Intrinsic and non-cell-autonomous roles for the neurodevelopmental syndrome-linked transcription factor UNC-3/EBF

Jayson J Smith; Seth R Taylor; Honorine Destain; Grace Kim; David H Hall; John G White; David M Miller, III; Paschalis Kratsios

doi:10.1038/s41467-026-76320-x

. 2026 Aug 11;17:9632. doi: 10.1038/s41467-026-76320-x

Intrinsic and non-cell-autonomous roles for the neurodevelopmental syndrome-linked transcription factor UNC-3/EBF

Jayson J Smith ^1,^2,^3,^✉, Seth R Taylor ^4,⁵, Honorine Destain ^1,², Grace Kim ⁶, David H Hall ⁶, John G White ⁷, David M Miller III ^4,^8,^✉, Paschalis Kratsios ^1,^2,^✉

PMCID: PMC13554116 PMID: 42711312

Abstract

Transcription factors are central to neuronal development, yet their functions beyond the cells in which they are expressed remain poorly understood. Here, we uncover unexpected non-cell-autonomous roles for UNC-3, a terminal selector of cholinergic motor neuron identity in C. elegans, whose human ortholog (EBF3) is linked to a neurodevelopmental syndrome. Single-cell RNA-sequencing reveals unc-3 loss in cholinergic motor neurons elicits pronounced transcriptional changes in GABAergic motor neurons that do not express unc-3, which can be rescued by cholinergic-specific UNC-3 restoration. Mechanistically, gene network analysis identifies the pro-regenerative bZIP factor CEBP-1/CEBPB as a key driver of these transcriptional changes. At the circuit level, unc-3 loss causes synaptic and axon pathfinding defects in GABA motor neurons alongside misregulation of neurite development genes. Finally, UNC-3 not only acts as a direct transcriptional activator but also suppresses inappropriate gene expression through indirect mechanisms. Together, these findings broaden terminal selectors as both intrinsic and extrinsic regulators of neuronal identity and circuit assembly, providing a mechanistic framework for understanding EBF3-associated neurodevelopmental disease.

Subject terms: Differentiation, Genetics of the nervous system

The non-cell-autonomous functions of transcription factors in neuronal development remain poorly understood. Here, the authors show that UNC-3, the C. elegans homolog of the neurodevelopmental disorder gene EBF3, regulates not only the development of UNC-3–expressing neurons but also that of neighboring neurons, revealing previously unrecognized mechanisms of neural circuit assembly.

Introduction

Studies of transcription factors (TFs) have typically focused on their intrinsic (cell-autonomous) roles in guiding the development and function of cell types that produce them, herein referred to as “host” cell types. This host cell-centric framework has shaped much of our understanding of TF biology, with comparatively limited attention to whether and how TFs exert influence beyond the cells in which they are expressed. As such, the extrinsic (non-cell-autonomous) functions of TFs in post-mitotic, synaptically connected neuron types remain poorly understood, despite their potential to impact circuit organization, intercellular communication, and human disease.

Terminal selector TFs epitomize this focus on intrinsic host cell regulation. Defined initially in the nematode Caenorhabditis elegans, terminal selectors are a specialized class of TFs that orchestrate the establishment and lifelong maintenance of neuron type-specific identities^1–3. Extensive work in C. elegans has revealed insights into how terminal selectors such as UNC-3/EBF1-4^4–9, UNC-30/PITX^10–13, and UNC-86/POU4F1-3^14,15 activate effector genes (e.g., neurotransmitter [NT] biosynthesis proteins, NT receptors, ion channels, and neuropeptides), which determine the identity and function of their host neuron types (reviewed in refs. ^2,16–19). To date, dozens of terminal selectors have been described for individual sensory, interneuron, and motor neuron (MN) types in the nervous system of nematodes (C. elegans), fruit flies (Drosophila), planarians (Schmidtea mediterranea), cnidarians (Nematostella vectensis), marine chordates (Ciona robusta), zebrafish (Danio rerio), and mice (Mus musculus)^{15,18,20–27} (reviewed in ref. ¹⁸), representing deeply conserved regulators for the control of neuron type identity. Studies across model systems continue to focus on the intrinsic roles of terminal selectors in their host neuron types^28–31. As such, whether and how terminal selectors (or more broadly any TF) impact the development of downstream, synaptically-connected neurons remains largely unknown.

UNC-3, the sole C. elegans ortholog of the highly conserved Collier/Olf/EBF (COE) family of TFs, functions as a terminal selector in the ventral nerve cord by controlling the identity of cholinergic MNs^4–9, defined herein as ‘host’ cells. UNC-3 is known to act as a direct transcriptional activator in these cells^4,8, which are further subdivided into five MN classes based on molecular^32,33, anatomical and functional criteria^34,35. However, the global effects of UNC-3 on the molecular identity of each MN class remain unknown, as only a handful of UNC-3 target genes per host MN class have been identified to date using candidate approaches^4,6,7. Notably, prior work showed that unc-3 activity in cholinergic MNs influences synaptic connectivity in downstream GABA MNs^36,37, but the extent to which unc-3 non-cell-autonomously impacts the development of these cells is unclear.

Loss-of-function mutations in the unc-3 human ortholog, EBF3, cause Hypotonia, Ataxia, and Delayed Development Syndrome (HADDS), also known as EBF3 Syndrome, a recently identified neurodevelopmental disorder characterized by motor dysfunction, muscle hypotonia, intellectual disability, and autism spectrum features^38–45. These broad and complex neurological phenotypes suggest that EBF3 plays intricate roles in both the central and peripheral nervous systems. However, our mechanistic understanding of the EBF3 syndrome remains limited as it is largely based on clinical data. Further, although cell-autonomous roles for Ebf3 have been described in cortical neuron migration in mice^46,47, its non-cell-autonomous impact on synaptically connected neurons remains unknown. Like unc-3 in C. elegans, EBF3 is expressed in human MNs^48–50. In addition, UNC-3 exhibits high amino-acid sequence similarity and conserved domain structure with EBF3 (Fig. 1A). Therefore, a mechanistic understanding of UNC-3’s regulatory roles in C. elegans, encompassing its effects both in host cells and downstream neurons, promises not only to advance our understanding of TF biology, but also to generate early insight into the EBF3 neurodevelopmental syndrome.

Fig. 1 — A Schematic of human EBF3 and *C. elegans* UNC-3 proteins. Red bar below UNC-3 shows region deleted in the *unc-3(n3435)* allele used for scRNA-seq and all genetic experiments in this study. Red octagon indicates the location of the *unc-3(e151)* nonsense mutation used for connectivity analyses in Fig. 8C-E. Conserved protein domains are listed above UNC-3, and amino acid (a.a.) similarity is indicated as a percentage between protein schematics. DBD, DNA binding domain (light blue); IDR, Intrinsically Disordered Region (pink); IPT, Immunoglobulin-like/Plexin/Transcription Factor (green); HLH, Helix-Loop-Helix (orange). B Schematic of host (UNC-3[+], green), downstream (UNC-3[-], blue), and sex-specific (UNC-3[-], black) MNs in the *C. elegans* VNC. RVG, Retrovesicular Ganglion; PAG, Preanal Ganglion. C Segment of the *C. elegans* motor circuit created in BioRender. Smith, J. (2026) https://BioRender.com/lu5fe23. d/vBWM, dorsal/ventral Body Wall Muscle. NMJ, Neuromuscular Junction. Green triangles = host MN to GABA MN synapse; Green triangle with asterisk = host MN dyadic synapse onto both GABA MN and BWM; Blue triangle = GABA MN to BWM synapse. D *lin-39p::RFP* reporter expression in WT (top) and *unc-3(-)* mutants (bottom). E Single-cell expression pattern of *lin-39p::RFP* reporter in WT Day 1 young adult VNC MNs. F ScRNA-seq strategy used to profile adult VNC MNs. G UMAPs of sequenced MNs derived from WT only (left, 2 biological replicates), *unc-3(-)* mutant only (middle, 3 biological replicates), or all MNs (right). Left and middle panels are colored by MN class; right panel is colored by genotype of origin. Numbers (i.e., 1-4) refer to mutant MN groups lacking clear wild-type counterparts. In right panel, green dotted line indicates the five wild-type-specific MN populations, blue dotted line indicates the three MN populations which are derived from both genotypes, and the grey dotted line indicates the four *unc-3(-)*-specific MN populations. H Bar plot depicting the total number of DEGs identified in each MN class.

Here, we leverage the powerful genetics and fully mapped nervous system^34,51–54 of C. elegans to uncover the effects of unc-3 loss not only in cholinergic (host) MNs, but also in downstream GABA MNs, which do not express unc-3^32,33, but receive direct cholinergic input from host MNs (Fig. 1B, C). To this end, we employ single-cell RNA sequencing (scRNA-seq) to identify in an unbiased manner transcriptional changes in both MN populations. In host MNs, we discovered a major role for UNC-3 in suppression of alternate neurotransmitter identities. In downstream GABA MNs, unc-3 loss triggers extensive non-cell-autonomous effects by altering their transcriptome, axonal path-finding, and synaptic connectivity. Further, unc-3 loss or disruption of acetylcholine (ACh) biosynthesis induces neuropeptide misregulation and the pro-regenerative bZIP TF CEBP-1/CEBPB in GABA MNs. Altogether, our study reveals critical roles for the terminal selector UNC-3/EBF in shaping both host neuron identity and downstream neuron development, offering a conceptual framework for understanding cell- and non-cell-autonomous functions of TFs associated with human disease.

Results

C. elegans nerve cord: a model for circuit-level TF studies

UNC-3 functions as a terminal selector in 50 cholinergic MNs (‘host’ cells) located in the C. elegans ventral nerve cord (VNC), a structure analogous to the vertebrate spinal cord⁵¹, and its flanking retrovesicular and preanal ganglia (RVG, PAG; Fig. 1B). An additional 19 GABA and six egg-laying MNs are in the VNC, RVG, and PAG, and do not express unc-3^32,33. All these MNs are categorized into eight distinct classes based on morphological and functional criteria (Fig. 1B). Of the five classes of cholinergic host MNs: two control forward locomotion (DB, VB)³⁵, two control backward locomotion (DA, VA)³⁵, and one class (AS) contributes to anterior-posterior bending wave propagation⁵⁵. In addition, two classes (DD, VD) of GABA MNs receive cholinergic input by host MNs⁵⁴, and are referred to here as ‘downstream MNs’. Last, the VC class is cholinergic and controls egg-laying³⁴ (Fig. 1B). These eight classes subdivide further into at least 29 molecularly distinct subclasses based on single-cell transcriptomic profiling^32,33. The coordinated activity of cholinergic host MNs and GABA downstream MNs propels the characteristic sinusoidal locomotion of C. elegans^34,35,51. Cholinergic MNs provide input both to GABA MNs and muscle via dyadic synapses (Fig. 1C)³⁵. To generate dorsal body bends, DA/DB classes of cholinergic MNs simultaneously stimulate dorsal muscle to contract and downstream GABA MNs (VD class), which in turn relax ventral muscle³⁵ (Fig. 1C). Conversely, to generate ventral body bends, VA/VB cholinergic MNs stimulate ventral muscle and a different class of GABA MNs (DD class)³⁵. Last, the lineage and connectivity of all these MNs have been mapped with high resolution^34,51, offering a well-characterized in vivo system to dissect the roles of UNC-3 both in host and downstream cells.

unc-3 affects the transcriptome of host and downstream cells

To identify the transcriptional impacts of UNC-3 in both cholinergic (host) and GABA (downstream) cells, we performed scRNA-seq on MNs isolated from day 1 adult hermaphrodites of wild-type (WT) and unc-3(n3435) strong loss-of-function mutant (unc-3(-), Fig. 1A) animals with two and three biological replicates, respectively. MNs were labeled with a lin-39p::RFP reporter, which marks 86% (50/58) of host and downstream MNs of the VNC and is unaffected by the loss of unc-3 (Fig. 1D-E). Cells were isolated through FACS and sequenced following established protocols^32,33,56 (Fig. 1F). In total, we captured 17,142 transcriptomes from WT and 46,425 transcriptomes from unc-3(-) animals. We annotated neuronal populations using the expression of known pan-neuronal marker genes (e.g., sbt-1, egl-21, egl-3, rab-3). In unc-3 mutants, MNs are still generated in wild-type numbers and express pan-neuronal marker genes⁴. We identified four groups of neuronal cells (Groups 1-4) that derived exclusively from unc-3(-) animals (Fig. 1G). We classified these as unc-3(-) MNs as they exhibited clear expression of pan-neuronal markers and midbody Hox genes (lin-39 and/or mab-5). Top markers for these unc-3(-) neuronal cells did not clearly align with any neuron class from the WT samples or reference datasets. Because single-cell transcriptomes for all C. elegans neurons, including the ventral nerve cord^32,33, also did not match these novel groups of neuronal cells, we reasoned that these cell populations represent unc-3(-) MNs that lost their original molecular identity. Further, the n3435 allele removes exons 2-5 and generates an in-frame deletion⁵⁷, which we confirmed by detecting unc-3 transcripts lacking exonic sequences 2-5 in the four unc-3(-) MN groups. All other neuronal populations from unc-3(-) animals were successfully annotated based on known marker genes^32,33. Together, these data indicate that all lin-39::RFP-labeled MNs that were known to express unc-3 in the WT are included in Groups 1-4 of unc-3(-) mutants. Overall, 9,269 WT and 9,682 unc-3(-) MN transcriptomes were identified across our biological replicates (Supplementary Data 1).

Given the striking molecular diversity recently uncovered among adult VNC MNs of WT animals^32,33, at least two hypothetical outcomes can be envisioned for the five host MN classes (DA, DB, VA, VB, AS) lacking unc-3: a uniform collapse of identity into a single undifferentiated state (i.e., erasure of class identities), or MN class-specific effects with varied degrees of identity loss. Similarly, for the three classes of MNs (DD, VD, VC) that do not express unc-3, at least three outcomes can be predicted in the unc-3(-) mutant: no effect, transcriptional disruption in all three classes, or class-specific effects.

To assess these possibilities, we performed computational integration and UMAP clustering of MN cells from both WT and unc-3(-) genotypes. This approach yielded 12 transcriptionally distinct MN populations, consisting of five WT-specific populations, four unc-3(-)-specific populations (Groups 1-4), and three populations shared between the two genotypes (Fig. 1G). By integrating differential expression analysis with known MN class-specific markers (Supplementary Data 1), we found that the five WT-specific clusters precisely corresponded to the five host MN classes (AS, DA, DB, VA, VB), whereas the three genotype-shared populations express molecular markers of the two downstream GABA classes (DD, VD) and the VC class (Fig. 1G, Supplementary Data 1). Notably, three unc-3(-)-specific MN populations (Groups 1-3) lack expression of class-specific markers (Fig. 1G, Supplementary Data 1), whereas the fourth unc-3(-) population (Group 4) exhibits partial transcriptomic similarity to wild-type AS MNs (Fig. 1G, Supplementary Data 1). As the lin-39p::RFP reporter remains mostly restricted to VNC MNs in the unc-3(-) background (Fig. 1D, E), we reasoned that the three mutant populations (Groups 1-3) represent host MN classes whose WT counterparts are the DA, DB, VA, VB neurons. Hence, scRNA-seq revealed that one class (AS) partially retains its original identity, whereas the remaining four classes of host MNs collapse into three mutant cell populations.

Next, we assessed the number of differentially expressed genes (DEGs) in each class as a metric for transcriptional disruption. We found that host MNs of the DA, DB, VA, VB classes (Groups 1-3) had the most DEGs (2,050), followed by the 5^th host class - AS MNs - which had 1,522 DEGs (discussed below, Fig. 1H, Supplementary Data 2). Surprisingly, even though the GABA (DD, VD) and VC MN classes do not express unc-3^32,33 and overlap in UMAP space between genotypes (Fig. 1G, Supplementary Fig. 1B, C), we found that the DD and VD neurons underwent significant transcriptomic disruption in the unc-3(-) mutant with 560 and 267 DEGs between genotypes, respectively, whereas the VC MNs were essentially unchanged (9 DEGs) (Fig. 1H). Unlike DD and VD neurons, VC MNs do not receive synaptic input from host MNs^34,54. Altogether, our scRNA-seq approach revealed that loss of unc-3 leads to class-specific effects on the transcriptomes of host and downstream MNs, effects that would have been masked in a bulk approach. In the ensuing sections, we provide an in-depth characterization of these transcriptional effects, beginning with host MNs and ending with downstream MNs.

AS MNs are partially resilient to unc-3 loss

The single-cell resolution of our molecular profiling approach revealed non-uniform effects of unc-3 loss on the five host MN classes: DA, DB, VA, and VB MNs lose their original identity, whereas AS MNs partially retain their molecular identity (Fig. 2A). To probe this further, we used NeuroPAL⁵⁸, a multicolor strain suitable for nervous system-wide cell identification and detection of neuronal identity changes based on fluorescent marker expression. Indeed, we found that AS MNs (green) as well as downstream (DD, VD) (blue) and VC (unlabeled) MNs retained their fluorescent color codes in unc-3(-) animals, whereas DA, DB, VA, and VB host MNs instead adopt a uniform dim-red color (Fig. 2B-C). These results are consistent with the notion that AS MNs are uniquely resilient to loss of UNC-3 among the host cholinergic MN classes.

In WT animals, the AS class is subdivided into four molecularly distinct subclasses: AS2-3, AS4-8, AS9-10, and AS11³³. Here, we observed that loss of unc-3 leads to the formation of four distinct mutant AS subclusters (Fig. 2A), suggesting that each of the four WT subclass identities might be partially retained. To test this idea, we assessed the expression of Hox genes, which delineate each AS subclass along the A-P axis of the VNC³³. One mutant AS subcluster included anterior Hox profile markers (ceh-13/HOXB1/HOXD1[+], mab-5/HOXB8/HOXC8[-]) indicating AS2-3 subclass identity, supported by its co-expression of egl-44/TEAD and igcm-4/FGFRL1, which uniquely label this subclass in WT³³ (Fig. 2D). Similarly, the anterior-midbody Hox gene lin-39/HOXA5 was highly enriched in one subcluster lacking mab-5, matching the AS4-8 subclass³³ (Fig. 2D). Only one subcluster expressed both lin-39 and mab-5, consistent with the WT AS9-10 posterior-midbody subclass³³ (Fig. 2D). The last AS subcluster showed the expected posterior Hox gene expression profile of AS11 (lin-39[-], mab-5[+]), supported by co-expression of vab-3/PAX6 and flp-7³³ (Fig. 2D). Altogether, this analysis mapped the unc-3(-) AS MN subclasses to their WT counterparts, suggesting that AS neuron identity partially persists in the absence of unc-3.

Supporting this idea, DEG analysis followed by reporter validation revealed partial effects of unc-3 loss in each AS subclass (Fig. 2E, F), with terminal identity gene categories (i.e., ion channels, neuropeptides, NT receptors) among the most affected (Supplementary Data 3, 4). For example, the GATA1/3 TF elt-1 and the vesicular ACh transporter unc-17/VAChT are both normally expressed in all AS neurons. In unc-3(-) mutants, elt-1 and unc-17 show partial reductions in anterior AS2-3 (elt-1: |log2FC | = 1.2; unc-17: |log2FC | = 5.4) and midbody AS4-8 subclasses (elt-1: |log2FC | = 1.6; unc-17: |log2FC | = 6.8), but remain unaffected (elt-1) or only moderately reduced (unc-17) in the posterior AS9-10 subclass (Fig. 2D, F). We independently confirmed these effects in unc-3(-) mutants using an endogenous elt-1 reporter (Fig. 2G). Similarly, the anterior-midbody HOX TF lin-39, which is expressed in both anterior and midbody AS subclasses of WT animals, is significantly reduced ( | log2FC | = 5.8) only in the anterior AS2-3 subclass of unc-3(-) animals. To further corroborate these findings, we used endogenous fluorescent reporters and NeuroPAL to validate UNC-3 repression of the TF egl-18/GATA4 in AS2-3 (Fig. 2H) and UNC-3 activation of mab-9/TBX20 in AS9-10 (Fig. 2I). Altogether, scRNA-seq and endogenous reporter data support a model in which UNC-3 contributes to AS subclass identity by regulating distinct TFs (Fig. 2J).

UNC-3 promotes host MN identity and limits ectopic expression

Prior work used candidate gene approaches to identify a limited number of UNC-3 target genes in cholinergic host MNs, supporting its role as a direct transcriptional activator^4,6–8. To uncover the global effects of unc-3 loss in host MNs in an unbiased manner, we performed pseudobulk comparisons between our scRNA-seq profiles of WT and unc-3(-) MNs. Because the transcriptional effects on AS MNs are described in detail above, we focus here on the remaining four classes (DA, DB, VA, VB) of host MNs (Fig. 2A). In total, we identified 929 activated (i.e., downregulated) transcripts in unc-3(-) MNs (False Discovery Rate [FDR] <0.05), including 49 target genes known to be activated by UNC-3, such as ACh biosynthesis components (e.g., cha-1/ChAT, cho-1/ChT, unc-17/VAChT)⁴, MN class-specific TFs (e.g., bnc-1/BNC1-2^7,8, ceh-12/MNX1⁴, unc-4/UNCX^4,59, vab-7/EVX1-2⁴), ion channels (e.g., nca-1/NALCN⁴, lgc-36/GABRA1-3⁷, slo-2/KCNT1-2⁹), and neuropeptides (e.g., nlp-21⁴, flp-18⁶) (Fig. 3A, Supplementary Data 3A). Strikingly, we identified even more repressed (i.e., upregulated) transcripts (1,121) in unc-3(-) host MNs, including six known UNC-3-repressed target genes (glr-5/GRIK4^5,9, lin-11/LHX1⁵⁹, ida-1/PTPRN2^9,59, ser-2/HTR1A⁹, lin-39/HOXA5⁶⁰, mab-5/HOX8⁶⁰). These results, supported by the validation of two repressed targets (ceh-6/POU3F, Supplementary Fig. 3E; egl-18/GATA4, Fig. 2H, Supplementary Fig. 3F) using fluorescent reporters, suggest a major role for UNC-3 in gene repression.

Fig. 3 — A Volcano plot of results from pseudobulk analysis showing all significant DEGs (False Discovery Rate, FDR < 0.05) in DA/DB/VA/VB MNs of WT vs. *unc-3(-)*. Green dot = UNC-3-activated (downregulated in *unc-3(-)*) gene; Pink dot = UNC-3-repressed (upregulated in *unc-3(-)*) genes. B Venn diagram depicting the integration of DEGs from scRNA-seq with UNC-3 ChIP-seq data⁸. Bar charts depicting WormCat2⁶¹ gene family enrichment of activated (C) or repressed (D) DEGs in host MNs overlayed with UNC-3 ChIP-seq data, as in (B). E Schematic of most significantly enriched motifs within UNC-3 ChIP-seq peaks in *cis*-regulatory loci of activated (top) or repressed (bottom) DEGs. The most significant motif for activated DEGs was UNC-3’s cognate COE binding motif (shown), whereas the top five motifs present in repressed DEGs are shown (left column). Middle column: Enrichment p-value and proportion of targets with indicated motif. Right column: TF with the closest matching DNA binding motif (JASPAR 2022⁶³) to those identified de novo in repressed DEGs (left column); Asterisk: HLH-11 motif similarity is only significant prior to multiple testing correction (p-value = 2.0e⁻³; q-value = 0.139). NA = No significant matches. We note that the limited size of the JASPAR 2022 nematode database (43 curated TF binding profiles)⁶³, may reduce statistical power for motif similarity analyses. F Top: schematic of a generic gene locus with relevant regions compared below. Bottom: proportions of UNC-3 ChIP-seq peaks in each genomic region were compared between activated and repressed DEGs using Fisher’s exact test (global) followed by post-hoc 2 × 2 Fisher’s exact tests (two-tailed) with Bonferroni correction (ns, not significant; Intronic p = 1.7e⁻¹⁰; promoter p = 1.8e⁻⁵). p > 0.05 = Not significant, ns; p < 0.05 = *; p < 0.01 = **; p < 0.001 = ***; p < .0001 = ****. Colors of asterisk/ns indicate respective categories compared in post-hoc tests.

As with the AS MNs, gene enrichment analysis (WormCat2.0)⁶¹ of activated and repressed targets in the remaining four host MNs revealed categories related to terminal neuronal identity and neuronal function, such as synaptic signaling, membrane transport, and metabolism (Fig. 3C, D, Supplementary Fig. 3B, D, Supplementary Data 5, 6). To determine whether the widespread effects of unc-3 loss on the transcriptomes of host MNs are direct or indirect, we integrated our scRNA-seq data with available UNC-3 ChIP-seq data⁸. We found UNC-3 ChIP-seq peaks at the cis-regulatory region of 58% of activated and 36% of repressed target genes (Fig. 3B). Because TF occupancy at active loci can reflect non-specific high-occupancy target (HOT) binding, we next asked whether UNC-3 binding at DEGs exceeded appropriate background expectations. We compared DEGs to expression-matched non-DEGs and performed HOT site-aware analysis (see Methods). Targets activated by UNC-3 showed significant enrichment for UNC-3 binding relative to non-DEG controls, particularly at non-HOT regions (Supplementary Fig. 4A–E), suggesting their direct activation by UNC-3 in a HOT-independent manner. In contrast, UNC-3 repressed targets exhibited weaker enrichment, consistent with a larger contribution of indirect regulation (Supplementary Fig. 4A–E). Altogether, the unbiased identification of UNC-3-responsive genes in host MNs supports a dual role for UNC-3 in shaping host MN transcriptomes. Based on the 929 downregulated genes, many of which are associated with UNC-3 occupancy enrichment over matched DEG controls, UNC-3 acts chiefly as a direct transcriptional activator to establish and maintain host MN identity, consistent with prior work^4,6–8. Further, the identification of 1,121 upregulated genes points to an additional role for UNC-3 in suppressing gene expression programs in host MNs, at least in part through indirect mechanisms.

UNC-3 occupies distinct motifs at repressed targets

Prior work in host MNs showed that UNC-3 directly activates dozens of terminal identity genes via its cognate DNA-binding site (TCCCNNGGGA)^4,5,8, termed the COE motif. However, the precise mechanisms through which UNC-3 represses gene expression in host MNs remain poorly understood. The integration of scRNA-Seq and ChIP-Seq data suggests that UNC-3 can occupy cis-regulatory loci at repressed target genes (Fig. 3B). To investigate this possibility at the genomic level, we performed motif enrichment analysis (HOMER, see Methods) on sequences contained within UNC-3 ChIP-seq peaks in activated or repressed DEGs in host MNs. The COE motif was the most enriched sequence within UNC-3 ChIP-seq peaks of activated target genes (Fig. 3E, Supplementary Data 7), corroborating a direct role for UNC-3 in transcriptional activation^4,5,8. Surprisingly, however, the COE motif was not strongly enriched within UNC-3 peaks associated with repressed targets (Fig. 3E, Supplementary Data 8), suggesting that UNC-3 occupancy at these loci may primarily occur through indirect recruitment, cooperative binding, or context-dependent interactions distinct from canonical COE motif recognition. Indeed, motif enrichment analysis of UNC-3-bound repressed targets identified multiple non-COE motifs (Fig. 3E, Supplementary Data 7). Comparison of these motifs against the JASPAR 2022 nematode motif database⁶² revealed a nominal similarity to the motif bound by the bHLH TF HLH-11/TFAP4 (Fig. 3E). Notably, hlh-11 is co-expressed with UNC-3 in VNC MNs, raising the possibility that UNC-3 regulates a subset of repressed targets through cooperative or indirect interactions with HLH-11.

To independently validate COE site enrichment in UNC-3-activated targets, we used TargetOrtho2^63–65, which identified COE motifs in 61.3% (330/538 genes) of UNC-3-bound activated targets but only 24.4% (99/405) of UNC-3-bound repressed targets (Supplementary Fig. 5A, B, Supplementary Data 9). To gain further insight into UNC-3 binding at repressed loci, we examined the genomic distribution of UNC-3 ChIP-seq peaks in the cis-regulatory regions of DEGs. UNC-3 equally occupied introns and promoters in activated targets but showed a strong preference for promoters in repressed targets (Fig. 3F). Thus, UNC-3-associated repressed loci differ markedly from activated targets by showing reduced COE motif enrichment and strong promoter-biased occupancy, consistent with regulatory mechanisms that may involve indirect recruitment by or cooperative interactions with other TFs.

UNC-3 suppresses alternate identity features in host MNs

To further probe the repressor role of UNC-3 in host MNs, we focused on gene enrichment categories of UNC-3-repressed targets (Fig. 3D). We found an overrepresentation of neuronal and cell-cell signaling-related categories, including neuropeptides, G protein-coupled receptors, and homeodomain TFs (Supplementary Fig. 3B, D). Strikingly, we also observed NT identity genes normally restricted to other neuron classes. These included GABA (unc-46/LAMP, unc-47/VGAT), glutamatergic (eat-4/VGLUT), and monoaminergic (cat-1/VMAT, tph-1/TPH1-2) identity genes (Fig. 4A). We independently validated the ectopic expression of these five genes in unc-3(-) host MNs using fluorescent reporters (Fig. 4B, S6A–E).

Fig. 4 — A Heatmap depicting differential expression (Transcripts per million, TPM) of alternative NT identity genes in WT vs. *unc-3(-)*. B Quantification of host MNs expressing reporters for alternative NT identity genes. All pairwise statistical tests were two-tailed (*unc-47* p = 5.6e⁻⁷; *unc-46* p = 1.5e⁻⁴; *eat-4* p = 3.5e⁻⁹; *cat-1* p = 1.9e⁻³; *tph-1* p = 5.5e⁻⁴. C Feature plots showing ectopic expression of alternative NT identity genes is non-uniform across mutant MNs. D Micrographs of *unc-47/*GABA and *eat-4*/glutamatergic reporters in WT or *unc-3(-)* animals. Magenta and green arrowheads indicate host MNs ectopically expressing *unc-47* or *eat-4*, respectively. GABA MNs are circled in blue. **D’-D”** Insets of *unc-47* or *eat-4* expression from yellow boxes in (D). Quantification of host MNs ectopically expressing the *unc-47* (E, p = 2.9e⁻¹⁰) or *eat-4* (F, p = 3.6^e⁻⁴⁾ reporters. Compared using a two-tailed Wilcoxon test. G Schematic of UNC-3 as a dual transcriptional regulator in host MNs. H Strategy for temporal UNC-3 depletion coupled with quantification of *unc-47* expression in host MNs. I Micrographs of UNC-3::mNG::AID expression in control or auxin-treated animals. J Quantification of host MNs expressing UNC-3::mNG::AID in control or auxin-treated animals (p = 2.7e⁻¹⁵)^. K Micrographs of *unc-47* in control or auxin-treated animals. L Quantification of host MNs ectopically expressing *unc-47* in control or auxin-treated animals (p = 4.6e⁻⁴). All quantifications were performed at the young adult stage. Number of animals (N) is listed in each plot. Statistical tests were selected based on data distribution: Normally distributed data (Shapiro-Wilk p > 0.05 in both groups) with equal variances (Levene’s test p > 0.05) = Student’s t-test; normally distributed with unequal variances = Welch’s t-test; non-normal data or zero expression = Wilcoxon rank-sum test. For all tests, p > 0.05 = Not significant, ns; p < 0.05 = *; p < 0.01 = **; p < 0.001 = ***. All pairwise statistical tests were two-tailed. Box-plot elements: thick horizontal line (red) = median; box = 25th to 75th percentiles; whiskers extend to the furthest data point within 1.5 × IQR from the quartiles (or the min/max if all points within this range); individual data points are overlaid as black dots. Source data are provided as a Source Data file.

Next, we asked whether host MNs in unc-3(-) animals ectopically co-express multiple alternate NT identity genes (e.g., dual NT identity), or if they are subdivided into groups each expressing a distinct NT identity. To this end, we examined individual unc-3(-) MNs for co-expression of GABA (unc-46, unc-47), glutamatergic (eat-4), and monoaminergic (cat-1) identity markers. We noted that Group 1 expresses unc-47 and unc-46, but lacks eat-4 and cat-1 (Fig. 4C). Consistently, animals that simultaneously carry a red (mChOpti) reporter for unc-47/VGAT and a yellow (YFP) reporter for eat-4/VGLUT did not show any overlapping expression in individual unc-3(-) host MNs (Fig. 4D–F, Supplementary Fig. 6F, G). Using a similar analysis, we identified two additional groups. Group 2 contains cells that either express glutamatergic (eat-4), GABA (unc-46, unc-47), or monoaminergic (cat-1) markers, whereas Group 3 only expresses low levels of the eat-4 glutamatergic marker. Altogether, the single-cell resolution of RNA-seq revealed that, in the absence of UNC-3, host MNs are divided into several groups, each adopting molecular features indicative of a distinct NT identity: MNs of Group 1 acquire GABA features, MNs of Group 2 can adopt features of three alternate NT identities, and MNs of Group 3 can acquire glutamatergic features (Fig. 4G).

To determine whether unc-3(-) host MNs fully or partially adopt alternate NT identities, we focused on Group 1. Although unc-46/LAMP and unc-47/VGAT are ectopically co-expressed in this group (Fig. 4A–C), other core GABA NT identity features, such as the biosynthetic enzyme gene unc-25/GAD, were unaffected (Supplementary Fig. 1A). Further, unc-30/PITX, the terminal selector of GABA MN identity and direct activator of unc-46 and unc-47^10–13, was neither ectopically expressed in host MNs of unc-3 mutants nor bound by UNC-3 at its cis-regulatory sequences (Supplementary Fig. 7A, B). Instead, analysis of ChIP-seq⁸ and TargetOrtho2 data revealed UNC-3 occupancy at a non-COE motif in the unc-47/VGAT promoter (Supplementary Fig. 6A). Collectively, these results argue against cell fate transformation, supporting instead a model where UNC-3 acts to suppress latent alternate NT identity features to secure the cholinergic NT identity of host MNs.

UNC-3 continuously suppresses GABA NT identity in host MNs

UNC-3 is expressed throughout life in adult host MNs to maintain the expression of ACh biosynthesis genes⁸. To test whether UNC-3 also continuously suppresses alternative NT identity genes, we used the auxin-inducible degron (AID) system⁶⁶ to acutely deplete UNC-3 in late larval/early adult stages. We started auxin treatment at larval stage 4 (L4), by which time all nerve cord MNs have differentiated, and discontinued auxin treatment after 24 h - at day 1 of adulthood (Fig. 4H). After confirming efficient UNC-3 depletion in day 1 adult MNs (Fig. 4I, J), we observed a mild hypomorphic effect on unc-47/VGAT expression in control animals (Figs. 4E, 4L) but robust ectopic expression in host MNs of animals treated with auxin (Fig. 4K, L), indicating that UNC-3 activity is required in late larval/early adult life to suppress alternate NT identity genes.

Transcriptional dysregulation of GABA MNs in unc-3 mutants

In post-mitotic neurons, TFs have been typically studied within their host neuron types. Whether and how TFs control the development of downstream post-mitotic neurons remains largely unknown. To address this question, we systematically characterized the transcriptomes of GABA MNs (DD/VD) in unc-3(-) animals. Our scRNA-seq data show that GABA NT identity markers, such as unc-25/GAD, unc-47/VGAT, and gta-1/GABA-T, remain unchanged in GABA MNs of unc-3(-) mutants (Supplementary Fig. 8A). Additionally, unlike host MNs, we observed no ectopic expression of alternative NT identity genes (e.g., cholinergic, glutamatergic) in GABA MNs (Supplementary Data 2). However, we observed other extensive transcriptomic changes in GABA MNs of unc-3(-) animals with 560 DEGs in DD MNs and 267 DEGs in VD MNs, most of which were upregulated (Fig. 5A). These effects appear specific to downstream GABA MNs, as we only identified 9 DEGs in VC MNs (Fig. 5A). Most DEGs were specific to anterior-midbody GABA MN subclasses, with 68% (256/377 genes) of DD-specific DEGs unique to DD2-3 subclass and 92% (77/84 genes) of VD-specific DEGs unique to VD3-7 subclass (Fig. 5B, Supplementary Fig. 8B, C). Given that UNC-3 is not expressed in the embryonic lineage of (or mature) DD or VD MNs (Supplementary Fig. 9A-B”)^67–69, and that DD/VD MN DEGs show no enrichment for UNC-3 ChIP-seq binding relative to expression-matched non-DEGs (observed = 0.37, null mean = 0.48, p-value = 1; Supplementary Fig. 4F–H), these results suggest a non-cell-autonomous impact of unc-3 on the transcriptomes of downstream GABA cells.

Fig. 5 — A Number of DEGs in non-host MNs (DD, VD, VC). B Top: Shared and unique DEGs by GABA MN subclass. Numbers represent counts of unique DEGs in each subclass and percentages provide fraction of total. Bottom: *C. elegans* GABA MN subclasses color matched to Venn diagram. C Gene enrichment (WormCat 2.0⁶¹) analysis for DEGs in downstream (DD/VD) MNs. Dot sizes correspond to gene counts; dot colors correspond to -log₁₀(p-Value). D DEG enrichment across categories by regulation (upregulated = green; downregulated = pink) and MN class. Dot sizes correspond to gene counts. E Micrographs depicting endogenous *dmsr-6* expression in the VNC of WT, *unc-3(-)*, and *unc-3(-)* mutants with UNC-3 cDNA rescue construct. GABA MNs are circled in blue. Asterisks and blue arrowheads indicate host/cholinergic and downstream/GABA MNs, respectively. FNumber of GABA MNs expressing *dmsr-6* in WT, *unc-3(-)*, and *unc-3(-)* siblings without and with UNC-3 cDNA rescue. Groups were statistically compared via a Kruskal-Wallis test, p-values provided for significant and relevant comparisons: WT-*unc-3(-)* p = 6.0e⁻⁵; WT-*unc-3(-)/cDNA(-)* p = 3.3e⁻³; *unc-3(-)/cDNA(-)-unc-3(-)/cDNA(+)* p = 7.2e⁻³. ns, not significant. **G–H** Number of VNC MNs expressing endogenous *dmsr-6* reporter in wild-type animals or animals harboring mutations in components of cholinergic synaptic neurotransmission (G, WT-*unc-3(-)* p = 4.1e⁻⁵; WT-*cha-1*(15 °C) p = 2.6e⁻²; WT-*cha-1*(25 °C) p = 1.4e⁻³; WT-*unc-17*(-) p = 3.5e⁻²; *unc-3(-)-unc-17(-)* p = 9.5e⁻³) or neuropeptidergic signaling (H, WT-unc-3(-) p = 7.0e⁻⁵; *unc-3(-)-unc-31(-)* p = 2.8e⁻⁵; WT-unc-3(-)/unc-31(-) p = 2.5e⁻³; *unc-31(-)-unc-3(-)/unc-31(-)* p = 9.4e⁻⁴). All quantifications were performed at the young adult stage. The number of animals (N) is listed in each plot. Kruskal-Wallis tests were performed, followed by two-tailed Dunn’s post-hoc test with Benjamini-Hochberg multiple comparisons adjustment (Shapiro-Wilk test in groups with n ≥ 5 and SD > 0). Global Kruskal-Wallis p-value is displayed at the top. For pairwise comparisons, p < 0.05 = *; p < 0.01 = **; p < 0.001 = ***. Only relevant comparisons are shown. Box-plot elements: thick horizontal line (red) = median; box = 25th to 75th percentiles; whiskers extend to the furthest data point within 1.5 × IQR from the quartiles (or the min/max if all points within this range); individual data points are overlaid as black dots. Source data are provided as a Source Data file.

To determine which biological processes are dysregulated in downstream (DD, VD) MNs in the absence of unc-3, we conducted gene enrichment analysis. DEGs were enriched for a variety of biological categories, including neuronal function (e.g., neuropeptides), cytoskeletal organization, signaling (e.g., GPCRs), and extracellular matrix (Fig. 5C-D, Supplementary Data 10-13). To validate these effects, we independently confirmed dysregulation of genes involved in vesicle sorting and trafficking (unc-46/LAMP)¹², synapse remodeling (oig-1)⁷⁰, and transcriptional regulation (mab-9/TBX20) using fluorescent reporters in downstream GABA MNs of unc-3(-) mutants (Supplementary Fig. 10). Altogether, these findings suggest that UNC-3 non-cell-autonomously impacts multiple biological processes in downstream GABA MNs.

UNC-3 impacts neuropeptide signaling in downstream GABA MNs

Studies in invertebrates^71–78 and vertebrates^79–83 have highlighted neuropeptides as important modulators of locomotion, with implications for MN disease^84–86. Given that host and downstream GABA MNs express cognate neuropeptide-receptor pairs^33,87, and that UNC-3 activates neuropeptide gene expression in host MNs^4,6,88, we asked whether unc-3 loss in host MNs affects neuropeptidergic gene expression in downstream GABA MNs.

Indeed, scRNA-Seq uncovered a significant dysregulation of neuropeptide and neuropeptide receptor genes both in host (79 genes) and downstream (15 genes) MNs of unc-3(-) animals (Supplementary Fig. 11A, B). For example, validation using an endogenous fluorescent reporter for the neuropeptide nlp-11 showed increased expression in both MN populations of unc-3(-) animals (Supplementary Fig. 11C). Among the nine neuropeptide receptor genes that were significantly dysregulated in GABA MNs, two were upregulated: the FMRFamide receptor frpr-5 and the DroMyoSuppressin G-Protein Coupled Receptor (GPCR) dmsr-6 (Supplementary Fig. 11B), both of which are implicated in control of locomotion^89–92. Interestingly, frpr-5 is dysregulated in both host and downstream MNs of unc-3(-) mutants, whereas dmsr-6 was only upregulated in downstream MNs (Supplementary Fig. 11B), a finding we validated using an endogenous fluorescent reporter (Fig. 5E, F).

We next evaluated whether the dmsr-6 upregulation in downstream MNs can be rescued by reintroducing UNC-3 specifically in host MNs of unc-3(-) animals and found this to be the case (Fig. 5E, F), supporting the notion that UNC-3 acts non-cell autonomously to suppress neuropeptide receptor (dmsr-6) expression in downstream MNs. Taken together, these results suggest a broad role for the terminal selector UNC-3 in controlling neuropeptide signaling within the C. elegans motor circuit via cell and non-cell autonomous mechanisms in host and downstream GABA MNs, respectively.

UNC-3 effects on GABA MNs depend on ACh biosynthesis

How can the loss of unc-3 in host MNs lead to gene expression changes in downstream MNs? One possibility is that UNC-3 functions early in the GABA MN lineage such that its loss impacts the development of post-mitotic GABA MNs. This possibility seems unlikely, however, as our analysis of single-cell transcriptional⁶⁷ and proteomic⁶⁸ atlases throughout embryogenesis failed to detect appreciable levels of unc-3/UNC-3 early in the DD or VD MN lineages (Supplementary Fig. 9A, B”).

Another possibility is that UNC-3 acts in host MNs to control cell-cell signaling pathways (e.g., synaptic signaling or secreted cues) essential for downstream GABA MN development or function. To address this possibility, we focused on dmsr-6 as a test case because it is specifically upregulated in downstream MNs of unc-3(-) animals (Fig. 5E, F). Because host MNs provide cholinergic (excitatory) input to downstream GABA MNs and UNC-3 controls the expression of ACh biosynthesis genes in host MNs^4,5,8, we first asked whether blocking cholinergic transmission alone is sufficient to induce upregulation of dmsr-6 in downstream MNs. Indeed, disruption of ACh biosynthesis either globally using a temperature-sensitive allele (y226) for cha-1 (ChAT), or specifically in host MNs using a regulatory mutation (e113)^4,36 upstream of the conserved unc-17 (VAChT)/cha-1 (ChAT) gene locus increased dmsr-6 expression in GABA MNs (Fig. 5G). The e113 allele carries a C > T substitution in the COE binding motif (Supplementary Fig. 12), which disrupts UNC-3-dependent transcriptional activation of the unc-17 (VAChT)/cha-1 (ChAT) cholinergic locus in host MNs⁴. Because unc-3 is not expressed in the majority of C. elegans cholinergic neurons⁹³, this regulatory mutation (e113) limits the disruption of cholinergic transmission primarily to host MNs of the motor circuit. We conclude that dmsr-6 upregulation in downstream MNs depends on UNC-3-controlled ACh biosynthesis, and thereby cholinergic neurotransmission from host MNs.

Next, we asked whether additional cell-cell signaling mechanisms downstream of UNC-3 might contribute to dmsr-6 upregulation in GABA MNs. Since neuropeptide gene expression is significantly disrupted in both host and GABA MNs in the absence of UNC-3 (Supplementary Fig. 11), we next investigated whether blockade of neuropeptide release also affects dmsr-6 expression. Homozygous animals for a null allele (e928) of unc-31/CAPS, a gene required for neuronal neuropeptide release by dense core vesicles⁹⁴, showed no effect on dmsr-6 expression in GABA MNs (Fig. 5H). Further, unc-3(-); unc-31(e928) double mutants did not suppress the effect seen in unc-3(-) single mutants (Fig. 5H). We conclude that the influence of UNC-3 on gene expression in downstream MNs depends on cholinergic input from host MNs and is independent of neuronal neuropeptide release.

unc-3 loss triggers a CEBP-1-mediated response in GABA MNs

The observation that cholinergic (host) MN input is sufficient to regulate dmsr-6 expression in downstream GABA MNs suggests the involvement of neuronal activity-dependent transcriptional programs⁹⁵. However, we detected no changes in the expression of known neuronal activity-dependent TFs (e.g., crh-1/CREB⁹⁶, fos-1/ATF2⁹⁷, egl-43/MECOM⁹⁷, Supplementary Data 2) in downstream MNs of unc-3(-) animals. We also investigated several stress-induced TFs (e.g., daf-16/FOXO4⁹⁸, hsf-1/HSF1-2⁹⁹, ets-5/FEV/Pet1¹⁰⁰, Supplementary Data 2) but found no dysregulation at the transcript level.

To identify in an unbiased manner candidate TFs that mediate non-cell-autonomous transcriptional changes in downstream MNs of unc-3(-) animals, we used the recently published CelEst gene regulatory networks (GRNs) inference algorithm¹⁰¹ (see Methods). As a control, we first tested the approach on host MNs. CelEst correctly identified reduced UNC-3 activity as the dominant driver of transcriptional changes in these cells (Fig. 6A). When applied to downstream MNs, the same unbiased analysis suggested that increased activity of the conserved CCAAT/enhancer-binding protein (C/EBP) family bZIP TF CEBP-1 is the most likely driver (Fig. 6A). Consistent with this prediction, cebp-1 expression was sharply upregulated in neighboring MNs of unc-3(-) mutants (Supplementary Data 2). Using an endogenous translational reporter, we confirmed CEBP-1 upregulation in both DD and VD GABA MNs in unc-3 mutants and observed a similar increase in its expression using the unc-17(e113) regulatory allele (Fig. 6B–D), indicating that reduced cholinergic transmission itself is sufficient to induce CEBP-1 in downstream MNs. Integration of our unc-3(-) scRNA-seq dataset with a published CEBP-1 ChIP-seq dataset¹⁰² revealed that ~20% (42/212) of CEBP-1 genomic targets were upregulated in GABA MNs, suggesting CEBP-1 regulates their expression (Fig. 6E, F). Altogether, these data indicate that loss of unc-3 or disruption of cholinergic transmission from host MNs triggers a CEBP-1-mediated transcriptional response in downstream GABA MNs.

Fig. 6 — A Heatmap showing *Cel*Est¹⁰³ estimated TF activity (columns) driving differential expression between WT and *unc-3(-)* genotypes for host and downstream MNs (rows). Positive values (red-yellow) indicate increased transcription factor activity, whereas negative values (blue) indicate decreased activity. B, C Representative micrographs (top) of endogenous CEBP-1::EGFP expression in WT (A) and *unc-3(-)* (B) animals, with insets (bottom) of DD and VD MNs. DFluorescence intensity quantifications of CEBP-1::EGFP in GABA MNs of WT, *unc-3(-)*, and *unc-17(e113)* animals. Quantifications were performed at the young adult stage. N = 10 animals per genotype. Groups were statistically compared globally via a Kruskal-Wallis test followed by two-tailed Dunn’s post-hoc test with Benjamini-Hochberg multiple comparisons adjustment, with p-values provided for significant and relevant comparisons; WT-*unc-3(-)* p = 1.3e⁻¹⁷; WT-*unc-17(-)* p = 2.0e⁻⁶; *unc-3(-)-unc-17(-)* p = 2.1e⁻⁴. p > 0.05 = Not significant, ns; p < 0.05 = *; p < 0.01 = **; p < 0.001 = ***. Box-plot elements: thick horizontal line (red) = median; box = 25th to 75th percentiles (interquartile range); whiskers extend to the furthest data point within 1.5 × IQR from the quartiles (or the min/max if all points lie within this range); individual data points are overlaid as black dots. E Venn diagram depicting the integration of DEGs from scRNA-seq (this study) with CEBP-1 ChIP-seq data¹⁰⁴. F Dot plot of CEBP-1 ChIP-seq targets¹⁰⁴ that are expressed in GABA/downstreams MNs. Dot sizes convey absolute value of the log fold change (|logFC|) in gene expression, and dot color conveys regulation (upregulated in mutant = green; downregulated in mutant = pink). We note that all CEBP-1 target gene transcripts that were dysregulated in *unc-3(-)* animals were upregulated (green). Source data are provided as a Source Data file.

unc-3 loss in host MNs causes axon defects in GABA MNs

The significant transcriptomic effects we observed in downstream GABA MNs prompted assessment of their morphology in unc-3(-) animals. Using a GABA MN-specific fluorescent reporter (juIs223[ttr-39p::mCherry]), we identified four distinct phenotypes.

First, we observed axon guidance defects. In WT animals, GABA MN commissures typically project on the right side of the animal to reach the dorsal nerve cord^34,35. In unc-3(-) animals, however, 20% of GABA MN axons were located on the wrong (left) side (i.e., ‘reversed’) at both early larval (L1) and young adult stages (Fig. 7A, Supplementary Fig. 13A, B). These reversals occurred without changes in the total number of commissures, suggesting an axon guidance phenotype (Fig. 7A, Supplementary Fig. 13C, E). Second, whereas WT GABA MN axons bundle tightly together in the VNC, their axons display splitting or ‘defasciculation’ phenotypes in the unc-3(-) animals (Fig. 7B), reminiscent of cell adhesion defects^36,103,104. Third, we observed increased GABA MN axonal gaps in the ventral nerve cord (Fig. 7B, C). Last, GABA MNs consistently exhibited axonal misrouting and ectopic branching around the vulva in unc-3(-) animals (Fig. 7D, E).

Fig. 7 — A Left: Representative fluorescence micrographs of *ttr-39p::mCherry* expression in GABA VNC MNs seen ventrally (top) with schematic representations (bottom). Right: Percentage of right- vs. left-sided axonal/commissural paths (p = 2.0e⁻¹²) and percentage of scored animals with this defect (p = 2.6e⁻⁸) in wild-type vs. *unc-3(-)* backgrounds. Compared via Fisher’s exact test (two-tailed), p > 0.05 = Not significant, ns; p < 0.05 = *; p < 0.01 = **; p < 0.001 = ***; p < 0.00001 = ****. **B–C** Representative micrographs of GABA MN morphology in WT vs. *unc-3(-)* animals. Mutants display significantly more splits in the nerve fascicle (arrowheads, B, p = 3.1e⁻⁵) and more gaps in the nerve cords (asterisks, C, p = 3.4e⁻²) as visualized using the GABA MN-specific reporter. Quantifications were performed at the young adult stage. Number of animals (N) is listed on each plot. Wilcoxon rank-sum tests (two-tailed) were selected based on non-normal data; p < 0.05 = *; p < 0.01 = **; p < 0.001 = ***. Box-plot elements: thick horizontal line (red) = median; box = 25th to 75th percentiles (interquartile range); whiskers extend to the furthest data point within 1.5 × IQR from the quartiles (or the min/max if all points lie within this range); individual data points are overlaid as black dots. D Left: Representative micrographs of ectopic branching near the vulva in *unc-3(-)* compared to WT. Right: Stacked bar plot showing percent of animals with defects (p = 1.5e^-2). N = 13 animals. Compared via Fisher’s exact test (two-tailed), p > .5 = Not significant, ns; p < 0.05 = *; p < 0.01 = **; p < 0.001 = ***; p < 0.00001 = ****. E Schematic summary 0of morphological defects in GABA MNs of *unc-3(-)* animals assessed in (A–D). Dot plots showing DEGs encoding ligands and receptors (F) or TFs (G) associated with neurite (i.e., axon, dendrite) development. The gene list was derived from a recent review¹⁰⁷. Dot sizes convey absolute value of the log fold change (|logFC|) in gene expression, and dot color conveys regulation (upregulated in mutant = green; downregulated in mutant = pink). Source data are provided as a Source Data file.

What is the molecular foundation of these axon pathfinding defects? To address this question, we cross-referenced our scRNA-seq dataset with a comprehensive list of in vivo validated genes that control neurite development (reviewed here¹⁰⁵). We found dysregulation of neurite development genes in GABA MNs of unc-3(-) animals (Fig. 7F), including integrin (pat-3/ITGB1) and the Netrin receptor (unc-40/DCC). We also observed dysregulation of genes that mediate axonal (eva-1/EVA1C, wrk-1/HMCN1) and dendritic (dma-1/LRR) guidance. Finally, genes encoding TFs that regulate neurite development¹⁰⁵ and regeneration^106–108 (egl-46/INSM2, hlh-3/ASCL1) were also dysregulated in GABA MNs (Fig. 7G), revealing potential molecular mediators of the morphological phenotypes identified in unc-3(-) animals. Interestingly, we also found dysregulation of neurite development genes (e.g., unc-6/Netrin, unc-40/DCC, wrk-1/HMCN1) in host MNs (Fig. 7F, G), likely explaining the previously described axonal defects of unc-3(-) host MNs (Fig. 1D)^4,59,69. Altogether, both transcriptomic and morphological analyses support a non-cell-autonomous role for UNC-3 in coordinating axonal/neurite development in downstream GABA MNs.

UNC-3 influences downstream GABA MN connectivity

To assess whether the connectivity of downstream GABA MNs is affected in unc-3(-) animals, we first cross-referenced our scRNA-seq dataset with two comprehensive lists of C. elegans synaptogenesis molecules^109,110. We found that both host and downstream cells exhibited changes in pre- and post-synaptic genes, which govern neuronal output and input¹¹¹, respectively (Fig. 8A, B, Supplementary Fig. 14). In the GABA MN circuitry, most outputs are onto body wall muscles (BWMs), and most inputs come from cholinergic host MNs^34,35 (Supplementary Fig. 15). Importantly, GABA MNs form almost no gap (i.e., electrical) junctions with host MNs (Supplementary Fig. 16A)^51,54. Consistently, genes encoding innexins or other gap junction subunits were not affected in GABA MNs in the absence of unc-3 (Supplementary Fig. 16B).

Fig. 8 — Dot plots showing DEGs encoding postsynaptic components (A) and synaptic organizers and extrinsic cues for synapse development (B). Dot size conveys the absolute value of the log fold change (|FC|) in gene expression, and dot color conveys regulation (upregulated = green; downregulated = pink). C Representative electron microscopy (EM) micrographs of cross-sections of a WT (N2U) and an *unc-3(-)/Df* animal (top) with schematic representations (bottom). D Synaptic inputs (left of axon/soma) and outputs (right of axon/soma) of the VD3 GABA MN in the WT and *unc-3(-)/Df* backgrounds. E Summary of scRNA-seq and genetic analyses, showing a role for cholinergic input in the non-cell-autonomous dysregulation of neuropeptide signaling (e.g., *dmsr-6*), neuronal injury/repair (CEBP-1 and effectors), synaptogenesis (e.g., AChR genes *acr-9, deg-3*), and axon pathfinding/neurite development (e.g., *unc-40/DCC, clr-1/RPTP*) in downstream MNs. Question marks indicate processes/pathways (AChR and Netrin genes) that are non-cell-autonomously impacted by UNC-3 but were not specifically assessed for loss of cholinergic signaling alone.

In DD MNs, expression of two genes implicated in synaptic output^112,113 - snt-6/SYT7 (Synaptotagmin) and sng-1/SYNGR2/4 (Synaptogyrin) - was reduced (Supplementary Fig. 14A, Supplementary Data 2). Expression of genes that mediate synaptic inputs was also disrupted in DDs (Fig. 8A), including a reduction in ACh receptor (AChR) genes, which mediate host MN signaling to downstream MNs. Specifically, three AChR genes, deg-3/CHRNA7-2, acr-9/CHRFAM7A/CHRNA7 and gar-2/CHRM3, were downregulated (Fig. 8A). Interestingly, expression of transcripts for the five subunits of the core pentameric AChR/CHRNA complex (acr-12, unc-38, unc-63, unc-29, lev-1)³⁷ was unaffected in downstream cells (Fig. 8A), despite the reported mislocalization of their corresponding proteins in DD MNs of unc-3(-) mutants^37,114.

Given these changes in synaptic gene expression, we next evaluated the expression of 31 conserved genes involved in extrinsic pathways known to guide synapse formation in C. elegans¹⁰⁹. Three - unc-40/DCC, clr-1/RPTP, and madd-4/Punctin - were non-cell-autonomously affected in DD MNs (Fig. 8B). The first two genes, unc-40/DCC and clr-1/RPTP, were upregulated in the mutant and encode receptors that together with their ligand UNC-6/Netrin, form a Netrin signaling pathway critical for synaptic partner recognition in other neurons in C. elegans¹¹⁵, suggesting a similar mechanism may mediate downstream MN synaptic connectivity. The third gene, madd-4/Punctin, was downregulated and encodes a secreted synaptic organizer from MNs that induces GABA receptor clustering in postsynaptic muscle cells^5,116,117. Together, these results suggest that unc-3 non-cell-autonomously impacts molecular features that determine synaptic input and output of downstream GABA MNs.

To complement this molecular analysis, we analyzed electron microscopy (EM) data (see Methods). Due to the axon pathfinding defects, we were unable to identify with confidence the DD neurons in the unc-3(-) EM dataset. Because a previous study found pre- and post-synaptic protein localization defects in VD neurons of unc-3(-) animals³⁶, we reconstructed the synaptic connectivity of VD3 and VD4 from WT and unc-3 mutant animals carrying a strong LOF allele (e151) over a chromosomal deficiency (MnH205), (hereafter unc-3(-)/Df) (Figs. 1A, 8D, Supplementary Fig. 17A). The EM analysis revealed a marked reduction in inputs and outputs of VD3 and VD4, suggesting impaired integration into motor circuitry (Fig. 8D, Supplementary Fig. 17A).

Reduced inputs onto the GABA VD MNs suggested that their presynaptic partners – the cholinergic host MNs - also have connectivity defects. Indeed, our analysis of six host cholinergic MNs (AS2, DA2, DB3, VA3, VB3, VB4) in the unc-3(-)/Df animal showed sharp reductions in their inputs and outputs (Supplementary Fig. 17B–G), in addition to axon pathfinding defects (Supplementary Fig. 17H). Altogether, the integration of EM and scRNA-seq datasets revealed that UNC-3 impacts the connectivity of downstream GABA MNs both at the anatomical and molecular level.

Discussion

Decades of research have emphasized the cell-autonomous roles of transcription factors (TFs) in individual neuron types, but their impact on downstream, synaptically connected neurons remains poorly understood. Here, we employed scRNA-seq to systematically identify the cell- and non-cell-autonomous functions of the conserved terminal selector UNC-3/EBF1-4 in C. elegans ventral nerve cord MNs. Since mutations in the unc-3 human ortholog EBF3 cause a severe neurodevelopmental syndrome (HADDS) characterized by muscle hypotonia and motor developmental delay^39–45, the identification of UNC-3 roles in host and downstream MNs may provide a conceptual framework for understanding the syndrome’s pathogenesis.

Every nervous system is composed of individual and often heterogeneous neuron types. That is, cells of a given neuron type share common features, such as the use of the same neurotransmitter (NT), but can be further subdivided into distinct subtypes based on anatomical, functional, and molecular criteria. Terminal selectors tend to be expressed in all subtypes of a given neuron type¹⁸. For example, in mice, the terminal selectors Pet-1 and Nurr1 are expressed in all subtypes of brainstem serotonergic neurons¹¹⁸ and midbrain dopamine neurons¹¹⁹, respectively, but their precise functions in each subtype remain poorly understood. This highlights a conceptual problem broadly applicable to most neuron types: A common TF (e.g., terminal selector) specifies a group of neurons with shared features, but additional gene regulatory mechanisms must exist to diversify those neurons into subtypes. How terminal selectors control neuronal diversification processes, such as the identity of individual neuronal subtypes, remains limited due to the employment of either biased (candidate gene) or bulk RNA-seq approaches^120–125. With unbiased molecular profiling (scRNA-seq), we provide here a systematic characterization of terminal selector (unc-3) loss in all five classes (subtypes) of cholinergic MNs. Without unc-3, four of the five host MN classes (DA, DB, VA, VB), which control backward and forward locomotion³⁵, collapse into three molecularly distinct mutant populations (Fig. 4G). In contrast, the AS MN class, which has a functionally distinct role in movement coordination (i.e., speed, body curvature)^55,126, shows resilience despite unc-3 loss, partially retaining its original molecular features. This is likely due to additional regulatory mechanisms, such as TFs, that help safeguard AS identity by partially compensating for unc-3 loss. The strongest candidate is UNC-55/NR2F, which is known to control AS identity⁷, followed by ELT-1/GATA and MAB-9/TBX20, which are both expressed in AS neurons (Fig. 2I). Altogether, the single-cell resolution of our RNA-seq approach revealed a non-uniform picture likely applicable to other terminal selectors. Although all five host MN classes (DA, DB, VA, VB, and AS) are cholinergic, loss of the same terminal selector (unc-3) led to differential effects on MN class identity, offering valuable insights into the transcriptional logic of neuronal diversification.

The unbiased identification of UNC-3 target genes in host MNs revealed a dual regulatory role, expanding our understanding of terminal selectors. Consistent with prior work^4,6–8, UNC-3 is a major determinant of MN identity by acting as a direct transcriptional activator of hundreds of effector genes. However, our analysis also points out a major role in suppressing inappropriate transcriptional programs. Among the > 1,100 repressed genes in host MNs (Fig. 3A), we identified alternate neurotransmitter (NT) identity components. In unc-3 mutants, host MNs ectopically express GABAergic or glutamatergic features (Fig. 4), suggesting that UNC-3 reinforces host MN identity by preventing the adoption of alternate NT identity features. This finding is reminiscent of other TFs in the vertebrate nervous system^127–133. However, it has remained unclear whether the repressor activity of a TF is continuously needed or becomes superfluous in later stages of life. With inducible protein depletion, we show here that UNC-3 is continuously required to suppress alternate NT identities in mature cholinergic MNs.

The roughly equal numbers of activated (929) and repressed (1,121) target genes in host MNs suggest that suppression of inappropriate gene expression programs is also a major function of UNC-3. But how can UNC-3 activate and repress distinct sets of genes? Prior studies found that terminal selectors can suppress inappropriate neuronal identities in their host cells via TF competition mechanisms^134,135. Alternatively, terminal selectors could repress alternative identity programs indirectly by preventing the expression or activity of other regulatory factors. The latter however, appears unlikely, as we found no ectopic expression of terminal selectors of GABA (unc-30) or glutamatergic (che-1, unc-86, die-1) NT identities in unc-3(-) host MNs, nor evidence of UNC-3 occupancy at their cis-regulatory regions.

Whereas integration of scRNA-seq and ChIP-seq data revealed strong enrichment of UNC-3 occupancy at activated targets relative to matched controls, UNC-3 occupancy was weaker at repressed targets, frequently associated with HOT-sites and promoter-proximal regions lacking the canonical COE motif. These results argue that the UNC-3 repressive effects are mostly indirect or context-dependent. Motif analysis at repressed loci identified enrichment of non-COE motifs, including one with nominal similarity to the binding site of the bHLH TF HLH-11/TFAP4, which is co-expressed with UNC-3 in VNC MNs^32,33. These findings support a model in which UNC-3 modulates repressed genes through cooperative or antagonistic interactions with other transcriptional regulators.

Consistent with this idea, UNC-3 antagonizes the Hox protein LIN-39 (Scr/Dfd/Hox4-5), preventing it from activating inappropriate terminal identity genes in host MNs⁹. More broadly, the promoter-biased occupancy observed at UNC-3-associated repressed loci may reflect mechanistically distinct modes of transcriptional regulation, including indirect recruitment or position-dependent effects, as recently described for human TFs¹³⁶. Altogether, our findings in host MNs offer a blueprint for future single-cell and mechanistic studies aimed at resolving how conserved and clinically relevant TFs sculpt neuronal identity programs.

Although non-cell-autonomous functions for TFs are often assumed a priori, their prevalence and mechanistic contributions to the development of post-mitotic neurons remain largely unexplored. Using scRNA-seq, we show that UNC-3/EBF1-4 exerts extensive non-cell-autonomous effects on the transcriptomes of downstream, synaptically connected GABA (DD and VD) MNs in C. elegans, indirectly modulating transcription of genes involved in key neuronal processes, such as neuropeptidergic signaling and neurite development. These molecular effects, accompanied by axon pathfinding and synaptic defects, redefine terminal selectors as both intrinsic and extrinsic regulators of neuronal identity and circuit assembly.

Given that UNC-3 is not expressed in the lineage of GABA (DD and VD) MNs (Supplementary Fig. 9), we surmise that cell-cell signaling from host to downstream MNs is disrupted in unc-3 mutants, leading to the observed molecular and morphological effects in GABA cells. In principle, such cell-cell signaling can take many forms, ranging from synaptic signaling to secreted molecules and cell surface proteins. In some cases, TFs themselves can be transferred from host cells to neighboring neurons, as has been demonstrated for the homeodomain proteins Engrailed and Otx2 in the developing mammalian brain^137–139. Here, we find that unc-3 loss or disruption of ACh biosynthesis (cholinergic neurotransmission) non-cell-autonomously induces neuropeptide misregulation in GABA MNs. Although cholinergic neurotransmission is involved, we detected no changes in expression of established neuronal activity-dependent TFs (e.g., crh-1/CREB⁹⁶, fos-1/ATF2⁹⁷, egl-43/MECOM⁹⁷) in GABA MNs of unc-3(-) animals. Instead, we found increased expression of the pro-regenerative bZIP TF CEBP-1^106,108 both in unc-3 and unc-17/VAChT mutants, supporting the idea that disruption of ACh biosynthesis in host MNs, which is a consequence of unc-3 loss, triggers a CEBP-1-mediated neuronal injury/repair response in downstream GABA MNs (Fig. 8E). We emphasize that additional signaling mechanisms independent of cholinergic neurotransmission are also plausible because the magnitude of the observed effects in genetic mutants that block ACh biosynthesis (unc-17/VAChT, cha-1/ChAT) is smaller compared to unc-3(-) mutants. Future studies will investigate such mechanisms, including how autocrine effects of ACh signaling or feedback from body wall muscles might contribute to the observed non-cell-autonomous effects in GABA MNs of unc-3(-) animals.

Notably, we observed dysregulation of genes encoding major components of the deeply conserved UNC-6/Netrin signaling pathway in both host and downstream MNs of unc-3(-) animals (Fig. 8B). Netrin signaling regulates a variety of neuronal processes from nematodes to mammals, including axon guidance^140,141, neurite morphology^142,143, and synapse assembly^115,144,145, all of which appear defective in downstream MNs of unc-3(-) animals. In addition, UNC-3 is known to directly activate expression of the presynaptic cell-adhesion molecule nrx-1/Neurexin in host MNs; loss of unc-3 strongly reduces NRX-1 levels, leading to defects in dendritic spine formation and postsynaptic AChR clustering in downstream GABA MNs³⁷. We surmise that these two conserved signaling pathways – UNC-6/Netrin and NRX-1/Neurexin – which are controlled by UNC-3 in host MNs, likely act in parallel to instruct axonal and synaptic development in downstream GABA MNs. Interestingly, a similar logic applies to the terminal selector UNC-42 (PROP1), which cell-autonomously controls host neuron identities and circuit assembly while non-cell-autonomously promoting axonal outgrowth in neighboring cells, potentially via UNC-6/Netrin signaling^146,147. Hence, the non-cell-autonomous effects of UNC-3 may reflect a broader role for terminal selectors in deploying guidance and adhesion pathways to coordinate neuronal circuit assembly.

Our study offers a rare glimpse into how TF activity in a host neuron type affects the development of downstream, synaptically-connected neurons. We acknowledge that our scRNA-seq data may not have captured all unc-3(-) MN populations. While the lin-39::RFP reporter used here has similar expression patterns in WT and unc-3 animals, we cannot rule out possible bias in cell numbers, which may affect the interpretation of our differential expression analysis. Additionally, we do not explore the potential impact of UNC-3 on non-neuronal cells, such as muscle cells, which also receive cholinergic input from host MNs. Consistent with prior work^69,147,148, we found that unc-3 loss impacts the organization of the ventral nerve cord, which could secondarily alter the transcriptomes of downstream GABA MNs. While we cannot rule out that nerve cord disorganization contributes to the observed non-cell-autonomous effects in GABA MNs, the minimal transcriptomic changes in the VC class of neurons argue against this possibility.

By uncovering regulatory roles for a conserved and clinically relevant terminal selector gene, this work advances our understanding of how TFs control the development of individual neuron types, shifting the field’s perspective from a “host cell-centric” framework to one that incorporates unexpected non-cell-autonomous roles in neighboring neurons. Our findings also establish the C. elegans motor circuit as a powerful model for studying causal pathways linking TF activity in host cells to its impact on downstream cells. Together, this work offers a conceptual framework for understanding TF functions in neural development and circuit assembly, as well as the pathogenesis of the EBF3 neurodevelopmental syndrome (HADDS).

Methods

Maintenance of C. elegans strains

All C. elegans strains were cultured at 20°C or 25°C on nematode growth media (NGM) plates seeded with standard E. coli OP50 as a food source. Embryonic, larval, and day 1 adult stage hermaphrodites were assessed as described in the main text, figures, and figure legends. All strains used or generated for this study are listed in Supplementary Data 14.

Preparation of day 1 adult stage C. elegans and dissociation

Worms were grown on 8 P nutrient agar plates (150 mm) seeded with E. coli strain NA22. To obtain synchronized cultures of day 1 adult-stage animals, adult hermaphrodites were treated with hypochlorite to isolate embryos, which were then incubated in M9 buffer at room temperature for 16 hours to hatch and arrest at L1 stage. L1 animals were then grown on NA22-seeded plates for 62-65 hours. The developmental age of each culture was determined by scoring vulval morphology in at least 90 worms. The lin-39p::RFP strain showed variability in age even after synchronization. Thus, young adults were further isolated by size exclusion using a 35 µm nylon mesh. Worms were washed off plates with M9, then placed on a 35 µm nylon mesh suspended over M9 containing NA22 bacteria for 25 minutes. Larval worms passed through the mesh, whereas adults were retained. Young adult worms remaining on the mesh were collected into M9 and centrifuged at 150 × g for 2.5 minutes. Of the remaining lin-39p::RFP population, 81.5% of the animals were young adults, and the remaining 18.5% were late L4 stage (approaching day 1 adult stage). Single-cell suspensions were obtained with some modifications to published protocols^32,149. Worms were transferred to a 1.6 mL centrifuge tube and centrifuged at 16,000 × g for 1 minute to form 250 uL pellets. Worm pellets were then treated with 500 µL of SDS-DTT solution (20 mM HEPES, 0.25% SDS, 200 mM DTT, 3% sucrose, pH 8.0) for 6 minutes.

Following SDS-DTT treatment, worms were washed five times (each wash: dilute with 1 mL egg buffer, centrifuge at 16,000 × g for 30 seconds). Worms were then digested in cold-active protease (10 mg/mL, Protease from Bacillus licheniformis, Sigma-Aldrich P4860, with DNAse I 35 U/mL) in egg buffer for 35 minutes at 4 °C. Cells were kept at 4 °C from protease incubation through all subsequent procedures.

During the protease incubations, solutions were triturated by pipetting through a P1000 pipette tip for four sets of 80 repetitions. Dissociation efficiency was monitored at 5-minute intervals with a fluorescence dissecting scope. Digestions were stopped by adding 750 µL L-15 media supplemented with 10% fetal bovine serum (L-15-10). Cells were then centrifuged at 530 × g for 5 minutes at 4 °C. The pellet was resuspended in 1 mL L-15-10, and individual cells were separated from whole worms and debris by centrifuging at 100 × g for 2 minutes at 4 °C. The supernatant was filtered through a 35-micron strainer cap into a 5 mL collection tube (Falcon 352235). The pellet was resuspended a second time, centrifuged (100 x g for 2 minutes at 4 °C), and the resulting supernatant was added to the collection tube. For higher sorting efficiency, samples were diluted with an additional 1 mL of L-15-10.

FACS isolation of C. elegans motor neurons for single-cell RNA-seq

The samples were prepared as three pairs isolated on different days from distinct cultures, with a WT (lin-39p::RFP) sample and a lin-39p::RFP; unc-3(n3435) sample being prepared in parallel on each day. Single-cell suspensions of both genotypes were sorted simultaneously on two BD FACSAria™ III cell sorters equipped with 70-micron diameter nozzles. DAPI was added to the samples (final concentration of 1 µg/mL) to label dead /dying cells. Non-fluorescent N2 standards were used to set gates to exclude auto-fluorescent cells. To ensure capture of all targeted VNC MNs, we set FACS gates to encompass a wide range of fluorescent intensities (Supplementary Fig. 18). This likely contributed to the presence of unlabeled neuronal and non-neuronal cells in our sample, which were excluded from our analysis in this study. Cells were sorted for three hours under the “4-way Purity” mask into 1.5 mL microcentrifuge tubes containing 200 uL L-15-33 (L-15 medium with 33% fetal bovine serum) and subsequently centrifuged (1200 × g for 12 minutes at 4 °C). A hemocytometer was used to count fluorescent cells. Single-cell suspensions used for 10x Genomics single-cell sequencing ranged from 180–350 cells/µL. Three samples of WT and three samples of unc-3(n3435) were prepared for encapsulation using the 10X Genomics Chromium system. We estimate the time from harvesting worms off plates (dissociation + sorting = ~4.5 hours) to encapsulation in the 10X Genomics Chromium Controller (concentrating + counting + encapsulation = 1-1.5 hours) to be ~6 hours.

Single-cell RNA sequencing

Each sample targeted 10,000 cells and was processed for single-cell 3’ RNA sequencing using the 10X Chromium system (v3 chemistry). Libraries were prepared using P/N 1000075, 1000073, and 120262 following the manufacturer’s protocol. Illumina NovaSeq 6000 with 150 bp paired-end reads was used for library sequencing. Base calling was performed with Real-Time Analysis software (RTA, version 2.4.11; Illumina).

Downstream processing

FASTQ files were processed using the 10X Genomics Cell Ranger software (version 6.1.1) using a custom reference genome from Wormbase release WS273 that incorporated extended 3’ UTR regions for several specific genes³². This reference is accessible at GEO under accession number GSE234962. Cells containing droplets were identified via the Emptydrops function in the DropletUtils R package, with the ambient RNA profile derived from droplets containing fewer than 50 unique molecular identifiers (UMIs). Background RNA correction was performed with the SoupX R package¹⁵⁰, applying a 25-UMIs cutoff for the background expression profile. The genes used for contamination estimation in each sample are detailed in Supplementary Data 1, column J. Adjusted counts were rounded to the nearest integer, and the resulting corrected gene-by-barcode matrices were carried forward for further processing. Quality control metrics were calculated for each dataset using the scater R package¹⁵¹, focusing on the proportion of UMIs attributed to mitochondrial genes (nduo-1, nduo-2, nduo-3, nduo-4, nduo-5, nduo-6, ctc-1, ctc-2, ctc-3, ndfl-4, atp-6, ctb-1, MTCE.7 and MTCE.33). Droplets exceeding 20% mitochondrial UMI content were filtered out. Up to this stage, the six samples were processed separately. The datasets were then merged into a single cell_data_set object within the monocle3^152–155 framework for dimensionality reduction and clustering. Dimensionality reduction on the integrated dataset used 75 principal components, followed by 2-dimensional UMAP embeddings with parameters of umap.min_dist = 0.3 and umap.n_neighbors = 75, which had previously demonstrated effective separation of most neuron classes¹⁰. All remaining parameters were default values. One WT sample – corresponding to the third sample preparation day – yielded low-quality cells and was therefore excluded from analysis.

Motor neuron class and subclass identification in C. elegans

We identified clusters containing VNC MNs by expression of known marker genes, including unc-3, bnc-1, unc-4, unc-129, vab-7, unc-25, and unc-47 (Supplementary Fig. 1A, Supplementary Data 1). Clusters corresponding to GABAergic MNs (DD and VD) and to the VC neurons contained overlapping populations of cells from both genotypes. We could confidently annotate clusters corresponding to AS, DA, DB, VA and VB from WT, but these clusters did not contain any cells from unc-3(n3435) animals. We identified populations of cells we surmised to be cholinergic MNs in the unc-3(n3435) data by expression of neuronal markers egl-3, egl-21 and sbt-1 as well as the homeodomain TFs ceh-20, unc-62, and the Hox genes ceh-13, lin-39 and mab-5. We subset the data to include only those populations corresponding to WT or unc-3(n3435) VNC MNs and reran dimensionality reduction (35 principal components), alignment with align_cds (from the batchelor R package, alignment_k = 10), and generated new UMAP plots (umap.min_dist = 0.2, umap.n_neighbors = 50). The subsequent sub-UMAP was also made of just the host MNs in both genotypes using 25 principal components, umap.min_dist = 0.2, umap.n_neighbors = 50). We note that while the lin-39::RFP reporter labeled most VNC MNs in WT and unc-3(n3435) animals (Fig. 1D, E), we did not sample each MN class across genotypes equally (Supplementary Data 1).

Differential Expression in C. elegans motor neurons: wild-type vs. unc-3(n3435)

Differential expression analyses between WT and unc-3(n3435) MN classes were performed using pseudobulk methods. For each class, an aggregate “pseudobulk” expression value was calculated for every gene for each replicate sample (two WT and three unc-3(n3435) samples) using the aggregateAcrossCells function from the scater R package. In the case of neighbor MNs and AS neurons, each subclass (e.g., DD2_3, DD4_5, VC4_5) was identified in both genotypes and was therefore considered a separate class. In the case of host MNs, expression was aggregated across all DA, DB, VA, and VB neurons in the WT samples, and across all cells in Groups 1-3 in the unc-3(n3435) samples. The pseudobulk expression profiles were then used as input to edgeR for differential expression analysis. Each class was considered independently.

DEG enrichment analysis

Gene set enrichment analysis was performed using WormCat2.0 (wormcat.com)⁶¹. For each host or downstream MN class, two separate gene lists were submitted: (1) genes significantly upregulated (activated) and (2) genes significantly downregulated (repressed), using the same statistical cutoffs applied for differential expression (False discovery rate [FDR] <0.05). WormCat2.0 was run with default settings using the “Fisher Exact Test” mode and the full ‘Whole genome v2’ annotation type. Categories from all three WormCat annotation levels (Category 1–3) were examined, and enriched terms with FDR < 0.05 were considered significant. Raw WormCat2.0 output results are reported in Supplementary Data (AS MNs = Supplementary Data 3, 4, DA/DB/VA/VB [Groups1-3] = Supplementary Data 5-6, DD MNs = Supplementary Data 10, 11, VD MNs = Supplementary Data 12, 13).

Transcription factor activity estimation

We used the CelEsT gene regulatory networks¹⁰¹ to estimate transcription factor (TF) activity. The CelEsT GRNs contain TF and target data for 487 TFs, compiled from ChIP-Seq, DNA-binding motifs, and eY1H screens. For each MN subclass, we used the average log fold change between wild-type and unc-3(n3435) for all genes as input, along with the CelEsT GRNs, to the decouple function in the decoupleR R package¹⁵⁶. We used the multivariate linear model (“mlm”). We calculated Benjamini-Hochberg corrected p-values to control for multiple comparisons within each neuron. We retained only those transcription factors with adjusted p-values < 0.05. We also filtered results to retain TFs that were detected in the neuron of interest in at least one genotype.

Microscopy

Larval and adult stage animals were anesthetized with sodium azide (NaN₃, 100 mM) and mounted on a 4% agarose pad on imaging slides. Images were recorded with an automated fluorescence microscope (Zeiss, Axio Imager Z2). Z-stacks (0.50–1.0 µm step size) were acquired using a Zeiss Axiocam 503 mono (ZEN Blue software, version 2.3.69.1000), a Zeiss LSM 880, or a Zeiss LSM 900. Representative images shown are max intensity z-projections. All image reconstruction was performed in Fiji (version 2.9.0/1.53t). Fluorescent overlays and cropping for figures were generated using Adobe Photoshop 2022 (23.2.2 Release). Images of strains containing the fluorescent Neuronal Polychromatic Atlas of Landmarks (NeuroPAL) transgene⁵⁸ for cell identification were acquired on a Zeiss LSM900 confocal microscope with 0.5–1.0 µm step size.

Fluorescence intensity quantifications

To quantify fluorescence intensity in individual VNC MNs, Z-stack images of the midbody or whole animal were acquired at 0.5-1.0 um z-step intervals. The same imaging parameters (e.g., exposure time, laser power, master gain, temperature) were applied across all samples within the same experiment. Image stacks were then processed, including background subtraction via a sliding paraboloid at a rolling ball radius of 50.0 pixels, and signal was measured using FIJI.

Identification of motor neuron classes and subclasses in C. elegans

Motor neuron classes and subclasses were identified based on the following criteria: (1) Anatomically invariant positioning of neuronal bodies in the retrovesicular ganglion (RVG), ventral nerve cord (VNC), and preanal ganglion (PAG); (2) class-specific birth order (i.e., embryonic versus post-embryonic emergence); (3) total cell numbers in each motor neuron class or subclass; (4) co-expression with the NeuroPAL transgene⁵⁸.

Temporally controlled UNC-3 degradation

To deplete UNC-3 specifically in mature (L4-day 1 adult stage) animals, we used the auxin-inducible degradation system⁶⁶ with the previously characterized KRA376 strain, which contains the ot837[unc-3::mNG::AID] allele and ubiquitously driven TIR1 ieSi57[eft-3::TIR1::mRuby]⁸, crossed to otIs564[unc-47^fosmid::mCherry]. L4 stage animals were grown at 20 °C on NGM plates coated with 4 nM auxin (indole-acetic acid [IAA] dissolved in ethanol) or ethanol (negative control) for 24 hours before imaging. All plates were shielded from light.

UNC-3 cDNA rescue in host MNs

A 558 bp fragment of the unc-3 promoter (-1bp to -558 bp from the unc-3 start codon), which is expressed in VNC host MNs, was used. Punc-3_558bp>unc-3_WT_cDNA was generated through plasmid digest ligation. Plasmids (pCHO_Punc-3_558 and pKP10_hsp_unc3_cDNA) were separately double-digested at 37 °C for 1 hour with restriction enzymes SmaI and SphI in rCutSmart^TM Buffer (NEB Catalog #B6004S). Punc-3_558bp insert was ligated into pKP10_unc-3_cDNA vector with T4 DNA ligase (NEB Catalog #M0202S) in T4 DNA ligase buffer (NEB Catalog #B0202S) at 16 °C overnight. Addition of a spacer (GGAGCCGGATCT)

and 3XFLAG(GATTATAAAGACGATGACGATAAGCGTGACTACAAGGACGACGACGA

CAAGCGTGATTACAAGGATGACGATGACAAGAGA) was done by Gibson Assembly (NEB catalog #E5510S).

Primers:

Punc-3_558bp FWD primer: CTATCCTCTCATCCTCTCCCATCTC

Unc-54_3’ UTR RVS primer: gaaacagttatgtttggtatattggg

Gibson assembly primer to generate vector fragment, FWD: CGATGACAAGAGAtaagttctagaaatgctccaacactttcc

Gibson assembly primer to generate vector fragment, RVS: TTATAATCAGATCCGGCTCCagacagacgggacgacga

Gibson assembly primer to generate FLAG insert fragment, FWD: GGAGCCGGATCTGATTATAAAGACG

Gibson assembly primer to generate FLAG insert fragment, RVS: agaacttaTCTCTTGTCATCGTCATCCTTGT

Punc-3_558bp>unc-3_WT_cDNA::3XFLAG_unc-54-3’UTR was then injected as a linear purified PCR product at a concentration of 15 ng/μL with co-injection marker Pttx-3::mCherry (50 ng/μL) into young adult WT (N2) hermaphrodite animals. Animals harboring this construct were then crossed to the unc-3(n3435) null mutant containing the NeuroPAL transgene and endogenous dmsr-6(syb4442[dmsr-6::SL2::GFP::G2B]) reporter for the rescue assay. As this unc-3p::unc-3 cDNA was maintained extra-chromosomally, cDNA(-) and cDNA(+) siblings were used to score rescue.

De novo motif discovery in differentially expressed genes

Peak calls from the UNC-3 ChIP-seq narrowbed file⁸ were annotated to nearby genes with Hypergeometric Optimization of Motif EnRichement (HOMER) discovery and analysis tool using annotatePeaks.pl¹⁵⁷. Annotated peaks were then filtered based on their association with either activated or repressed DEGs. De novo motif discovery was conducted on the filtered peak groups with HOMER using findMotifsGenome.pl, with a size of +/− 75 bp from the center of each peak. Throughout this study, ChIP-seq tracks were generated using Integrated Genomics Viewer (IGV)^158,159. To identify TFs with known binding sequences matching enriched motifs, motif comparison was performed using Tomtom¹⁶⁰ against three C. elegans motif databases: CIS-BP 2.00, the JASPAR 2022 CORE nematode collection (non-redundant), and the Uniprobe worm database. Tomtom was run using Pearson correlation distance with a minimum overlap of 4 bp. Given the small size of the available C. elegans motif databases (43–574 entries), q-values were treated as indicative rather than definitive, and nominal p-values are reported. One of the five motifs enriched among UNC-3-repressed targets showed nominal similarity to the binding profile of HLH-11, a bHLH TF co-expressed with UNC-3 in ventral nerve cord motor neurons^32,33.

UNC-3 ChIP-seq binding enrichment at differentially expressed genes

UNC-3 ChIP-seq peaks and HOT sites¹⁶¹ were annotated to the nearest gene using the C. elegans canonical gene set (WormBase WBPS19). scRNA-seq differential expression results were merged with these annotations. Genes with FDR < 0.05 were classified as UNC-3-activated (positive logFC) or UNC-3-repressed (negative logFC). To test whether UNC-3 ChIP-seq binding was enriched at differentially expressed genes beyond expectation given expression level, an empirical p-value was derived from 1,000 permutations of expression-matched non-DEGs per MN subtype (i.e., DA/DB/VA/VB, AS, DD/VD). A logistic regression model was additionally fit with UNC-3 binding as the outcome and wildtype expression level, DEG type, HOT-site status, and a DEG type × HOT-site interaction as predictors. GABAergic DD/VD motor neurons, which do not express UNC-3, served as a negative control. All analyses were performed in R using the GenomicRanges, rtracklayer, dplyr, and ggplot2 packages.

Electron microscopical analysis

To assess neuronal morphology and synaptic connectivity, we performed reconstructions of WT and unc-3 mutant animals in the anterior segment of the ventral nerve cord. The strains examined included the WT strain (N2U) and the unc-3(e151) variant balanced by the mnDf5 deficiency. The unc-3 mutant analyzed was a trans-heterozygous combination of the unc-3(e151) loss-of-function allele (depicted in Fig. 1A) with the chromosomal deficiency mnDf5, which fully deletes the unc-3 locus. This balanced strain was created through a cross between unc-3(e151) and the SP266 line carrying mnDp1(X; V)/V; mnDf5 X. Reconstructions were derived from serial-section electron micrographs outlined previously⁵¹. The analyzed regions spanned approximately 150 µm and encompassed around 1800 consecutive sections. Specifically, we focused on the VNC extending roughly from the AS1 to AS3 MNs. Images were captured and produced for every third section. We traced the full axonal and dendritic processes of host and downstream MNs whose soma resided within the reconstructed zone (Fig. 8, Supplementary Fig. 17). Neuron identities were established based on distinctive synaptic patterns, morphological traits, and the sequential positioning of their cell bodies along the ventral cord⁵¹.

Statistics and reproducibility

For continuous data (i.e., MN counts, fluorescent intensity of reporters, morphological assays), statistical tests were selected based on data distribution as follows: Normally distributed data (Shapiro-Wilk p > 0.05 in both groups) with equal variances (Levene’s test p > 0.05) = Student’s t-test; Normally distributed with unequal variances = Welch’s t-test; Non-normal data = Wilcoxon rank-sum test. Box-plot elements: thick horizontal line (red) = median; box = 25th to 75th percentiles (interquartile range); whiskers extend to the furthest data point within 1.5 × IQR from the quartiles (or the min/max if all points lie within this range); individual data points are overlaid as black dots. Fluorescent microscopy images next to each dot plot show a representative animal. The number of animals (N) is listed near each box in all plots. No data were excluded from analyses, and investigators were not blinded to allocation during experiments and outcome assessment.

For statistical comparison of categorical data (i.e., UNC-3 ChIP-seq peak distribution in Fig. 3f, frequency of morphological defects in Fig. 7, Supplementary Fig. 13), Fisher’s exact test was performed. The number of animals (N) is listed near each group in all plots. Where >2 categories were compared, post-hoc 2 × 2 Fisher’s exact tests with Bonferroni correction were performed. For all quantifications/statistical tests, p > 0.05 = not significant, ns; p < 0.05 = *; p < 0.01 = **; p < 0.001 = ***; p < 0.0001 = ****. No statistical method was used to predetermine sample size. No data were excluded from the analyses. In all experiments, animals were randomly drawn from plates containing dozens to hundreds of mixed-stage animals. The investigators were not blinded to allocation during experiments and outcome assessment.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

Supplementary Information^{(5.1MB, pdf)}

41467_2026_76320_MOESM2_ESM.pdf^{(231.3KB, pdf)}

Description of Additional Supplementary Files

Supplementary Data 1^{(16.9KB, xlsx)}

Supplementary Data 2^{(4.8MB, xlsx)}

Supplementary Data 3^{(88.9KB, xlsx)}

Supplementary Data 4^{(92.5KB, xlsx)}

Supplementary Data 5^{(138.2KB, xlsx)}

Supplementary Data 6^{(147.6KB, xlsx)}

Supplementary Data 7^{(86.3KB, pdf)}

Supplementary Data 8^{(82.6KB, pdf)}

Supplementary Data 9^{(1.1MB, csv)}

Supplementary Data 10^{(45.5KB, xlsx)}

Supplementary Data 11^{(85.4KB, xlsx)}

Supplementary Data 12^{(47.9KB, xlsx)}

Supplementary Data 13^{(18.8KB, xlsx)}

Supplementary Data 14^{(11KB, xlsx)}

Reporting Summary^{(108.6KB, pdf)}

Transparent Peer Review file^{(338.5KB, pdf)}

Source data

Source Data^{(46.3KB, xlsx)}

Acknowledgements

We thank the Caenorhabditis Genetics Center (CGC), which is funded by the National Institutes of Health (NIH) Office of Research Infrastructure Programs (P40 OD010440), for providing many of the strains used in this study. We thank members of the Kratsios lab (Filipe Marques, Konstantinos Tsioras, Ian Weigle), Oliver Hobert, and Michael Francis for providing feedback on the manuscript. We also thank the Vanderbilt University Medical Center (VUMC) Flow Cytometry Shared Resource, supported by Ingram Cancer Center (P30 CA68485), DDRC (DK058404), VANTAGE Core Facility, supported by CTSA (5UL1 RR024975-03), Ingram Cancer Center (P30 CA68485), Vision Center (P30 EY08126), NIH/NCRR (G20 RR030956) for scRNA-Seq, and the Vanderbilt Cell Imaging Shared Resource (NIH CA68485, DL20593, DK58404, DK59637, EY08126).

Author contributions

J.J.S., S.R.T., D.M.M., and P.K. were responsible for conceptualization; J.J.S., S.R.T, G.K., and D.H.H. were responsible for investigation; J.J.S., S.R.T., G.K., D.H.H., and J.G.W. were responsible for formal analysis. J.J.S., D.M.M, and P.K. were responsible for resources and funding acquisition. J.J.S. and P.K. were responsible for writing the original draft. D.H.H., D.M.M., and P.K. were responsible for supervision. All authors read, edited, and approved the manuscript.

Peer review

Peer review information

Nature Communications thanks Zhao-Wen Wan and the other anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Funding

This work was funded by NIH grants to J.J.S. (K99 NS140549-01), P.K (R21 NS108505, R01 NS118078, R01 NS116365), D.H (OD R24 010943), and D.M.M. (R01NS113559, R01NS100547 and R01NS106951).

Data availability

Wild-type and unc-3 mutant raw sequencing data have been deposited at GEO and are available under accession codes GSE234962 and GSE314726, respectively. All data generated for or analyzed in this study are contained in the manuscript and supporting files. Due to their large number and size, microscopy data will be available upon request from the lead contact. Source data are provided with this paper.

Code availability

All original code is publicly available via the Kratsios Lab GitHub site (https://github.com/KratsiosLab) in the ‘Smith_etal_2026’ repository DOI: 10.5281/zenodo.21345127 [https://zenodo.org/records/21345127].

Any additional information that is required to reanalyze data reported in this study is available from the lead contact upon request.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Jayson J. Smith, Email: jsmit254@syr.edu

David M. Miller, III, Email: david.miller@vanderbilt.edu.

Paschalis Kratsios, Email: pkratsios@uchicago.edu.

Supplementary information

The online version contains supplementary material available at https://doi.org/10.1038/s41467-026-76320-x.

References

1.Deneris, E. S. & Hobert, O. Maintenance of postmitotic neuronal cell identity. Nat. Neurosci.17, 899–907 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Hobert, O. in Current Topics in Developmental Biology Vol. 116 (ed Paul M. Wassarman) 455-475 (Academic Press, 2016). [DOI] [PubMed]
3.Hobert, O. Regulatory logic of neuronal diversity: Terminal selector genes and selector motifs. Proc. Natl. Acad. Sci.105, 20067–20071 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Kratsios, P., Stolfi, A., Levine, M. & Hobert, O. Coordinated regulation of cholinergic motor neuron traits through a conserved terminal selector gene. Nat. Neurosci.15, 205–214 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Kratsios, P. et al. Transcriptional coordination of synaptogenesis and neurotransmitter signaling. Curr. Biol.25, 1282–1295 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Kratsios, P. et al. An intersectional gene regulatory strategy defines subclass diversity of C. elegans motor neurons. eLife6, e25751–e25751 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Kerk, S. Y., Kratsios, P., Hart, M., Mourao, R. & Hobert, O. Diversification of C. elegans motor neuron identity via selective effector gene repression. Neuron93, 80–98 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Li, Y. et al. Establishment and maintenance of motor neuron identity via temporal modularity in terminal selector function. eLife9, e59464 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Feng, W. et al. A terminal selector prevents a Hox transcriptional switch to safeguard motor neuron identity throughout life. eLife9, e50065 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Correa, E. et al. UNC-30/PITX coordinates neurotransmitter identity with postsynaptic GABA receptor clustering. Development151, 10.1242/dev.202733 (2024). [DOI] [PMC free article] [PubMed]
11.Jin, Y., Hoskins, R. & Horvitz, H. R. Control of type-D GABAergic neuron differentiation by C. elegans UNC-30 homeodomain protein. Nature372, 780–783 (1994). [DOI] [PubMed] [Google Scholar]
12.Schuske, K., Palfreyman, M. T., Watanabe, S. & Jorgensen, E. M. UNC-46 is required for trafficking of the vesicular GABA transporter. Nat. Neurosci.10, 846–853 (2007). [DOI] [PubMed] [Google Scholar]
13.McLntire, S. L., Jorgensen, E. & Horvitz, H. R. Genes required for GABA function in Caenorhabditis elegans. Nature364, 334–337 (1993). [DOI] [PubMed] [Google Scholar]
14.Zhang, F. et al. The LIM and POU homeobox genes ttx-3 and unc-86 act as terminal selectors in distinct cholinergic and serotonergic neuron types. Development141, 422–435 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Serrano-Saiz, E., Leyva-Díaz, E., De La Cruz, E. & Hobert, O. BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr. Biol.28, 2813–2823.e2812 (2018). [DOI] [PubMed] [Google Scholar]
16.Destain, H., Prahlad, M. & Kratsios, P. Maintenance of neuronal identity in C. elegans and beyond: Lessons from transcription and chromatin factors. Semin Cell Dev. Biol.154, 35–47 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Poole, R. J., Flames, N. & Cochella, L. Neurogenesis in Caenorhabditis elegans. Genetics228, 10.1093/genetics/iyae116 [DOI] [PMC free article] [PubMed]
18.Hobert, O. & Kratsios, P. Neuronal identity control by terminal selectors in worms, flies, and chordates. Curr. Opin. Neurobiol.56, 97–105 (2019). [DOI] [PubMed] [Google Scholar]
19.Hobert, O. Homeobox genes and the specification of neuronal identity. Nat. Rev. Neurosci.22, 627–636 (2021). [DOI] [PubMed] [Google Scholar]
20.Marz, M., Seebeck, F. & Bartscherer, K. A Pitx transcription factor controls the establishment and maintenance of the serotonergic lineage in planarians. Development140, 4499–4509 (2013). [DOI] [PubMed] [Google Scholar]
21.Ogawa, Y., Shiraki, T., Fukada, Y. & Kojima, D. Foxq2 determines blue cone identity in zebrafish. Sci. Adv.7, eabi9784 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Gabilondo, H. et al. Neuronal cell fate specification by the convergence of different spatiotemporal cues on a common terminal selector cascade. PLOS Biol.14, e1002450 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Chu, S.-Y., Lai, Y.-W., Hsu, T.-C., Lu, T.-M. & Yu, H.-H. Isoforms of terminal selector Mamo control axon guidance during adult Drosophila memory center construction via Semaphorin-1a. Dev. Biol.515, 1–6 (2024). [DOI] [PubMed] [Google Scholar]
24.Özel, M. N. et al. Coordinated control of neuronal differentiation and wiring by sustained transcription factors. Science378, eadd1884 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Park, Y., Nnamani, M. C., Maziarz, J. & Wagner, G. P. Cis-Regulatory Evolution of Forkhead Box O1 (FOXO1), a Terminal Selector Gene for Decidual Stromal Cell Identity. Mol. Biol. Evol.33, 3161–3169 (2016). [DOI] [PubMed] [Google Scholar]
26.Remesal, L. et al. PBX1 acts as terminal selector for olfactory bulb dopaminergic neurons. Development147, 10.1242/dev.186841 [DOI] [PubMed]
27.Lipiec, M. A. et al. TCF7L2 regulates postmitotic differentiation programmes and excitability patterns in the thalamus. Development147, 10.1242/dev.190181 [DOI] [PMC free article] [PubMed]
28.Smolin, N. et al. Neuronal identity control at the resolution of a single transcription factor isoform. bioRxiv, 2024.2006.2014.598883. 10.1101/2024.06.14.598883 [DOI]
29.Simon, F. et al. Establishment of terminal selector combinations in optic lobe neurons. bioRxiv, 2024.2002.2005.578975. 10.1101/2024.02.05.578975 [DOI]
30.Kilpinen, S. et al. Gene regulatory mechanisms guiding bifurcation of inhibitory and excitatory neuron lineages in the anterior brainstem. bioRxiv, 2025.2001.2026.634960. 10.1101/2025.01.26.634960 [DOI] [PMC free article] [PubMed]
31.Marques, F., Chen, Y., Destain, H., Marinelli, M. & Kratsios, P. Interlocked transcription factor feedback loops maintain and restore touch sensation. bioRxiv, 2025.2005.2015.654349. 10.1101/2025.05.15.654349 [DOI] [PMC free article] [PubMed]
32.Taylor, S. R. et al. Molecular topography of an entire nervous system. Cell184, 4329–4347.e4323 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Smith, J. J. et al. A molecular atlas of adult C. elegans motor neurons reveals ancient diversity delineated by conserved transcription factor codes. Cell Rep.43, 113857 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
34.White, J. G., Southgate, E., Thomson, J. N. & Brenner, S. The structure of the ventral nerve cord of Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. Ser. B, Biol. Sci.275, 327–348 (1976). [DOI] [PubMed] [Google Scholar]
35.Von Stetina, S. E., Treinin, M. & Miller, D. M. The motor circuit. Int Rev. Neurobiol.69, 125–167 (2006). [DOI] [PubMed] [Google Scholar]
36.Barbagallo, B. et al. Excitatory neurons sculpt GABAergic neuronal connectivity in the C. elegans motor circuit. Development144, 1807–1819 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Philbrook, A. et al. Neurexin directs partner-specific synaptic connectivity in C. elegans. eLife7, e35692 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Narayanan, D. L., Kutsche, K. & Girisha, K. M. EBF3 Neurodevelopmental Disorder. (University of Washington, Seattle, 1993). [PubMed]
39.Chao, H.-T. et al. A syndromic neurodevelopmental disorder caused by De Novo variants in EBF3. Am. J. Hum. Genet.100, 128–137 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Sleven, H. et al. De Novo mutations in EBF3 cause a neurodevelopmental syndrome. Am. J. Hum. Genet.100, 138–150 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
41.D’Arrigo, S. et al. Abnormal cerebellar foliation in EBF3 mutation. Neurology94, 933–935 (2020). [DOI] [PubMed] [Google Scholar]
42.Nishi, E. et al. Clinical spectrum of individuals with de novo EBF3 variants or deletions. Am. J. Med. Genet. A185, 2913–2921 (2021). [DOI] [PubMed] [Google Scholar]
43.Deisseroth, C. A. et al. An integrated phenotypic and genotypic approach reveals a high-risk subtype association for EBF3 Missense variants affecting the zinc finger domain. Ann. Neurol.92, 138–153 (2022). [DOI] [PubMed] [Google Scholar]
44.Ciaccio, C. et al. Neurologic, neuropsychologic, and neuroradiologic features of EBF3-related Syndrome. Neurol. Genet.9, e200049 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Zhu, J. et al. Further delineation of EBF3-related syndromic neurodevelopmental disorder in twelve Chinese patients. Front. Pediatr.11, 10.3389/fped.2023.1091532 [DOI] [PMC free article] [PubMed]
46.Chiara, F. et al. Early B-cell factors 2 and 3 (EBF2/3) regulate early migration of Cajal-Retzius cells from the cortical hem. Dev. Biol.365, 277–289 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Iwai, R. et al. A Prdm8 target gene Ebf3 regulates multipolar-to-bipolar transition in migrating neocortical cells. Biochem Biophys. Res Commun.495, 388–394 (2018). [DOI] [PubMed] [Google Scholar]
48.Zhu, Y. et al. Discovery of coding regions in the human genome by integrated proteogenomics analysis workflow. Nat. Commun.9, 903 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Roadmap Epigenomics, C. et al. Integrative analysis of 111 reference human epigenomes. Nature518, 317–330 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Lindsay, S. J. et al. HDBR expression: a unique resource for global and individual gene expression studies during early human brain development. Front. Neuroanat.10, 10.3389/fnana.2016.00086 [DOI] [PMC free article] [PubMed]
51.White, J. G., Southgate, E., Thomson, J. N. & Brenner, S. The Structure of the Nervous System of the Nematode Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. Biol. Sci.314, 1–340 (1986). [DOI] [PubMed] [Google Scholar]
52.Ward, S., Thomson, N., White, J. G. & Brenner, S. Electron microscopical reconstruction of the anterior sensory anatomy of the nematode Caenorhabditis elegans. J. Comp. Neurol.160, 313–337 (1975). [DOI] [PubMed] [Google Scholar]
53.Chalfie, M. et al. The neural circuit for touch sensitivity in Caenorhabditis elegans. J. Neurosci.5, 956 LP–964 (1985). [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Cook, S. J. et al. Whole-animal connectomes of both Caenorhabditis elegans sexes. Nature571, 63–71 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Tolstenkov, O. et al. Functionally asymmetric motor neurons contribute to coordinating locomotion of Caenorhabditis elegans. Elife7. 10.7554/eLife.34997 [DOI] [PMC free article] [PubMed]
56.Taylor, S. R., McWhirter, R. D., Matlock, B. K., Flaherty, D. K. & Miller, D. M. Protocol for isolating specific C. elegans neuron types for bulk and single-cell RNA sequencing. STAR Protoc.5, 103439 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Destain, H., Koh, A., Shin, H., Brown, A. E. X. & Kratsios, P. Continuous negative autoregulation fine-tunes dosage-sensitive transcription factor expression to maintain post-mitotic neuron identity. bioRxiv. 10.64898/2026.05.14.725191 [DOI]
58.Yemini, E. et al. NeuroPAL: a multicolor atlas for whole-brain neuronal identification in C. elegans. Cell184, 272–288.e211 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Prasad, B., Karakuzu, O., Reed, R. R. & Cameron, S. unc-3-dependent repression of specific motor neuron fates in Caenorhabditis elegans. Dev. Biol.323, 207–215 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Feng, W., Destain, H., Smith, J. J. & Kratsios, P. Maintenance of neurotransmitter identity by Hox proteins through a homeostatic mechanism. Nat. Commun.13, 6097 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Holdorf, A. D. et al. WormCat: an online tool for annotation and visualization of Caenorhabditis elegans Genome-Scale Data. Genetics214, 279–294 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Castro-Mondragon, J. A. et al. JASPAR 2022: the 9th release of the open-access database of transcription factor binding profiles. Nucleic Acids Res.50, D165–D173 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Rumley, J. D., Kim, J. H. & Hobert, O. Protocol to identify transcription factor target genes using TargetOrtho2. STAR Protoc.6, 103680 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Glenwinkel, L. et al. In silico analysis of the transcriptional regulatory logic of neuronal identity specification throughout the C. elegans nervous system. eLife10, e64906 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Glenwinkel, L., Wu, D., Minevich, G. & Hobert, O. TargetOrtho: a phylogenetic footprinting tool to identify transcription factor targets. Genetics197, 61–76 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Zhang, L., Ward, J. D., Cheng, Z. & Dernburg, A. F. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development142, 4374–4384 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Packer, J. S. et al. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science365, eaax1971 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Ma, X. et al. A 4D single-cell protein atlas of transcription factors delineates spatiotemporal patterning during embryogenesis. Nat. Methods18, 893–902 (2021). [DOI] [PubMed] [Google Scholar]
69.Prasad, B. C. et al. unc-3, a gene required for axonal guidance in Caenorhabditis elegans, encodes a member of the O/E family of transcription factors. Development125, 1561–1568 (1998). [DOI] [PubMed] [Google Scholar]
70.Howell, K., White, J. G. & Hobert, O. Spatiotemporal control of a novel synaptic organizer molecule. Nature523, 83–87 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Bhat, U. S., Shahi, N., Surendran, S. & Babu, K. Neuropeptides and Behaviors: How Small Peptides Regulate Nervous System Function and Behavioral Outputs. Front. Mol. Neurosci.14, 10.3389/fnmol.2021.786471 [DOI] [PMC free article] [PubMed]
72.Chen, D., Taylor, K. P., Hall, Q. & Kaplan, J. M. The neuropeptides FLP-2 and PDF-1 Act in concert to arouse Caenorhabditis elegans Locomotion. Genetics204, 1151–1159 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Chang, Y.-J. et al. Modulation of locomotion and reproduction by FLP neuropeptides in the nematode Caenorhabditis elegans. PLOS ONE10, e0135164 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
74.Stawicki, T. M., Takayanagi-Kiya, S., Zhou, K. & Jin, Y. Neuropeptides Function in a Homeostatic Manner to Modulate Excitation-Inhibition Imbalance in C. elegans. PLOS Genet.9, e1003472 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Ramachandran, S. et al. A conserved neuropeptide system links head and body motor circuits to enable adaptive behavior. eLife10, e71747 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Kahsai, L., Martin, J.-R. & Winther, ÅM. E. Neuropeptides in the Drosophila central complex in modulation of locomotor behavior. J. Exp. Biol.213, 2256–2265 (2010). [DOI] [PubMed] [Google Scholar]
77.Lee, S. H., Cho, E., Yoon, S.-E., Kim, Y. & Kim, E. Y. Metabolic control of daily locomotor activity mediated by tachykinin in Drosophila. Commun. Biol.4, 693 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Watteyne, J., Chudinova, A., Ripoll-Sánchez, L., Schafer, W. R. & Beets, I. Neuropeptide signaling network of Caenorhabditis elegans: from structure to behavior. Genetics228, 10.1093/genetics/iyae141 (2024). [DOI] [PMC free article] [PubMed]
79.Li, C., Wu, X.-J. & Li, W. Neuropeptide S promotes maintenance of newly formed dendritic spines and performance improvement after motor learning in mice. Peptides156, 170860 (2022). [DOI] [PubMed] [Google Scholar]
80.Das Gupta, R. R., Scheurer, L., Pelczar, P., Wildner, H. & Zeilhofer, H. U. Neuron-specific spinal cord translatomes reveal a neuropeptide code for mouse dorsal horn excitatory neurons. Sci. Rep.11, 5232 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
81.Blum, J. A. et al. Single-cell transcriptomic analysis of the adult mouse spinal cord reveals molecular diversity of autonomic and skeletal motor neurons. [DOI] [PMC free article] [PubMed]
82.de Groat, W. C. et al. The role of neuropeptides in the sacral autonomic reflex pathways of the cat. J. Auton. Nerv. Syst.7, 339–350 (1983). [DOI] [PubMed] [Google Scholar]
83.Cui, C. et al. Adequate expression of neuropeptide Y is essential for the recovery of zebrafish motor function following spinal cord injury. Exp. Neurol.345, 113831 (2021). [DOI] [PubMed] [Google Scholar]
84.Zuccaro, E., Piol, D., Basso, M. & Pennuto, M. Motor Neuron Diseases and Neuroprotective Peptides: A Closer Look to Neurons. Front. Aging Neurosci.13, 10.3389/fnagi.2021.723871 [DOI] [PMC free article] [PubMed]
85.Clark, R. M. et al. Intranasal neuropeptide Y1 receptor antagonism improves motor deficits in symptomatic SOD1 ALS mice. Ann. Clin. Transl. Neurol.10, 1985–1999 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Clark, C. M., Clark, R. M., Hoyle, J. A. & Dickson, T. C. Pathogenic or protective? Neuropeptide Y in amyotrophic lateral sclerosis. J. Neurochem.156, 273–289 (2021). [DOI] [PubMed] [Google Scholar]
87.Ripoll-Sánchez, L. et al. Neuron111, 3570–3589.e3575 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Li, Y. & Kratsios, P. Transgenic reporter analysis of ChIP-Seq-defined enhancers identifies novel target genes for the terminal selector UNC-3/Collier/Ebf. MicroPubl. Biol.2021, 10.17912/micropub.biology.000453 [DOI] [PMC free article] [PubMed]
89.Kim, D.-Y. et al. A FMRFamide-like neuropeptide FLP-12 signaling regulates head locomotive behaviors in Caenorhabditis elegans. Mol. Cells47, 100124 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
90.Li, C. & Kim, K. Family of FLP Peptides in Caenorhabditis elegans and Related Nematodes. Front. Endocrinol.5, 10.3389/fendo.2014.00150 [DOI] [PMC free article] [PubMed]
91.Buntschuh, I. et al. FLP-1 neuropeptides modulate sensory and motor circuits in the nematode Caenorhabditis elegans. PLOS ONE13, e0189320 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Nelson, L. S., Rosoff, M. L. & Li, C. Disruption of a Neuropeptide Gene, flp-1, Causes Multiple Behavioral Defects in Caenorhabditis elegans. Science281, 1686–1690 (1998). [DOI] [PubMed] [Google Scholar]
93.Pereira, L. et al. A cellular and regulatory map of the cholinergic nervous system of C. elegans. eLife4, e12432 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
94.Speese, S. et al. UNC-31 (CAPS) Is Required for Dense-Core Vesicle But Not Synaptic Vesicle Exocytosis in Caenorhabditis elegans. J. Neurosci.27, 6150–6162 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
95.Flavell, S. W. & Greenberg, M. E. Signaling mechanisms linking neuronal activity to gene expression and plasticity of the nervous system. Annu. Rev. Neurosci.31, 563–590 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
96.Dahiya, Y. et al. Differential regulation of innate and learned behavior by Creb1/Crh-1 in Caenorhabditis elegans. J. Neurosci.39, 7934–7946 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
97.Yee, C. et al. An activity-regulated transcriptional program directly drives synaptogenesis. Nat. Neurosci.27, 1695–1707 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
98.Kim, S. Y. & Webb, A. E. Neuronal functions of FOXO/DAF-16. Nutr. Healthy Aging4, 113–126 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
99.Ooi, F. K. & Prahlad, V. Olfactory experience primes the heat shock transcription factor HSF-1 to enhance the expression of molecular chaperones in C. elegans. Sci. Signal.10, eaan4893 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
100.Juozaityte, V. et al. The ETS-5 transcription factor regulates activity states in Caenorhabditis elegans by controlling satiety. Proc. Natl. Acad. Sci. USA114, E1651–e1658 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
101.Perez, M. F. CelEst: a unified gene regulatory network for estimating transcription factor activities in C. elegans. Genetics229, 10.1093/genetics/iyae189 [DOI] [PMC free article] [PubMed]
102.Kim, K. W. et al. Coordinated inhibition of C/EBP by Tribbles in multiple tissues is essential for Caenorhabditis elegans development. BMC Biol.14, 104 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
103.Kim, B. & Emmons, S. W. Multiple conserved cell adhesion protein interactions mediate neural wiring of a sensory circuit in C. elegans. eLife6, e29257 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
104.Woo, W.-M. et al. The C. elegans F-spondin family protein SPON-1 maintains cell adhesion in neural and non-neural tissues. Development135, 2747–2756 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
105.Godini, R., Fallahi, H. & Pocock, R. The regulatory landscape of neurite development in Caenorhabditis elegans. Front. Mol. Neurosci.15, 10.3389/fnmol.2022.974208 [DOI] [PMC free article] [PubMed]
106.Yan, D., Wu, Z., Chisholm, A. D. & Jin, Y. The DLK-1 kinase promotes mRNA stability and local translation in C. elegans synapses and axon regeneration. Cell138, 1005–1018 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
107.Malinow, R. A. et al. Functional Dissection of C. elegans bZip-Protein CEBP-1 reveals novel structural motifs required for axon regeneration and nuclear import. Front. Cellular Neurosci.13, 10.3389/fncel.2019.00348 [DOI] [PMC free article] [PubMed]
108.Li, C., Hisamoto, N. & Matsumoto, K. Axon regeneration is regulated by Ets–C/EBP Transcription complexes generated by activation of the cAMP/Ca2+ signaling pathways. PLOS Genet.11, e1005603 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
109.Hendi, A., Kurashina, M. & Mizumoto, K. Intrinsic and extrinsic mechanisms of synapse formation and specificity in C. elegans. Cell. Mol. Life Sci.76, 2719–2738 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
110.Mizumoto, K., Jin, Y. & Bessereau, J.-L. Synaptogenesis: unmasking molecular mechanisms using Caenorhabditis elegans. Genetics223, 10.1093/genetics/iyac176 [DOI] [PMC free article] [PubMed]
111.Stefanakis, N., Carrera, I. & Hobert, O. Neuron87, 733–750 (2015). [DOI] [PMC free article] [PubMed]
112.Abraham, C., Bai, L. & Leube, R. E. Synaptogyrin-dependent modulation of synaptic neurotransmission in Caenorhabditis elegans. Neuroscience190, 75–88 (2011). [DOI] [PubMed] [Google Scholar]
113.Ventimiglia, D. A Comparative Study of Sensory Neuron Synaptic Activity and the Role of Presynaptic Diversity, Specificity, and Regulation in Caenorhabditis elegans, Rockefeller University (2017).
114.Oliver, D. et al. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLOS Genet.18, e1010016 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
115.Varshney, A. et al. The receptor protein tyrosine phosphatase CLR-1 is required for synaptic partner recognition. PLOS Genet.14, e1007312 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
116.Maro, G. S. et al. MADD-4/Punctin and Neurexin Organize C. elegans GABAergic Postsynapses through Neuroligin. Neuron86, 1420–1432 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
117.Pinan-Lucarré, B. et al. C. elegans Punctin specifies cholinergic versus GABAergic identity of postsynaptic domains. Nature511, 466–470 (2014). [DOI] [PubMed] [Google Scholar]
118.Okaty, B. W. et al. A single-cell transcriptomic and anatomic atlas of mouse dorsal raphe Pet1 neurons. eLife9, e55523 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
119.Kamath, T. et al. Single-cell genomic profiling of human dopamine neurons identifies a population that selectively degenerates in Parkinson’s disease. Nat. Neurosci.25, 588–595 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
120.Lu, C. et al. Essential transcription factors for induced neuron differentiation. Nat. Commun.14, 8362 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
121.Clare, A. J., Wicky, H. E., Empson, R. M. & Hughes, S. M. RNA-sequencing analysis reveals a regulatory role for transcription factor Fezf2 in the mature motor cortex. Front. Mol. Neurosci.10, 10.3389/fnmol.2017.00283 [DOI] [PMC free article] [PubMed]
122.Borromeo, M. D. et al. A transcription factor network specifying inhibitory versus excitatory neurons in the dorsal spinal cord. Development141, 2803–2812 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
123.Miozzo, F. et al. Maintenance of mitochondrial integrity in midbrain dopaminergic neurons governed by a conserved developmental transcription factor. Nat. Commun.13, 1426 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
124.Froldi, F. et al. The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells. Genes Dev.29, 129–143 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
125.Zhang, Q. et al. Temporal requirements for ISL1 in sympathetic neuron proliferation, differentiation, and diversification. Cell Death Dis.9, 247 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
126.Haspel, G., Deng, L., Harreguy, M. B. & Tanvir, Z. in The Neural Control of Movement (eds Patrick J. Whelan & Simon A. Sharples) 3-29 (Academic Press, 2020).
127.Hulme, A. J., Maksour, S., St-Clair Glover, M., Miellet, S. & Dottori, M. Making neurons, made easy: The use of Neurogenin-2 in neuronal differentiation. Stem Cell Rep.17, 14–34 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
128.Smidt, M. P., Peter, J. & Burbach, H. in Development and Engineering of Dopamine Neurons (eds R. Jeroen Pasterkamp, Marten P. Smidt, & J. Peter H. Burbach) 47-57 (Springer New York, 2009). [PubMed]
129.Pascual, M. et al. Cerebellar GABAergic progenitors adopt an external granule cell-like phenotype in the absence of Ptf1a transcription factor expression. Proc. Natl. Acad. Sci. USA104, 5193–5198 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
130.Fujitani, Y. et al. Ptf1a determines horizontal and amacrine cell fates during mouse retinal development. Development133, 4439–4450 (2006). [DOI] [PubMed] [Google Scholar]
131.Liu, C. et al. Pet-1 is required across different stages of life to regulate serotonergic function. Nat. Neurosci.13, 1190–1198 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
132.Wyler, S. C. et al. Pet-1 Switches Transcriptional Targets Postnatally to Regulate Maturation of Serotonin Neuron Excitability. J. Neurosci.36, 1758–1774 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
133.Aydin, B. et al. Foxa2 and Pet1 Direct and Indirect Synergy Drive Serotonergic Neuronal Differentiation. Front. Neurosci.16, 10.3389/fnins.2022.903881 [DOI] [PMC free article] [PubMed]
134.Gordon, P. M. & Hobert, O. A competition mechanism for a homeotic neuron identity transformation in C. elegans. Dev. Cell34, 206–219 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
135.Alqadah, A. et al. Postmitotic diversification of olfactory neuron types is mediated by differential activities of the HMG-box transcription factor SOX-2. EMBO J.34, 2574–2589 10.15252/embj.201592188 (2015). [DOI] [PMC free article] [PubMed]
136.Duttke, S. H. et al. Position-dependent function of human sequence-specific transcription factors. Nature631, 891–898 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
137.Joliot, A. et al. Identification of a signal sequence necessary for the unconventional secretion of Engrailed homeoprotein. Curr. Biol.8, 856–863 (1998). [DOI] [PubMed] [Google Scholar]
138.Sugiyama, S. et al. Experience-Dependent Transfer of Otx2 Homeoprotein into the Visual Cortex Activates Postnatal Plasticity. Cell134, 508–520 (2008). [DOI] [PubMed] [Google Scholar]
139.Beurdeley, M. et al. Otx2 Binding to Perineuronal Nets Persistently Regulates Plasticity in the Mature Visual Cortex. J. Neurosci.32, 9429–9437 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
140.Killeen, M. T. & Sybingco, S. S. Netrin, Slit and Wnt receptors allow axons to choose the axis of migration. Dev. Biol.323, 143–151 (2008). [DOI] [PubMed] [Google Scholar]
141.Xu, K. et al. Structures of netrin-1 bound to two receptors provide insight into its axon guidance mechanism. Science344, 1275–1279 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
142.Nagel, A. N. et al. Netrin-1 directs dendritic growth and connectivity of vertebrate central neurons in vivo. Neural Dev.10, 14 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
143.Gujar, M. R., Sundararajan, L., Stricker, A. & Lundquist, E. A. Control of growth cone polarity, microtubule accumulation, and protrusion by UNC-6/Netrin and its receptors in Caenorhabditis elegans. Genetics210, 235–255 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
144.Goldman, J. S. et al. Netrin-1 promotes excitatory synaptogenesis between cortical neurons by initiating synapse assembly. J. Neurosci.33, 17278–17289 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
145.Nelson, J. C. & Colón-Ramos, D. A. Serotonergic neurosecretory synapse targeting is controlled by Netrin-releasing guidepost neurons in Caenorhabditis elegans. J. Neurosci.33, 1366–1376 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
146.Berghoff, E. G. et al. The Prop1-like homeobox gene unc-42 specifies the identity of synaptically connected neurons. eLife10, e64903 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
147.Wightman, B., Baran, R. & Garriga, G. Genes that guide growth cones along the C. elegans ventral nerve cord. Development124, 2571–2580 (1997). [DOI] [PubMed] [Google Scholar]
148.Wang, J. et al. The C. elegans COE transcription factor UNC-3 activates lineage-specific apoptosis and affects neurite growth in the RID lineage. Development142, 1447–1457 (2015). [DOI] [PubMed] [Google Scholar]
149.Spencer, W. C. et al. Isolation of specific neurons from C. elegans larvae for gene expression profiling. PLoS One9, e112102 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
150.Young, M. D. & Behjati, S. SoupX removes ambient RNA contamination from droplet-based single-cell RNA sequencing data. Gigascience9, 10.1093/gigascience/giaa151 [DOI] [PMC free article] [PubMed]
151.McCarthy, D. J., Campbell, K. R., Lun, A. T. & Wills, Q. F. Scater: pre-processing, quality control, normalization and visualization of single-cell RNA-seq data in R. Bioinformatics33, 1179–1186 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
152.Cao, J. et al. Comprehensive single-cell transcriptional profiling of a multicellular organism. Science357, 661–667 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
153.Qiu, X. et al. Single-cell mRNA quantification and differential analysis with Census. Nat. Methods14, 309–315 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
154.Qiu, X. et al. Reversed graph embedding resolves complex single-cell trajectories. Nat. Methods14, 979–982 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
155.Trapnell, C. et al. The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells. Nat. Biotechnol.32, 381–386 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
156.Schmid, K. et al. SangeR: the high-throughput Sanger sequencing analysis pipeline. Bioinform. Adv.2, vbac009 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
157.Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell38, 576–589 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
158.Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol.29, 24–26 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
159.Thorvaldsdóttir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief. Bioinforma.14, 178–192 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
160.Gupta, S., Stamatoyannopoulos, J. A., Bailey, T. L. & Noble, W. S. Quantifying similarity between motifs. Genome Biol.8, R24 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
161.Gerstein, M. B. et al. Integrative analysis of the Caenorhabditis elegans Genome by the modENCODE Project. Science330, 1775–1787 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information^{(5.1MB, pdf)}

41467_2026_76320_MOESM2_ESM.pdf^{(231.3KB, pdf)}

Description of Additional Supplementary Files

Supplementary Data 1^{(16.9KB, xlsx)}

Supplementary Data 2^{(4.8MB, xlsx)}

Supplementary Data 3^{(88.9KB, xlsx)}

Supplementary Data 4^{(92.5KB, xlsx)}

Supplementary Data 5^{(138.2KB, xlsx)}

Supplementary Data 6^{(147.6KB, xlsx)}

Supplementary Data 7^{(86.3KB, pdf)}

Supplementary Data 8^{(82.6KB, pdf)}

Supplementary Data 9^{(1.1MB, csv)}

Supplementary Data 10^{(45.5KB, xlsx)}

Supplementary Data 11^{(85.4KB, xlsx)}

Supplementary Data 12^{(47.9KB, xlsx)}

Supplementary Data 13^{(18.8KB, xlsx)}

Supplementary Data 14^{(11KB, xlsx)}

Reporting Summary^{(108.6KB, pdf)}

Transparent Peer Review file^{(338.5KB, pdf)}

Source Data^{(46.3KB, xlsx)}

Data Availability Statement

Any additional information that is required to reanalyze data reported in this study is available from the lead contact upon request.

[CR1] 1.Deneris, E. S. & Hobert, O. Maintenance of postmitotic neuronal cell identity. Nat. Neurosci.17, 899–907 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR2] 2.Hobert, O. in Current Topics in Developmental Biology Vol. 116 (ed Paul M. Wassarman) 455-475 (Academic Press, 2016). [DOI] [PubMed]

[CR3] 3.Hobert, O. Regulatory logic of neuronal diversity: Terminal selector genes and selector motifs. Proc. Natl. Acad. Sci.105, 20067–20071 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR4] 4.Kratsios, P., Stolfi, A., Levine, M. & Hobert, O. Coordinated regulation of cholinergic motor neuron traits through a conserved terminal selector gene. Nat. Neurosci.15, 205–214 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR5] 5.Kratsios, P. et al. Transcriptional coordination of synaptogenesis and neurotransmitter signaling. Curr. Biol.25, 1282–1295 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR6] 6.Kratsios, P. et al. An intersectional gene regulatory strategy defines subclass diversity of C. elegans motor neurons. eLife6, e25751–e25751 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR7] 7.Kerk, S. Y., Kratsios, P., Hart, M., Mourao, R. & Hobert, O. Diversification of C. elegans motor neuron identity via selective effector gene repression. Neuron93, 80–98 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR8] 8.Li, Y. et al. Establishment and maintenance of motor neuron identity via temporal modularity in terminal selector function. eLife9, e59464 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR9] 9.Feng, W. et al. A terminal selector prevents a Hox transcriptional switch to safeguard motor neuron identity throughout life. eLife9, e50065 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR10] 10.Correa, E. et al. UNC-30/PITX coordinates neurotransmitter identity with postsynaptic GABA receptor clustering. Development151, 10.1242/dev.202733 (2024). [DOI] [PMC free article] [PubMed]

[CR11] 11.Jin, Y., Hoskins, R. & Horvitz, H. R. Control of type-D GABAergic neuron differentiation by C. elegans UNC-30 homeodomain protein. Nature372, 780–783 (1994). [DOI] [PubMed] [Google Scholar]

[CR12] 12.Schuske, K., Palfreyman, M. T., Watanabe, S. & Jorgensen, E. M. UNC-46 is required for trafficking of the vesicular GABA transporter. Nat. Neurosci.10, 846–853 (2007). [DOI] [PubMed] [Google Scholar]

[CR13] 13.McLntire, S. L., Jorgensen, E. & Horvitz, H. R. Genes required for GABA function in Caenorhabditis elegans. Nature364, 334–337 (1993). [DOI] [PubMed] [Google Scholar]

[CR14] 14.Zhang, F. et al. The LIM and POU homeobox genes ttx-3 and unc-86 act as terminal selectors in distinct cholinergic and serotonergic neuron types. Development141, 422–435 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR15] 15.Serrano-Saiz, E., Leyva-Díaz, E., De La Cruz, E. & Hobert, O. BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr. Biol.28, 2813–2823.e2812 (2018). [DOI] [PubMed] [Google Scholar]

[CR16] 16.Destain, H., Prahlad, M. & Kratsios, P. Maintenance of neuronal identity in C. elegans and beyond: Lessons from transcription and chromatin factors. Semin Cell Dev. Biol.154, 35–47 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR17] 17.Poole, R. J., Flames, N. & Cochella, L. Neurogenesis in Caenorhabditis elegans. Genetics228, 10.1093/genetics/iyae116 [DOI] [PMC free article] [PubMed]

[CR18] 18.Hobert, O. & Kratsios, P. Neuronal identity control by terminal selectors in worms, flies, and chordates. Curr. Opin. Neurobiol.56, 97–105 (2019). [DOI] [PubMed] [Google Scholar]

[CR19] 19.Hobert, O. Homeobox genes and the specification of neuronal identity. Nat. Rev. Neurosci.22, 627–636 (2021). [DOI] [PubMed] [Google Scholar]

[CR20] 20.Marz, M., Seebeck, F. & Bartscherer, K. A Pitx transcription factor controls the establishment and maintenance of the serotonergic lineage in planarians. Development140, 4499–4509 (2013). [DOI] [PubMed] [Google Scholar]

[CR21] 21.Ogawa, Y., Shiraki, T., Fukada, Y. & Kojima, D. Foxq2 determines blue cone identity in zebrafish. Sci. Adv.7, eabi9784 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR22] 22.Gabilondo, H. et al. Neuronal cell fate specification by the convergence of different spatiotemporal cues on a common terminal selector cascade. PLOS Biol.14, e1002450 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR23] 23.Chu, S.-Y., Lai, Y.-W., Hsu, T.-C., Lu, T.-M. & Yu, H.-H. Isoforms of terminal selector Mamo control axon guidance during adult Drosophila memory center construction via Semaphorin-1a. Dev. Biol.515, 1–6 (2024). [DOI] [PubMed] [Google Scholar]

[CR24] 24.Özel, M. N. et al. Coordinated control of neuronal differentiation and wiring by sustained transcription factors. Science378, eadd1884 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR25] 25.Park, Y., Nnamani, M. C., Maziarz, J. & Wagner, G. P. Cis-Regulatory Evolution of Forkhead Box O1 (FOXO1), a Terminal Selector Gene for Decidual Stromal Cell Identity. Mol. Biol. Evol.33, 3161–3169 (2016). [DOI] [PubMed] [Google Scholar]

[CR26] 26.Remesal, L. et al. PBX1 acts as terminal selector for olfactory bulb dopaminergic neurons. Development147, 10.1242/dev.186841 [DOI] [PubMed]

[CR27] 27.Lipiec, M. A. et al. TCF7L2 regulates postmitotic differentiation programmes and excitability patterns in the thalamus. Development147, 10.1242/dev.190181 [DOI] [PMC free article] [PubMed]

[CR28] 28.Smolin, N. et al. Neuronal identity control at the resolution of a single transcription factor isoform. bioRxiv, 2024.2006.2014.598883. 10.1101/2024.06.14.598883 [DOI]

[CR29] 29.Simon, F. et al. Establishment of terminal selector combinations in optic lobe neurons. bioRxiv, 2024.2002.2005.578975. 10.1101/2024.02.05.578975 [DOI]

[CR30] 30.Kilpinen, S. et al. Gene regulatory mechanisms guiding bifurcation of inhibitory and excitatory neuron lineages in the anterior brainstem. bioRxiv, 2025.2001.2026.634960. 10.1101/2025.01.26.634960 [DOI] [PMC free article] [PubMed]

[CR31] 31.Marques, F., Chen, Y., Destain, H., Marinelli, M. & Kratsios, P. Interlocked transcription factor feedback loops maintain and restore touch sensation. bioRxiv, 2025.2005.2015.654349. 10.1101/2025.05.15.654349 [DOI] [PMC free article] [PubMed]

[CR32] 32.Taylor, S. R. et al. Molecular topography of an entire nervous system. Cell184, 4329–4347.e4323 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR33] 33.Smith, J. J. et al. A molecular atlas of adult C. elegans motor neurons reveals ancient diversity delineated by conserved transcription factor codes. Cell Rep.43, 113857 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR34] 34.White, J. G., Southgate, E., Thomson, J. N. & Brenner, S. The structure of the ventral nerve cord of Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. Ser. B, Biol. Sci.275, 327–348 (1976). [DOI] [PubMed] [Google Scholar]

[CR35] 35.Von Stetina, S. E., Treinin, M. & Miller, D. M. The motor circuit. Int Rev. Neurobiol.69, 125–167 (2006). [DOI] [PubMed] [Google Scholar]

[CR36] 36.Barbagallo, B. et al. Excitatory neurons sculpt GABAergic neuronal connectivity in the C. elegans motor circuit. Development144, 1807–1819 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR37] 37.Philbrook, A. et al. Neurexin directs partner-specific synaptic connectivity in C. elegans. eLife7, e35692 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR38] 38.Narayanan, D. L., Kutsche, K. & Girisha, K. M. EBF3 Neurodevelopmental Disorder. (University of Washington, Seattle, 1993). [PubMed]

[CR39] 39.Chao, H.-T. et al. A syndromic neurodevelopmental disorder caused by De Novo variants in EBF3. Am. J. Hum. Genet.100, 128–137 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR40] 40.Sleven, H. et al. De Novo mutations in EBF3 cause a neurodevelopmental syndrome. Am. J. Hum. Genet.100, 138–150 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR41] 41.D’Arrigo, S. et al. Abnormal cerebellar foliation in EBF3 mutation. Neurology94, 933–935 (2020). [DOI] [PubMed] [Google Scholar]

[CR42] 42.Nishi, E. et al. Clinical spectrum of individuals with de novo EBF3 variants or deletions. Am. J. Med. Genet. A185, 2913–2921 (2021). [DOI] [PubMed] [Google Scholar]

[CR43] 43.Deisseroth, C. A. et al. An integrated phenotypic and genotypic approach reveals a high-risk subtype association for EBF3 Missense variants affecting the zinc finger domain. Ann. Neurol.92, 138–153 (2022). [DOI] [PubMed] [Google Scholar]

[CR44] 44.Ciaccio, C. et al. Neurologic, neuropsychologic, and neuroradiologic features of EBF3-related Syndrome. Neurol. Genet.9, e200049 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR45] 45.Zhu, J. et al. Further delineation of EBF3-related syndromic neurodevelopmental disorder in twelve Chinese patients. Front. Pediatr.11, 10.3389/fped.2023.1091532 [DOI] [PMC free article] [PubMed]

[CR46] 46.Chiara, F. et al. Early B-cell factors 2 and 3 (EBF2/3) regulate early migration of Cajal-Retzius cells from the cortical hem. Dev. Biol.365, 277–289 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR47] 47.Iwai, R. et al. A Prdm8 target gene Ebf3 regulates multipolar-to-bipolar transition in migrating neocortical cells. Biochem Biophys. Res Commun.495, 388–394 (2018). [DOI] [PubMed] [Google Scholar]

[CR48] 48.Zhu, Y. et al. Discovery of coding regions in the human genome by integrated proteogenomics analysis workflow. Nat. Commun.9, 903 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR49] 49.Roadmap Epigenomics, C. et al. Integrative analysis of 111 reference human epigenomes. Nature518, 317–330 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR50] 50.Lindsay, S. J. et al. HDBR expression: a unique resource for global and individual gene expression studies during early human brain development. Front. Neuroanat.10, 10.3389/fnana.2016.00086 [DOI] [PMC free article] [PubMed]

[CR51] 51.White, J. G., Southgate, E., Thomson, J. N. & Brenner, S. The Structure of the Nervous System of the Nematode Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. Biol. Sci.314, 1–340 (1986). [DOI] [PubMed] [Google Scholar]

[CR52] 52.Ward, S., Thomson, N., White, J. G. & Brenner, S. Electron microscopical reconstruction of the anterior sensory anatomy of the nematode Caenorhabditis elegans. J. Comp. Neurol.160, 313–337 (1975). [DOI] [PubMed] [Google Scholar]

[CR53] 53.Chalfie, M. et al. The neural circuit for touch sensitivity in Caenorhabditis elegans. J. Neurosci.5, 956 LP–964 (1985). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR54] 54.Cook, S. J. et al. Whole-animal connectomes of both Caenorhabditis elegans sexes. Nature571, 63–71 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR55] 55.Tolstenkov, O. et al. Functionally asymmetric motor neurons contribute to coordinating locomotion of Caenorhabditis elegans. Elife7. 10.7554/eLife.34997 [DOI] [PMC free article] [PubMed]

[CR56] 56.Taylor, S. R., McWhirter, R. D., Matlock, B. K., Flaherty, D. K. & Miller, D. M. Protocol for isolating specific C. elegans neuron types for bulk and single-cell RNA sequencing. STAR Protoc.5, 103439 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR57] 57.Destain, H., Koh, A., Shin, H., Brown, A. E. X. & Kratsios, P. Continuous negative autoregulation fine-tunes dosage-sensitive transcription factor expression to maintain post-mitotic neuron identity. bioRxiv. 10.64898/2026.05.14.725191 [DOI]

[CR58] 58.Yemini, E. et al. NeuroPAL: a multicolor atlas for whole-brain neuronal identification in C. elegans. Cell184, 272–288.e211 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR59] 59.Prasad, B., Karakuzu, O., Reed, R. R. & Cameron, S. unc-3-dependent repression of specific motor neuron fates in Caenorhabditis elegans. Dev. Biol.323, 207–215 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR60] 60.Feng, W., Destain, H., Smith, J. J. & Kratsios, P. Maintenance of neurotransmitter identity by Hox proteins through a homeostatic mechanism. Nat. Commun.13, 6097 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR61] 61.Holdorf, A. D. et al. WormCat: an online tool for annotation and visualization of Caenorhabditis elegans Genome-Scale Data. Genetics214, 279–294 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR62] 62.Castro-Mondragon, J. A. et al. JASPAR 2022: the 9th release of the open-access database of transcription factor binding profiles. Nucleic Acids Res.50, D165–D173 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR63] 63.Rumley, J. D., Kim, J. H. & Hobert, O. Protocol to identify transcription factor target genes using TargetOrtho2. STAR Protoc.6, 103680 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR64] 64.Glenwinkel, L. et al. In silico analysis of the transcriptional regulatory logic of neuronal identity specification throughout the C. elegans nervous system. eLife10, e64906 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR65] 65.Glenwinkel, L., Wu, D., Minevich, G. & Hobert, O. TargetOrtho: a phylogenetic footprinting tool to identify transcription factor targets. Genetics197, 61–76 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR66] 66.Zhang, L., Ward, J. D., Cheng, Z. & Dernburg, A. F. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development142, 4374–4384 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR67] 67.Packer, J. S. et al. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science365, eaax1971 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR68] 68.Ma, X. et al. A 4D single-cell protein atlas of transcription factors delineates spatiotemporal patterning during embryogenesis. Nat. Methods18, 893–902 (2021). [DOI] [PubMed] [Google Scholar]

[CR69] 69.Prasad, B. C. et al. unc-3, a gene required for axonal guidance in Caenorhabditis elegans, encodes a member of the O/E family of transcription factors. Development125, 1561–1568 (1998). [DOI] [PubMed] [Google Scholar]

[CR70] 70.Howell, K., White, J. G. & Hobert, O. Spatiotemporal control of a novel synaptic organizer molecule. Nature523, 83–87 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR71] 71.Bhat, U. S., Shahi, N., Surendran, S. & Babu, K. Neuropeptides and Behaviors: How Small Peptides Regulate Nervous System Function and Behavioral Outputs. Front. Mol. Neurosci.14, 10.3389/fnmol.2021.786471 [DOI] [PMC free article] [PubMed]

[CR72] 72.Chen, D., Taylor, K. P., Hall, Q. & Kaplan, J. M. The neuropeptides FLP-2 and PDF-1 Act in concert to arouse Caenorhabditis elegans Locomotion. Genetics204, 1151–1159 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR73] 73.Chang, Y.-J. et al. Modulation of locomotion and reproduction by FLP neuropeptides in the nematode Caenorhabditis elegans. PLOS ONE10, e0135164 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR74] 74.Stawicki, T. M., Takayanagi-Kiya, S., Zhou, K. & Jin, Y. Neuropeptides Function in a Homeostatic Manner to Modulate Excitation-Inhibition Imbalance in C. elegans. PLOS Genet.9, e1003472 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR75] 75.Ramachandran, S. et al. A conserved neuropeptide system links head and body motor circuits to enable adaptive behavior. eLife10, e71747 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR76] 76.Kahsai, L., Martin, J.-R. & Winther, ÅM. E. Neuropeptides in the Drosophila central complex in modulation of locomotor behavior. J. Exp. Biol.213, 2256–2265 (2010). [DOI] [PubMed] [Google Scholar]

[CR77] 77.Lee, S. H., Cho, E., Yoon, S.-E., Kim, Y. & Kim, E. Y. Metabolic control of daily locomotor activity mediated by tachykinin in Drosophila. Commun. Biol.4, 693 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR78] 78.Watteyne, J., Chudinova, A., Ripoll-Sánchez, L., Schafer, W. R. & Beets, I. Neuropeptide signaling network of Caenorhabditis elegans: from structure to behavior. Genetics228, 10.1093/genetics/iyae141 (2024). [DOI] [PMC free article] [PubMed]

[CR79] 79.Li, C., Wu, X.-J. & Li, W. Neuropeptide S promotes maintenance of newly formed dendritic spines and performance improvement after motor learning in mice. Peptides156, 170860 (2022). [DOI] [PubMed] [Google Scholar]

[CR80] 80.Das Gupta, R. R., Scheurer, L., Pelczar, P., Wildner, H. & Zeilhofer, H. U. Neuron-specific spinal cord translatomes reveal a neuropeptide code for mouse dorsal horn excitatory neurons. Sci. Rep.11, 5232 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR81] 81.Blum, J. A. et al. Single-cell transcriptomic analysis of the adult mouse spinal cord reveals molecular diversity of autonomic and skeletal motor neurons. [DOI] [PMC free article] [PubMed]

[CR82] 82.de Groat, W. C. et al. The role of neuropeptides in the sacral autonomic reflex pathways of the cat. J. Auton. Nerv. Syst.7, 339–350 (1983). [DOI] [PubMed] [Google Scholar]

[CR83] 83.Cui, C. et al. Adequate expression of neuropeptide Y is essential for the recovery of zebrafish motor function following spinal cord injury. Exp. Neurol.345, 113831 (2021). [DOI] [PubMed] [Google Scholar]

[CR84] 84.Zuccaro, E., Piol, D., Basso, M. & Pennuto, M. Motor Neuron Diseases and Neuroprotective Peptides: A Closer Look to Neurons. Front. Aging Neurosci.13, 10.3389/fnagi.2021.723871 [DOI] [PMC free article] [PubMed]

[CR85] 85.Clark, R. M. et al. Intranasal neuropeptide Y1 receptor antagonism improves motor deficits in symptomatic SOD1 ALS mice. Ann. Clin. Transl. Neurol.10, 1985–1999 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR86] 86.Clark, C. M., Clark, R. M., Hoyle, J. A. & Dickson, T. C. Pathogenic or protective? Neuropeptide Y in amyotrophic lateral sclerosis. J. Neurochem.156, 273–289 (2021). [DOI] [PubMed] [Google Scholar]

[CR87] 87.Ripoll-Sánchez, L. et al. Neuron111, 3570–3589.e3575 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR88] 88.Li, Y. & Kratsios, P. Transgenic reporter analysis of ChIP-Seq-defined enhancers identifies novel target genes for the terminal selector UNC-3/Collier/Ebf. MicroPubl. Biol.2021, 10.17912/micropub.biology.000453 [DOI] [PMC free article] [PubMed]

[CR89] 89.Kim, D.-Y. et al. A FMRFamide-like neuropeptide FLP-12 signaling regulates head locomotive behaviors in Caenorhabditis elegans. Mol. Cells47, 100124 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR90] 90.Li, C. & Kim, K. Family of FLP Peptides in Caenorhabditis elegans and Related Nematodes. Front. Endocrinol.5, 10.3389/fendo.2014.00150 [DOI] [PMC free article] [PubMed]

[CR91] 91.Buntschuh, I. et al. FLP-1 neuropeptides modulate sensory and motor circuits in the nematode Caenorhabditis elegans. PLOS ONE13, e0189320 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR92] 92.Nelson, L. S., Rosoff, M. L. & Li, C. Disruption of a Neuropeptide Gene, flp-1, Causes Multiple Behavioral Defects in Caenorhabditis elegans. Science281, 1686–1690 (1998). [DOI] [PubMed] [Google Scholar]

[CR93] 93.Pereira, L. et al. A cellular and regulatory map of the cholinergic nervous system of C. elegans. eLife4, e12432 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR94] 94.Speese, S. et al. UNC-31 (CAPS) Is Required for Dense-Core Vesicle But Not Synaptic Vesicle Exocytosis in Caenorhabditis elegans. J. Neurosci.27, 6150–6162 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR95] 95.Flavell, S. W. & Greenberg, M. E. Signaling mechanisms linking neuronal activity to gene expression and plasticity of the nervous system. Annu. Rev. Neurosci.31, 563–590 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR96] 96.Dahiya, Y. et al. Differential regulation of innate and learned behavior by Creb1/Crh-1 in Caenorhabditis elegans. J. Neurosci.39, 7934–7946 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR97] 97.Yee, C. et al. An activity-regulated transcriptional program directly drives synaptogenesis. Nat. Neurosci.27, 1695–1707 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR98] 98.Kim, S. Y. & Webb, A. E. Neuronal functions of FOXO/DAF-16. Nutr. Healthy Aging4, 113–126 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR99] 99.Ooi, F. K. & Prahlad, V. Olfactory experience primes the heat shock transcription factor HSF-1 to enhance the expression of molecular chaperones in C. elegans. Sci. Signal.10, eaan4893 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR100] 100.Juozaityte, V. et al. The ETS-5 transcription factor regulates activity states in Caenorhabditis elegans by controlling satiety. Proc. Natl. Acad. Sci. USA114, E1651–e1658 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR101] 101.Perez, M. F. CelEst: a unified gene regulatory network for estimating transcription factor activities in C. elegans. Genetics229, 10.1093/genetics/iyae189 [DOI] [PMC free article] [PubMed]

[CR102] 102.Kim, K. W. et al. Coordinated inhibition of C/EBP by Tribbles in multiple tissues is essential for Caenorhabditis elegans development. BMC Biol.14, 104 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR103] 103.Kim, B. & Emmons, S. W. Multiple conserved cell adhesion protein interactions mediate neural wiring of a sensory circuit in C. elegans. eLife6, e29257 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR104] 104.Woo, W.-M. et al. The C. elegans F-spondin family protein SPON-1 maintains cell adhesion in neural and non-neural tissues. Development135, 2747–2756 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR105] 105.Godini, R., Fallahi, H. & Pocock, R. The regulatory landscape of neurite development in Caenorhabditis elegans. Front. Mol. Neurosci.15, 10.3389/fnmol.2022.974208 [DOI] [PMC free article] [PubMed]

[CR106] 106.Yan, D., Wu, Z., Chisholm, A. D. & Jin, Y. The DLK-1 kinase promotes mRNA stability and local translation in C. elegans synapses and axon regeneration. Cell138, 1005–1018 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR107] 107.Malinow, R. A. et al. Functional Dissection of C. elegans bZip-Protein CEBP-1 reveals novel structural motifs required for axon regeneration and nuclear import. Front. Cellular Neurosci.13, 10.3389/fncel.2019.00348 [DOI] [PMC free article] [PubMed]

[CR108] 108.Li, C., Hisamoto, N. & Matsumoto, K. Axon regeneration is regulated by Ets–C/EBP Transcription complexes generated by activation of the cAMP/Ca2+ signaling pathways. PLOS Genet.11, e1005603 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR109] 109.Hendi, A., Kurashina, M. & Mizumoto, K. Intrinsic and extrinsic mechanisms of synapse formation and specificity in C. elegans. Cell. Mol. Life Sci.76, 2719–2738 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR110] 110.Mizumoto, K., Jin, Y. & Bessereau, J.-L. Synaptogenesis: unmasking molecular mechanisms using Caenorhabditis elegans. Genetics223, 10.1093/genetics/iyac176 [DOI] [PMC free article] [PubMed]

[CR111] 111.Stefanakis, N., Carrera, I. & Hobert, O. Neuron87, 733–750 (2015). [DOI] [PMC free article] [PubMed]

[CR112] 112.Abraham, C., Bai, L. & Leube, R. E. Synaptogyrin-dependent modulation of synaptic neurotransmission in Caenorhabditis elegans. Neuroscience190, 75–88 (2011). [DOI] [PubMed] [Google Scholar]

[CR113] 113.Ventimiglia, D. A Comparative Study of Sensory Neuron Synaptic Activity and the Role of Presynaptic Diversity, Specificity, and Regulation in Caenorhabditis elegans, Rockefeller University (2017).

[CR114] 114.Oliver, D. et al. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLOS Genet.18, e1010016 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR115] 115.Varshney, A. et al. The receptor protein tyrosine phosphatase CLR-1 is required for synaptic partner recognition. PLOS Genet.14, e1007312 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR116] 116.Maro, G. S. et al. MADD-4/Punctin and Neurexin Organize C. elegans GABAergic Postsynapses through Neuroligin. Neuron86, 1420–1432 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR117] 117.Pinan-Lucarré, B. et al. C. elegans Punctin specifies cholinergic versus GABAergic identity of postsynaptic domains. Nature511, 466–470 (2014). [DOI] [PubMed] [Google Scholar]

[CR118] 118.Okaty, B. W. et al. A single-cell transcriptomic and anatomic atlas of mouse dorsal raphe Pet1 neurons. eLife9, e55523 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR119] 119.Kamath, T. et al. Single-cell genomic profiling of human dopamine neurons identifies a population that selectively degenerates in Parkinson’s disease. Nat. Neurosci.25, 588–595 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR120] 120.Lu, C. et al. Essential transcription factors for induced neuron differentiation. Nat. Commun.14, 8362 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR121] 121.Clare, A. J., Wicky, H. E., Empson, R. M. & Hughes, S. M. RNA-sequencing analysis reveals a regulatory role for transcription factor Fezf2 in the mature motor cortex. Front. Mol. Neurosci.10, 10.3389/fnmol.2017.00283 [DOI] [PMC free article] [PubMed]

[CR122] 122.Borromeo, M. D. et al. A transcription factor network specifying inhibitory versus excitatory neurons in the dorsal spinal cord. Development141, 2803–2812 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR123] 123.Miozzo, F. et al. Maintenance of mitochondrial integrity in midbrain dopaminergic neurons governed by a conserved developmental transcription factor. Nat. Commun.13, 1426 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR124] 124.Froldi, F. et al. The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells. Genes Dev.29, 129–143 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR125] 125.Zhang, Q. et al. Temporal requirements for ISL1 in sympathetic neuron proliferation, differentiation, and diversification. Cell Death Dis.9, 247 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR126] 126.Haspel, G., Deng, L., Harreguy, M. B. & Tanvir, Z. in The Neural Control of Movement (eds Patrick J. Whelan & Simon A. Sharples) 3-29 (Academic Press, 2020).

[CR127] 127.Hulme, A. J., Maksour, S., St-Clair Glover, M., Miellet, S. & Dottori, M. Making neurons, made easy: The use of Neurogenin-2 in neuronal differentiation. Stem Cell Rep.17, 14–34 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR128] 128.Smidt, M. P., Peter, J. & Burbach, H. in Development and Engineering of Dopamine Neurons (eds R. Jeroen Pasterkamp, Marten P. Smidt, & J. Peter H. Burbach) 47-57 (Springer New York, 2009). [PubMed]

[CR129] 129.Pascual, M. et al. Cerebellar GABAergic progenitors adopt an external granule cell-like phenotype in the absence of Ptf1a transcription factor expression. Proc. Natl. Acad. Sci. USA104, 5193–5198 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR130] 130.Fujitani, Y. et al. Ptf1a determines horizontal and amacrine cell fates during mouse retinal development. Development133, 4439–4450 (2006). [DOI] [PubMed] [Google Scholar]

[CR131] 131.Liu, C. et al. Pet-1 is required across different stages of life to regulate serotonergic function. Nat. Neurosci.13, 1190–1198 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR132] 132.Wyler, S. C. et al. Pet-1 Switches Transcriptional Targets Postnatally to Regulate Maturation of Serotonin Neuron Excitability. J. Neurosci.36, 1758–1774 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR133] 133.Aydin, B. et al. Foxa2 and Pet1 Direct and Indirect Synergy Drive Serotonergic Neuronal Differentiation. Front. Neurosci.16, 10.3389/fnins.2022.903881 [DOI] [PMC free article] [PubMed]

[CR134] 134.Gordon, P. M. & Hobert, O. A competition mechanism for a homeotic neuron identity transformation in C. elegans. Dev. Cell34, 206–219 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR135] 135.Alqadah, A. et al. Postmitotic diversification of olfactory neuron types is mediated by differential activities of the HMG-box transcription factor SOX-2. EMBO J.34, 2574–2589 10.15252/embj.201592188 (2015). [DOI] [PMC free article] [PubMed]

[CR136] 136.Duttke, S. H. et al. Position-dependent function of human sequence-specific transcription factors. Nature631, 891–898 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR137] 137.Joliot, A. et al. Identification of a signal sequence necessary for the unconventional secretion of Engrailed homeoprotein. Curr. Biol.8, 856–863 (1998). [DOI] [PubMed] [Google Scholar]

[CR138] 138.Sugiyama, S. et al. Experience-Dependent Transfer of Otx2 Homeoprotein into the Visual Cortex Activates Postnatal Plasticity. Cell134, 508–520 (2008). [DOI] [PubMed] [Google Scholar]

[CR139] 139.Beurdeley, M. et al. Otx2 Binding to Perineuronal Nets Persistently Regulates Plasticity in the Mature Visual Cortex. J. Neurosci.32, 9429–9437 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR140] 140.Killeen, M. T. & Sybingco, S. S. Netrin, Slit and Wnt receptors allow axons to choose the axis of migration. Dev. Biol.323, 143–151 (2008). [DOI] [PubMed] [Google Scholar]

[CR141] 141.Xu, K. et al. Structures of netrin-1 bound to two receptors provide insight into its axon guidance mechanism. Science344, 1275–1279 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR142] 142.Nagel, A. N. et al. Netrin-1 directs dendritic growth and connectivity of vertebrate central neurons in vivo. Neural Dev.10, 14 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR143] 143.Gujar, M. R., Sundararajan, L., Stricker, A. & Lundquist, E. A. Control of growth cone polarity, microtubule accumulation, and protrusion by UNC-6/Netrin and its receptors in Caenorhabditis elegans. Genetics210, 235–255 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR144] 144.Goldman, J. S. et al. Netrin-1 promotes excitatory synaptogenesis between cortical neurons by initiating synapse assembly. J. Neurosci.33, 17278–17289 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR145] 145.Nelson, J. C. & Colón-Ramos, D. A. Serotonergic neurosecretory synapse targeting is controlled by Netrin-releasing guidepost neurons in Caenorhabditis elegans. J. Neurosci.33, 1366–1376 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR146] 146.Berghoff, E. G. et al. The Prop1-like homeobox gene unc-42 specifies the identity of synaptically connected neurons. eLife10, e64903 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR147] 147.Wightman, B., Baran, R. & Garriga, G. Genes that guide growth cones along the C. elegans ventral nerve cord. Development124, 2571–2580 (1997). [DOI] [PubMed] [Google Scholar]

[CR148] 148.Wang, J. et al. The C. elegans COE transcription factor UNC-3 activates lineage-specific apoptosis and affects neurite growth in the RID lineage. Development142, 1447–1457 (2015). [DOI] [PubMed] [Google Scholar]

[CR149] 149.Spencer, W. C. et al. Isolation of specific neurons from C. elegans larvae for gene expression profiling. PLoS One9, e112102 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR150] 150.Young, M. D. & Behjati, S. SoupX removes ambient RNA contamination from droplet-based single-cell RNA sequencing data. Gigascience9, 10.1093/gigascience/giaa151 [DOI] [PMC free article] [PubMed]

[CR151] 151.McCarthy, D. J., Campbell, K. R., Lun, A. T. & Wills, Q. F. Scater: pre-processing, quality control, normalization and visualization of single-cell RNA-seq data in R. Bioinformatics33, 1179–1186 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR152] 152.Cao, J. et al. Comprehensive single-cell transcriptional profiling of a multicellular organism. Science357, 661–667 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR153] 153.Qiu, X. et al. Single-cell mRNA quantification and differential analysis with Census. Nat. Methods14, 309–315 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR154] 154.Qiu, X. et al. Reversed graph embedding resolves complex single-cell trajectories. Nat. Methods14, 979–982 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR155] 155.Trapnell, C. et al. The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells. Nat. Biotechnol.32, 381–386 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR156] 156.Schmid, K. et al. SangeR: the high-throughput Sanger sequencing analysis pipeline. Bioinform. Adv.2, vbac009 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR157] 157.Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell38, 576–589 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR158] 158.Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol.29, 24–26 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR159] 159.Thorvaldsdóttir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief. Bioinforma.14, 178–192 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR160] 160.Gupta, S., Stamatoyannopoulos, J. A., Bailey, T. L. & Noble, W. S. Quantifying similarity between motifs. Genome Biol.8, R24 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR161] 161.Gerstein, M. B. et al. Integrative analysis of the Caenorhabditis elegans Genome by the modENCODE Project. Science330, 1775–1787 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Intrinsic and non-cell-autonomous roles for the neurodevelopmental syndrome-linked transcription factor UNC-3/EBF

Jayson J Smith

Seth R Taylor

Honorine Destain

Grace Kim

David H Hall

John G White

David M Miller III

Paschalis Kratsios

Abstract

Introduction

Fig. 1. Single-cell profiling of host and downstream MNs in the presence and absence of UNC-3/EBF.

Results

C. elegans nerve cord: a model for circuit-level TF studies

unc-3 affects the transcriptome of host and downstream cells

AS MNs are partially resilient to unc-3 loss

Fig. 2. AS MN identity partially persists in the absence of UNC-3/EBF.

UNC-3 promotes host MN identity and limits ectopic expression

Fig. 3. UNC-3/EBF has dual regulatory functions in host MNs.

UNC-3 occupies distinct motifs at repressed targets

UNC-3 suppresses alternate identity features in host MNs

Fig. 4. UNC-3/EBF suppresses alternative neuronal identities in host MNs.

UNC-3 continuously suppresses GABA NT identity in host MNs

Transcriptional dysregulation of GABA MNs in unc-3 mutants

Fig. 5. UNC-3/EBF loss leads to widespread transcriptomic disruption in downstream MNs.

UNC-3 impacts neuropeptide signaling in downstream GABA MNs

UNC-3 effects on GABA MNs depend on ACh biosynthesis

unc-3 loss triggers a CEBP-1-mediated response in GABA MNs

Fig. 6. Loss of unc-3 in host MNs triggers a pro-regenerative response in downstream MNs.

unc-3 loss in host MNs causes axon defects in GABA MNs

Fig. 7. UNC-3/EBF impacts downstream cell morphology.

UNC-3 influences downstream GABA MN connectivity

Fig. 8. UNC-3/EBF impacts downstream MN connectivity.

Discussion

Methods

Maintenance of C. elegans strains

Preparation of day 1 adult stage C. elegans and dissociation

FACS isolation of C. elegans motor neurons for single-cell RNA-seq

Single-cell RNA sequencing

Downstream processing

Motor neuron class and subclass identification in C. elegans

Differential Expression in C. elegans motor neurons: wild-type vs. unc-3(n3435)

DEG enrichment analysis

Transcription factor activity estimation

Microscopy

Fluorescence intensity quantifications

Identification of motor neuron classes and subclasses in C. elegans

Temporally controlled UNC-3 degradation

UNC-3 cDNA rescue in host MNs

De novo motif discovery in differentially expressed genes

UNC-3 ChIP-seq binding enrichment at differentially expressed genes

Electron microscopical analysis

Statistics and reproducibility

Reporting summary

Supplementary information

Source data

Acknowledgements

Author contributions

Peer review

Peer review information

Funding

Data availability

Code availability

Competing interests

Footnotes

Contributor Information

Supplementary information

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases