Enhanced exosomes for fertility protection against chemotherapy-induced ovarian damage

Abstract

Exosome-based therapies are emerging as promising tools in regenerative medicine and tissue protection. In this study, we engineered exosomes by mimicking paracrine signaling between umbilical cord-derived mesenchymal stem cells (UC-MSCs) and granulosa cells to mitigate chemotherapy-induced ovarian toxicity. Enhanced exosomes were evaluated in vitro, in vivo, and ex vivo using human granulosa cells, cyclophosphamide-treated mice, and cultured ovarian tissues from humans and rats. Enhanced exosomes demonstrated protective effects compared with chemotherapy-only controls. Molecular analyses revealed increased pro-proliferative and anti-apoptotic gene expression and reduced apoptotic markers following treatment. In vivo, enhanced exosome administration was associated with 70% higher primordial follicle counts and a two-fold increase in combined primordial and primary follicles relative to CTX controls. Primary follicle numbers were markedly elevated ( > 20-fold vs CTX). In breeding studies, pup numbers increased from 1 in CTX-treated mice to 7 in enhanced exosome–treated mice in the first mating, and pregnancies were observed in later breeding rounds only in the enhanced group. Enhanced exosomes also modulated ATP-binding cassette transporter expression. In human ovarian tissue ex vivo, treatment resulted in a two-fold increase in AMHR2 expression. These findings support engineered exosomes as a potential platform for oncofertility preservation and mitigation of chemotherapy-associated gonadotoxicity.

Introduction

The survival rates of premenopausal women diagnosed with cancer have significantly improved in recent years. As a result, preserving their quality of life, particularly reproductive function, after treatment has become increasingly important. However, standard cancer therapies, including chemotherapy, radiation, hormone therapy, and surgery, can severely compromise future fertility. This highlights the urgent need for proactive and innovative strategies that safeguard not only survival but also reproductive health and overall well-being, supporting a more holistic approach to cancer survivorship.

At birth, the human ovary contains approximately one to two million primordial follicles¹. By puberty, this number declines to around 400,000–500,000, each housing an oocyte capable of fertilization². Follicular depletion is a natural, lifelong process that culminates in menopause. Unfortunately, cytotoxic cancer therapies, particularly alkylating agents and topoisomerase inhibitors, accelerate the depletion of this finite follicle pool³, leading to the condition known as premature ovarian insufficiency (POI). POI is associated with a range of adverse outcomes, including amenorrhea, disrupted puberty, hypoestrogenism, cardiovascular risks, reduced bone mineral density, and infertility⁴. These effects have profound implications, especially for young cancer survivors, and underscore the need for safe, effective, and accessible fertility-preservation strategies.

Several fertility-preservation options are available for young female cancer patients, but each carries significant limitations. The use of GnRH agonists or ovarian tissue cryopreservation, for example, remains controversial in terms of efficacy^3,5. The most established approach for postpubertal patients is oocyte or embryo cryopreservation, which involves hormonal stimulation, oocyte retrieval, and subsequent cryopreservation of oocytes or fertilized embryos. However, delivery rates from cryopreserved embryos range only from 18% to 20%⁶, and the procedure is time-consuming, costly, and may damage embryos during freezing or thawing. Moreover, prolonged cryopreservation is associated with reduced pregnancy and live birth rates, making it less suitable for younger patients⁷.

When cancer treatment cannot be delayed, ovarian tissue cryopreservation is typically recommended. For prepubertal girls, it remains the only available fertility-preservation method⁸. The procedure involves laparoscopic removal of ovarian tissue, cryopreservation, and future retransplantation. Although the live birth rate following retransplantation is approximately 30%⁹, potential risks include tissue damage during freezing, ischemia-reperfusion injury, and—depending on the cancer type—the inadvertent reintroduction of malignant cells³.

Alternative options include adoption or third-party reproduction, such as surrogacy using donor gametes or cryopreserved embryos. Gestational surrogacy, in which a fertilized embryo is implanted into a surrogate’s uterus, has a reported success rate of 75% in the U.S. as of 2021¹⁰. Despite its feasibility, surrogacy is financially burdensome and often inaccessible. Adoption, while a viable pathway to parenthood, is frequently complicated by the medical and social stigma associated with a history of cancer¹¹. These limitations further reinforce the pressing need for novel fertility-preservation techniques that are safe, effective, and widely applicable—particularly for young girls and women undergoing gonadotoxic treatments.

Regenerative medicine has emerged as a promising field offering new solutions for conditions once deemed untreatable¹². At its core are mesenchymal stem cells (MSCs), multipotent stromal cells derived from tissues such as bone marrow, adipose tissue, and the umbilical cord. These cells possess self-renewal capacity, multilineage differentiation potential, and potent therapeutic effects¹³. Notably, growing evidence suggests that the regenerative effects of MSCs are primarily mediated by paracrine factors, especially extracellular vesicles secreted by the cells¹⁴. Among EVs, exosomes have gained significant interest as key mediators of intercellular communication. These nanosized vesicles transfer proteins, lipids, and diverse RNA species to recipient cells, thereby modulating cellular responses. MSC-derived exosomes retain many of the therapeutic properties of their parent cells, including anti-apoptotic, immunomodulatory, and anti-inflammatory activities, while offering advantages as a cell-free therapeutic platform¹⁵. Because of their low immunogenicity, high biocompatibility, and intrinsic targeting capability, exosomes are increasingly being explored as diagnostic tools, drug delivery vehicles, and therapeutic agents^16,17.

Recent studies have begun to investigate exosome-based therapies in reproductive medicine and fertility preservation^18–21. Preclinical models suggest that MSC-derived exosomes can attenuate chemotherapy-induced ovarian damage by reducing apoptosis, modulating oxidative stress, and supporting follicular survival^18,19. However, most reported approaches rely on naïve exosomes, are largely restricted to rodent models, and provide limited mechanistic insight or validation in human ovarian tissue. In addition, strategies to engineer exosomes with enhanced ovarian specificity and protective potency remain insufficiently explored. These limitations highlight the need for advanced exosome engineering approaches tailored to ovarian physiology.

To address this gap, we developed a strategy to enhance the therapeutic properties of MSC-derived exosomes by modifying the MSC secretome through co-culture with ovarian granulosa cells, thereby mimicking key aspects of the ovarian follicular microenvironment. Umbilical cord-derived MSCs (UC-MSCs) were selected as the exosome source due to their well-documented immunomodulatory properties, high exosome yield, and favorable clinical safety profile^22,23. Incorporation of granulosa cells into the co-culture system was intended to enrich exosomes with ovary-relevant paracrine signals and molecular features associated with ovarian stress responses.

In the present study, we evaluated these bioengineered exosomes across complementary in vitro, in vivo, and ex vivo models, including human granulosa cells, chemotherapy-exposed mice, and cultured rat and human ovarian tissues. Rather than focusing solely on regenerative effects, we investigated their capacity to function as protective agents against chemotherapy-induced ovarian injury. The objective of this study was to assess the protective efficacy and mechanistic features of these enhanced exosomes and to explore their potential as a complementary strategy for fertility preservation during gonadotoxic treatment.

Results

Enhanced exosomes can protect human granulosa cells before treatment with cyclophosphamide

NTA revealed that the mean diameter of the isolated enhanced exosomes was 149.7 ± 1.8 nm, with the majority of vesicles ranging between 86 nm and 132 nm in size (Fig. 1A). From each 400 mL of conditioned media collected, the final exosome preparation contained approximately 50 × 10⁹ particles. Transmission electron microscopy (TEM) confirmed the characteristic spherical morphology of the vesicles (Fig. 1B). Western blot analysis demonstrated the presence of canonical exosomal surface markers (Fig. 1C), including CD9, CD63, and CD81, while the endoplasmic reticulum marker calnexin was not detected, confirming the purity of the isolated exosomes (Supplementary Data, original blot images; Fig. 1C). To confirm the uptake of enhanced exosomes by target cells, DiR-labeled exosomes were incubated with HGrC1 cells for 24 h. Confocal laser-scanning microscopy revealed clear intracellular fluorescence, indicating successful internalization of the exosomes (Fig. 1D).

Fig. 1. Characterization and uptake of enhanced exosomes.

A Nanoparticle tracking analysis (NTA) of isolated exosomes revealed an average size of 149.7 ± 1.8 nm. B Transmission electron microscopy (TEM) image depicting the morphology of the isolated exosomes. C Western blot analysis of exosomal marker proteins (CD63, CD9, and CD81) confirms the presence of these markers in the isolated exosomes (n = 3). D Confocal laser-scanning microscopy of HGrC1 cells incubated with DiR-labeled enhanced exosomes for 24 h, showing intracellular fluorescence and confirming successful exosome uptake by the cells.

To evaluate the protective and proliferative effects of enhanced exosomes under chemotherapeutic stress, HGrC1 cells were pretreated with 1.5 × 10⁹ particles/mL of enhanced exosomes for 24 h, followed by exposure to 200 µg/mL of cyclophosphamide for an additional 24 h. Cell viability assessed by the CCK-8 assay showed a significant increase in cell survival in the enhanced exosome-treated group compared to untreated controls (Fig. 2A). Additionally, flow cytometric analysis of the cell cycle demonstrated a significant increase in the proportion of cells in the S phase and a corresponding decrease in the G0/G1 and G2/M phases in the exosome-treated group, suggesting accelerated cell cycle progression (Fig. 2B).

Fig. 2. Protective effects of enhanced exosomes on HGrC1 cells exposed to cyclophosphamide.

A CCK-8 assay results after 24 h showed significantly increased cell number and viability in the enhanced exosome-treated group compared to control groups. B Cell cycle distribution analyzed by flow cytometry showing increased S-phase fraction in enhanced exosome–treated cells. C RT-qPCR analysis of the proliferation marker Ki67 revealed a significant upregulation in Ki67 expression in enhanced exosome-treated HGrC1 cells compared to the control group. D RT-qPCR and Western blot analysis confirmed the increased expression of anti-apoptotic genes Bcl2 and AKT in the enhanced exosome-treated group compared to the untreated group. E RT-qPCR analysis showed a significant upregulation of granulosa cell markers CYP19A1, StAR, and FSHR in the enhanced exosome-treated group compared to the control group. Data represent mean ± SEM from three independent experiments (n = 3 biological replicates per group). Statistical analysis was performed using an unpaired two-tailed Student’s t test. P < 0.05 was considered statistically significant.

Gene expression analysis via RT-qPCR revealed a marked upregulation of the proliferation marker Ki67 in the enhanced exosome group compared to controls (Fig. 2C). Furthermore, expression of the anti-apoptotic genes Bcl2 and AKT was significantly elevated following exosome treatment. These findings were corroborated by Western blot analysis, which confirmed enhanced expression of BCL2 and AKT proteins in exosome-treated cells (Fig. 2D).

To further explore the functional integrity of granulosa cells, mRNA expression levels of granulosa cell-specific markers—including CYP19A1, StAR, and FSHR—were evaluated by RT-PCR. All three markers were significantly upregulated in the enhanced exosome group compared to controls (Fig. 2E), indicating preserved steroidogenic function and cellular identity under chemotherapeutic stress. Collectively, these results demonstrate that enhanced exosomes are effectively internalized by granulosa cells and confer a protective effect against chemotherapy-induced cytotoxicity. This protection is associated with increased proliferation, inhibition of apoptosis, and preservation of granulosa cell-specific gene expression.

Enhanced exosomes mitigate chemotherapy-induced reproductive damage in mice

To assess the protective effects of enhanced exosomes against chemotherapy-induced ovarian damage in vivo, body weights of mice from the control, CTX (chemotherapy), and enhanced exosome-treated groups were monitored over a four-week period (weeks 2 to 5 post-treatment). Mice in the CTX group exhibited a significant reduction in body weight compared to controls, indicative of systemic toxicity. In contrast, mice pretreated with enhanced exosomes maintained body weight comparable to the control group, suggesting a protective effect (Fig. 3A). Estrous cyclicity was analyzed from Days 21 to 31 post-chemotherapy. As expected, control mice exhibited regular estrous cycles, while CTX-treated mice demonstrated disrupted cyclicity, characterized by prolonged metestrus and diestrus phases. Notably, mice treated with enhanced exosomes exhibited near-normal estrous cycles, indicating preservation of hypothalamic-pituitary-ovarian axis function (Fig. 3B and Supplementary Fig. 1A, 1B). Ovarian morphology and follicular integrity were evaluated through histological analysis. Mice in the CTX group displayed marked ovarian atrophy and follicular loss. In contrast, ovaries from the enhanced exosome group exhibited significantly preserved structure, with increased ovary size and higher counts of primordial-primary follicles, primary follicles, and corpus luteum compared to the CTX group (Fig. 3C–E and Supplementary Fig. 1C, 1D). These findings suggest that enhanced exosome therapy preserves ovarian reserve and function under gonadotoxic stress.

Fig. 3. Enhanced exosomes protect body weight, estrous cycle, and ovarian health in cyclophosphamide-exposed mice.

A Body weight changes monitored weekly from weeks 2–5 post-treatment. B Estrous cycle distribution from days 21–31 post-chemotherapy. C Ovarian size measurements and representative histology. D, E Quantification of follicle classes: The enhanced exosome group demonstrated an increase in primary follicles, primordial-primary follicles, and corpus luteum compared to the untreated group, suggesting improved ovarian preservation. n = 4 ovaries per group for histological and follicle count analyses. Data are presented as mean ± SEM. Statistical comparisons were performed using one-way or two-way ANOVA with Tukey’s multiple comparisons test. P < 0.05 was considered statistically significant.

Fertility was assessed through three rounds of natural breeding. During the first mating round (six weeks post-chemotherapy), the number of pregnancies in the enhanced exosome-treated group was comparable to the CTX group. However, the total number of pups per pregnancy was significantly higher in the enhanced exosome group (Fig. 4A). Pup body weights at birth did not differ between the control and enhanced exosome groups, indicating no adverse effects of treatment on offspring development (Fig. 4B).

Fig. 4. Fertility outcomes in mice treated with enhanced exosomes following cyclophosphamide-induced damage.

A Pregnancy outcomes and litter size in first breeding round (6 weeks post-chemotherapy). B Birth weights of pups from control and enhanced exosome–treated groups. C Second and third rounds of pregnancy (12 and 17 weeks post-chemotherapy). Breeding cohort size: n = 6 females per group. Data are presented as cumulative reproductive outcomes per group and are shown for descriptive purposes; statistical comparisons, individual data points, and error bars were not applied. Other data are presented as mean ± SEM and were analyzed using one-way ANOVA with Tukey’s multiple comparisons test (P < 0.05).

In the second and third breeding rounds (12 and 17 weeks post-treatment), no pregnancies were observed in the CTX group, indicating long-term infertility. In contrast, mice in the enhanced exosome group remained fertile, with pregnancy rates and average litter sizes comparable to the control group (Fig. 4C). These results collectively demonstrate that enhanced exosome therapy mitigates chemotherapy-induced ovarian failure and preserves long-term reproductive capacity.

Enhanced exosome treatment prevents apoptosis and promotes steroidogenesis in rat and human ovarian cultures exposed to cyclophosphamide

To assess the protective effects of enhanced exosomes on chemotherapy-exposed ovarian tissues, we conducted ex vivo experiments using both rat ovaries and human ovarian cortical biopsies.

In the rat ovary model, isolated ovarian tissues were cultured with enhanced exosomes (1.50 × 10⁹ particles/mL) for 24 h, followed by exposure to 3,000 µg/mL cyclophosphamide for an additional 24 h. Quantitative real-time PCR revealed a significant upregulation of CYP19A1, a key gene involved in estrogen biosynthesis, in the enhanced exosome-treated group compared to the untreated control (Fig. 5A). Analysis of apoptosis-related genes showed increased expression of anti-apoptotic genes and decreased expression of proapoptotic markers in the exosome-treated group, indicating reduced apoptotic response (Fig. 5B). Furthermore, ELISA analysis of conditioned media demonstrated a significant increase in estrogen secretion in the enhanced exosome-treated group, while AMH levels showed a mild increase without reaching statistical significance (Fig. 5C).

Fig. 5. Enhanced exosomes protect rat and human ovarian tissues from cyclophosphamide-induced damage in ex vivo studies.

A–C Rat ovary ex vivo model: A RT-qPCR analysis showed significant overexpression of CYP19A1 in the enhanced exosome-treated group compared to the control. B Expression of apoptosis-related genes. C AMH and estrogen levels in conditioned media by ELISA. Paired ovaries from the same animals were assigned to control vs treatment (n = 6 rats). D–H Human ovarian cortical biopsy model: D RT-qPCR and Western blot analysis of Bcl2 and AKT expression. E TUNEL assay quantification of apoptosis. F RT-qPCR analysis of granulosa cell markers FSHR, CYP19A1, and StAR. G Estradiol (E2) and AMH levels by ELISA. H Immunohistochemistry analysis of AMHR2 expression. Human donors: n = 4 independent samples. Data are presented as mean ± SEM. Statistical analysis used paired or unpaired two-tailed Student’s t tests. P < 0.05 was considered statistically significant.

In the human ovarian biopsy model, cortical tissue fragments were treated with enhanced exosomes (1.50 × 10⁹ particles/mL) for 24 hours and subsequently exposed to cyclophosphamide for 24 hours. Real-time PCR analysis showed a significant upregulation of the anti-apoptotic genes Bcl2 and Akt in the exosome-treated group compared to the untreated control. In contrast, expression of the proapoptotic gene Casp3 was slightly reduced (Fig. 5D). Western blot analysis confirmed elevated protein levels of Bcl2 and Akt in the exosome-treated tissues, validating the transcriptomic findings. TUNEL staining demonstrated markedly reduced apoptosis in the exosome-treated biopsies relative to the untreated group (Fig. 5E).

To evaluate the preservation of granulosa cell function, the expression of FSHR, CYP19A1, and StAR was analyzed via real-time PCR. All three markers were significantly upregulated in the enhanced exosome-treated group compared with the untreated control, indicating improved granulosa cell function following chemotherapy exposure (Fig. 5F). ELISA quantification of estradiol (E2) and AMH in the culture media 24 hours post-chemotherapy revealed significantly higher E2 levels in the exosome-treated group, while AMH levels were elevated but did not reach statistical significance (Fig. 5G).

Immunohistochemical (IHC) staining for AMHR2, a receptor essential for follicular development, showed enhanced expression in ovarian follicles treated with exosomes prior to chemotherapy, compared with the untreated group (Fig. 5H). These findings collectively suggest that enhanced exosome treatment confers protective effects on human ovarian tissue by reducing apoptosis and preserving steroidogenic and follicular function during chemotherapy exposure.

Enhanced exosomes promote chemotherapy resistance through the upregulation of key ABC transporters in ovarian cells

Given the critical role of ATP-binding cassette (ABC) transporters in mediating the efflux of chemotherapeutic agents and thereby contributing to cellular drug resistance, we assessed the expression of three key multidrug resistance transporters: BCRP (ABCG2), MRP1 (ABCC1), and MDR1 (ABCB1). Their expression was analyzed across in vitro (HGrC1 cells) and ex vivo (rat ovaries and human ovarian biopsies) models using real-time PCR, Western blotting, and immunohistochemistry (IHC).

Across all experimental models and techniques, a consistent and significant upregulation of BCRP, MRP1, and MDR1was observed in the enhanced exosome-treated groups compared to their respective untreated controls (Fig. 6). These findings indicate that enhanced exosome treatment induces the expression of multidrug resistance transporters, potentially facilitating the efflux of cyclophosphamide from target cells. This mechanism may contribute to the observed cytoprotective effect of exosomes by reducing intracellular drug accumulation and mitigating chemotherapy-induced cellular damage.

Fig. 6. Enhanced exosomes upregulate ABC transporter expression to protect cells from cyclophosphamide-induced cytotoxicity.

A RT-qPCR and Western blot analyses of BCRP, MRP1, and MDR1 expression in HGrC1 cells following enhanced exosome treatment (n = 3 independent experiments). (B) RT-qPCR and Western blot analyses of BCRP, MRP1, MDR1a, and MDR1b expression in rat ovarian ex vivo cultures (n = 6 paired ovaries). C Representative H&E staining of human ovarian biopsy explants. D RT-qPCR, Western blot, and IHC analyses of BCRP, MRP1, and MDR1 expression in human ovarian biopsy tissues (n = 4 donors). Data are presented as mean ± SEM. Statistical analysis was performed using Student’s t test. P < 0.05 was considered statistically significant.

mir-224-5p overexpression in enhanced exosomes reduces PRKCD expression in granulosa cells

To explore the differences in miRNA cargo between enhanced exosomes and naïve exosomes, UC-MSCs were cultured under standard conditions using RoosterNourish-MSC-XF medium (RoosterBio, Frederick, MD, USA). Exosomes isolated under these conditions were designated as naïve exosomes and served as a control group for miRNA profiling. miRNA sequencing revealed distinct variations in the miRNA composition between control and enhanced exosomes (18). Based on these data and supporting literature, we focused on miR-224-5p, which was found to be significantly overexpressed in enhanced exosomes relative to control (Fig. 7A).

Fig. 7. Enhanced exosomes elevate miR-224-5p, reducing PRKCD expression in granulosa cells and ovarian biopsies.

A RT-qPCR analysis of miR-224-5p expression in enhanced versus naïve exosomes (control). (n = 3 independent isolation) B Expression of miR-224-5p and PRKCD in HGrC1 cells treated with enhanced exosomes followed by cyclophosphamide exposure (n = 3 independent experiments). C Expression of miR-224-5p and PRKCD in human ovarian biopsy tissues treated under the same treatment conditions (n = 4 donors). Data are shown as mean ± SEM. Statistical analysis was performed using unpaired two-tailed Student’s t tests. P < 0.05 was considered statistically significant.

Since miR-224-5p is known to directly target PRKCD, we treated granulosa cells and human ovarian biopsies with either naïve or enhanced exosomes followed by exposure to cyclophosphamide for 24 h. Analysis revealed a significant reduction in PRKCD expression in samples treated with enhanced exosomes compared to those treated with naïve exosomes (Fig. 7B, C). These results suggest that the elevated levels of miR-224-5p in enhanced exosomes contribute to the downregulation of PRKCD, potentially mediating part of the cytoprotective effect observed with enhanced exosome treatment.

Discussion

Exosome-based therapy has recently emerged as a promising biologic nanoparticle platform with demonstrated effectiveness in various preclinical studies and potential for clinical translation. Exosomes have attracted considerable interest for their multifunctional roles as diagnostic markers, drug delivery vehicles, and therapeutic agents¹⁶. Their inherently low immunogenicity allows them to cross biological and physical barriers effectively, making them valuable carriers for delivering tailored molecules to specific target tissues or disorders^24,25. A key advancement in this field is the development of engineered exosomes, which are characterized by customized surface modifications and optimized cargoes. These engineered exosomes facilitate targeted delivery of molecules necessary for treating distinct diseases, enabling precision therapy. Various approaches to generate engineered exosomes have been reported, with genetic manipulation of the parent cells being a common strategy despite its inherent limitations²⁶.

In this study, we introduce a novel approach to exosome engineering that circumvents direct genetic manipulation of either the parent cells or the exosomes. Instead, we mimicked the natural crosstalk between UC-MSCs and ovarian-specific cells to produce exosomes with a unique molecular profile. As we reported in our previous publication, these enhanced exosomes exhibited distinct protein and miRNA expression patterns compared to naïve exosomes derived from conventional cell culture conditions²⁷.

In addition to their therapeutic applications, several studies have highlighted the protective role of exosomes. Exosomes carry a diverse array of molecules, some of which contribute to their therapeutic function and others to their protective role. The cardioprotective and neuroprotective abilities of MSC-derived exosomes have been widely documented. For example, Wei et al. demonstrated in a neuronal injury model that adipose-derived MSC-derived exosomes protect brain tissue by activating the PI3K/Akt signaling pathway through the release of insulin-like growth factor (IGF) and hepatocyte growth factor (HGF)²⁸. Venugopal et al. reported the neuroprotective effect of rat bone marrow-derived mesenchymal stem cell exosomes in an in vitro model of excitotoxicity, which suggests their potential role in neurodegenerative disorders²⁹. Similarly, Sun et al. demonstrated the neuroprotective ability of exosomes derived from primary mouse neural stem cells and human-induced pluripotent stem cell-derived cardiomyocytes³⁰. Moreover, several reports have highlighted the cardioprotective effects of allogenic plasma-derived exosomes under ischemic conditions^31,32. Studies on cardioprotection confirm that exosomes derived from different cell sources exhibit distinct cargoes, which indicates their cardioprotective abilities through diverse pathways. For example, Vicencio et al. demonstrated the cardioprotective function of exosomes in ischemia-reperfusion injury by activating the MAPK/ERK1/2 signaling pathway³³, whereas Tseliou et al. reported that exosomes isolated from cardiosphere-derived cells play a cardioprotective role when injected into an in vivo model of myocardial infarction³⁴.

Exosome-mediated protection against chemotherapy-induced toxicity has also been explored. Park et al. found that bone marrow-derived stem cell exosomes reduced cisplatin-induced ototoxicity in cochlear explants³⁵, while Xiong et al. demonstrated cardioprotection against cyclophosphamide toxicity by adipose-derived MSC exosomes in vivo³⁶. Our previous work revealed that bone marrow-derived MSC exosomes protect fertility in a mouse model exposed to chemotherapy¹⁸. Building on this, the current study employed enhanced exosomes, characterized by ovarian-specific cargo, to investigate mechanisms underlying their protective effects on fertility.

Naïve exosomes have shown therapeutic promise by facilitating intercellular communication and delivering bioactive molecules that promote tissue repair, immune modulation, and anti-inflammatory responses¹⁷. Despite these advantages, naïve exosomes exhibit heterogeneous cargo and variable therapeutic efficacy. To overcome these challenges, engineered exosomes with optimized contents and functions are being developed through genetic engineering of parent cells, post-isolation loading techniques (e.g., electroporation, sonication), and surface modifications. These methods, however, are often complex and involve manipulations that can affect cell viability or exosome integrity.

Our approach, which simulates the natural dialogue between stem cells and host tissue cells in vitro, represents a pioneering method for generating exosomes enriched in molecules specific to ovarian regeneration. This method, specialized for ovarian tissue, uniquely captures the dynamic crosstalk that occurs in vivo during tissue repair, thus producing exosomes with enhanced therapeutic potential.

Functionally, HGrC1 cells and rat/human ovarian tissues pretreated with enhanced exosomes exhibited increased expression of proliferation-associated genes and decreased expression of apoptosis-related genes following cyclophosphamide exposure, relative to control group. In vivo, enhanced exosome pretreatment prevented chemotherapy-induced weight loss, normalized estrous cycles, preserved ovarian morphology, and increased follicle counts and offspring numbers. Additionally, enhanced exosomes better preserved steroidogenic function in human ovarian biopsies during chemotherapy.

Compared with established fertility-preservation strategies, the exosome-based approach described here offers a conceptually different and potentially complementary protective strategy. Current standard methods, such as oocyte, embryo, and ovarian tissue cryopreservation, are effective but invasive, time-dependent, and not universally applicable, particularly in prepubertal patients or when cancer treatment cannot be delayed. Pharmacological approaches such as GnRH analogs provide partial ovarian protection but show variable efficacy across studies³⁷. In contrast, engineered exosome therapy is designed as a non-cellular, biologically targeted intervention aimed at reducing chemotherapy-induced ovarian injury at the tissue level. Such an approach could potentially be administered alongside standard oncologic treatment without delaying therapy. However, unlike established cryopreservation techniques, exosome-based protection remains at a preclinical stage and requires further validation for dosing, safety, durability of effect, and long-term reproductive outcomes. Therefore, this strategy should currently be viewed as a complementary and investigational approach rather than a replacement for existing fertility-preservation methods.

The cyclophosphamide concentrations used in the in vitro and in vivo experiments were selected based on our previously published works^38,39. For ex vivo ovarian tissue culture, cyclophosphamide was added directly to the culture medium rather than injected into the tissue. To ensure effective induction of apoptosis within the tissue over a short exposure period (24 h), dose-response optimization experiments were performed using concentrations ranging from 200 to 5000 µg/mL. Based on apoptotic marker expression within the tissue, 3000 µg/mL was identified as the minimal concentration that consistently induced apoptosis throughout the explant after 24 h and was therefore used for subsequent experiments.

While pregnancy rates during the first mating did not differ significantly between the CTX and enhanced exosome–treated groups, improved reproductive performance was observed across subsequent breeding rounds. This pattern suggests a delayed or cumulative protective effect of enhanced exosomes on ovarian function and follicular recovery rather than an immediate restoration of fertility. Consistent with this interpretation, our prior study using naïve exosomes showed more limited long-term fertility benefit, supporting the enhanced efficacy of the engineered exosome approach¹⁸.

ABC transporters, including BCRP, MDR1, and MRP1, play critical roles in exporting a wide range of substrates, including chemotherapeutic agents, thereby contributing to multidrug resistance (MDR) phenomena in cancer cells^40,41. While ABC transporter overexpression in malignant cells reduces chemotherapy efficacy, their upregulation in normal ovarian cells may serve a protective detoxification function by limiting intracellular accumulation of cytotoxic agents^42,43. In this context, increased ABC transporter expression represents a protective adaptive response that enhances drug efflux and preserves ovarian cell viability during chemotherapy exposure^44,45. In our study, enhanced exosome treatment significantly increased ABC transporter expression in rat and human ovarian tissues prior to cyclophosphamide exposure, which may contribute to the observed protective effects. Although enhanced exosome treatment increased ABC transporter expression, a direct causal link to the observed protective effects was not established, and functional inhibition studies are needed for definitive mechanistic validation. Moreover, the potential impact of sustained transporter activation on other xenobiotics or drug metabolism was not assessed in this study and warrants further investigation.

An important consideration is whether ABC transporter upregulation in normal ovarian tissue influence systemic chemotherapy efficacy. While transporter overexpression in cancer cells contributes to drug resistance, the effects observed here were confined to ovarian tissue and localized experimental settings. Nonetheless, the potential impact of enhanced exosomes on tumor drug sensitivity was not evaluated and will require dedicated investigation in cancer models to ensure that fertility protection does not compromise anti-tumor efficacy.

Protein kinase C delta (PRKCD) is an apoptosis-modulating kinase and a substrate of caspase-3, with established roles in tumor progression and chemotherapy response^46,47. PRKCD has been shown to promote cisplatin-induced cytotoxicity by enhancing drug uptake in cancer cells⁴⁸. Our miRNA sequencing revealed that miR-224-5p, a microRNA implicated in cellular stress responses and apoptosis regulation, is overexpressed in enhanced exosomes²⁷. Previous studies have shown that miR-224-5p directly targets PRKCD⁴⁷, and our gene expression analysis also revealed an inverse relationship between miR-224-5p and PRKCD expression, suggesting a potential regulatory axis through which enhanced exosomes may contribute to protection against chemotherapy-induced ovarian damage. Functional validation through gain- and loss-of-function experiments for miR-224-5p or PRKCD will be required in future studies to confirm this regulatory mechanism.

Several limitations of the present study should be acknowledged. Although statistical significance was assessed using appropriate tests, effect size measurements were not calculated, and the sample size was limited in both the in vivo study and human biopsy experiments. Additionally, while enhanced exosomes exhibited protective effects across multiple experimental models, direct functional comparisons with naïve UC-MSC-derived exosomes were limited, and definitive conclusions regarding their superiority will require further investigation. These studies were designed as an initial proof-of-concept to evaluate the effects of exosomes in human tissue. Beyond these experimental considerations, several challenges must be addressed before clinical translation, including scalable production of engineered exosomes, batch-to-batch consistency, rigorous quality control, long-term storage stability, optimization of administration routes, and careful evaluation of regulatory requirements for biologically engineered extracellular vesicles.

In conclusion, this study employed enhanced exosomes generated via the natural crosstalk between UC-MSCs and granulosa cells to protect fertility. Enhanced exosomes demonstrated significant protective effects against cyclophosphamide-induced ovarian damage. They promoted the expression of genes involved in cell proliferation, suppressed apoptotic markers, and modulated ABC transporter expression to facilitate the efflux of cytotoxic drugs. Moreover, enhanced exosomes effectively preserved ovarian morphology, steroidogenesis, and fertility outcomes. These findings underscore the therapeutic potential of exosomes in reproductive health and suggest a promising strategy for fertility preservation in patients undergoing chemotherapy. Future investigations should explore the application of these exosomes in cancer animal models to further assess their safety and efficacy.

Methods

Cell culture and exosome isolation

Human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) were obtained from RoosterBio (Frederick, MD, USA). These cells were specifically isolated from the perivascular Wharton’s jelly region of the human umbilical cord and cultured according to the manufacturer’s protocols in RoosterNourish-MSC-XF medium. Cells were maintained until they reached approximately 80% confluence. At passage three, hUC-MSCs were washed with phosphate-buffered saline (PBS) and cultured in RoosterCollect-EV Pro™ medium (RoosterBio, Frederick, MD, USA) for 48 h to facilitate exosome production.

The immortalized human granulosa cell line (HGrC1), generously provided by Dr. A. Iwase (Nagoya University, Japan), was cultured in DMEM/F12 supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Thermo Fisher Scientific Inc., MA, USA).

To generate enhanced exosomes, hUC-MSCs were co-cultured with HGrC1 cells under previously described conditions^27,38. Conditioned media were collected from T-300 flasks, with each flask typically containing ~65 × 10⁶ cells at the time of collection. The conditioned media were concentrated using Amicon Ultra centrifugal filters (100 kDa MWCO; Millipore) according to the manufacturer’s instructions. The concentrated media were then subjected to a sequential centrifugation protocol to remove cells, apoptotic bodies, and larger vesicles, including centrifugation at 500 × g for 5 min, 2000 × g for 20 min, and 10,000 × g for 30 min. The resulting supernatant was processed using ExoQuick-TC™ (System Biosciences, Palo Alto, CA, USA) for exosome isolation, following the manufacturer’s instructions. The quality and concentration of isolated exosomes were assessed using Nanoparticle Tracking Analysis (NTA) on the NanoSight NS300 system.

To characterize the morphology of the enhanced exosomes, transmission electron microscopy (TEM) was performed. Briefly, exosome samples were applied to carbon film-coated copper grids for 1 minute, then negatively stained with 0.75% uranyl formate for 45 seconds. Imaging was conducted using an FEI Tecnai G2 F30 microscope operating at 300 kV. Additionally, Western blot analysis was conducted to confirm the expression of exosomal markers CD9, CD63, and CD81, using protocols and antibodies provided by System Biosciences (Palo Alto, CA, USA).

Nanoparticle labeling and imaging

To fluorescently label exosomes, we used DiR dye (DiIC18(7); 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindotricarbocyanine iodide; Invitrogen, USA), a near-infrared lipophilic dye that integrates into the lipid bilayer of vesicles. DiR was first dissolved in ethanol to a stock concentration of 2.47 mM, and then added to enhanced exosomes suspended in PBS, yielding a final labeling concentration of 5 µM, corresponding to 4.5 × 10¹⁰ particles/mL. The DiR-labeled exosome suspension was incubated at room temperature for 30 minutes, with gentle inversion every 10 min to ensure uniform labeling. Following incubation, HGrC1 cells, previously seeded on glass coverslips, were treated with the labeled exosomes at a final concentration of 1.5 × 10⁹ particles/mL for 24 h. After the incubation period, cells were washed three times with PBS to remove unbound exosomes, and then fixed with 4% paraformaldehyde (PFA) for 5 min at room temperature. Coverslips were washed again and mounted on glass slides using Fluoroshield mounting medium containing DAPI (Sigma, USA) for nuclear counterstaining. Cellular uptake of labeled exosomes was visualized using a Leica Stellaris 8 laser-scanning confocal microscope (Leica Microsystems, Inc., Buffalo Grove, IL, USA).

In vitro study

For the in vitro model, HGrC1 cells were cultured in DMEM/F12 medium (JangoCell, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin until reaching approximately 50% confluence. To eliminate serum-derived exosomes, cells were washed three times with PBS, after which they were incubated with DMEM/F12 medium containing 1.5 × 10⁹ particles/mL of enhanced exosomes. A control group was treated under identical conditions, except without the addition of exosomes (DMEM/F12 only). After 24 h of pretreatment, the medium in both groups was replaced with DMEM/F12 supplemented with cyclophosphamide (200 µg/mL) (Sigma, USA), as previously established in our earlier work³⁸, and incubated for an additional 24 h. Following treatment, culture media were collected, and the cells were harvested using trypsinization (Gibco, USA) for subsequent analyses.

In vivo study

All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Chicago under the protocol titled “Study for treating female reproductive disease using a small animal model” (approval number 72638; approved on 11 March 2020). The study included 30 female C57BL/6 mice, which were randomly assigned to one of three experimental groups (n = 10/group): a control group, a chemotherapy-only (CTX) group, and a chemotherapy plus enhanced exosomes group.

On Day 0 (one day prior to chemotherapy administration), mice in both the control and CTX groups received 100 µL of PBS intravenously, while mice in the exosome-treated group received 1.5 × 10⁸ particles of enhanced exosomes suspended in 100 µL of PBS, also administered intravenously.

On Day 1, the control group received 100 µL of PBS intravenously and 200 µL of PBS intraperitoneally, while the CTX and exosome-treated groups received cyclophosphamide (120 mg/kg) and busulfan (BUS) (30 mg/kg) (Sigma, USA) via intraperitoneal injection. The CTX group received 100 µL of PBS intravenously, whereas the exosome-treated group received 100 µL of PBS containing 1.5 × 10⁸ enhanced exosome particles intravenously.

On Days 2, 3, and 4 (i.e., one to three days post-chemotherapy), mice in the control and CTX groups continued to receive 100 µL of PBS intravenously, while those in the exosome group received 100 µL of PBS containing 1.5 × 10⁸ enhanced exosome particles intravenously each day.

Body weight was monitored weekly from Week 2 to Week 5 post-treatment to assess general health and toxicity, and estrous cycle analysis was conducted between Days 21 and 31 following chemotherapy to evaluate ovarian function.

On Day 7 post-chemotherapy, mice from each group were prospectively divided into two predefined subgroups based on experimental endpoints: breeding cages (n = 6/group) and experimental cages (n = 4/group). Mice in experimental cages were sacrificed for ovarian size measurement, follicular quantification, and histological evaluation, whereas mice in breeding cages were maintained for three consecutive rounds of natural mating to assess short- and long-term fertility outcomes. All animals were euthanized by carbon dioxide (CO₂) inhalation followed by cervical dislocation, in accordance with IACUC–approved protocols.

Ex vivo experimental setup

Rat Ovary Study: Ovarian tissues were collected from six Crl:CD(SD) female rats, each contributing two ovaries for ex vivo culture. For each rat, one ovary was treated with 10 µL of PBS (control), while the contralateral ovary received 1.5 × 10⁹ enhanced exosome particles/ml in 10 µL of PBS. The ovaries were individually placed in separate chambers of a Matrigel-coated 24-well plate (Corning, NY, USA) and cultured in α-MEM medium supplemented with 2% FBS and 1% penicillin/streptomycin at 37 °C in a 5% CO₂ atmosphere. After 24 h of pretreatment, the medium was replaced with α-MEM containing cyclophosphamide (3000 µg/mL), and the cultures were maintained for an additional 24 h. Following this, culture media were collected for ELISA analysis, and the ovarian tissues were harvested for downstream histological and molecular studies.

Human Ovary Biopsy Study: Human ovarian cortical biopsies were obtained from four women between the ages of 29 and 40 years who underwent pelvic surgery at the University of Chicago Hospital. All procedures were conducted in accordance with institutional ethical guidelines and approved by the Institutional Review Board (IRB# 20-1414, approved on 27 October 2020), with informed consent obtained from all participants. Ovarian tissue samples were specifically obtained for this study. Biopsy samples were rinsed three times in phosphate-buffered saline (PBS) containing 10% penicillin/streptomycin to minimize contamination and were subsequently sectioned into small fragments (approximately 1 mm × 1 mm × 1 mm) using sterile scalpel blades. These tissue fragments were randomly allocated into two treatment groups: one group received 10 µL of PBS (control), while the other was treated with 1.5×10⁹ enhanced exosome particles/ml suspended in 10 µL of PBS. Each fragment was individually cultured in a chamber of a 24-well plate pre-coated with Matrigel (Corning, NY, USA) and maintained in McCoy’s 5 A medium containing bicarbonate, supplemented with 20 mM HEPES, 3 mM glutamine (Gibco, USA), 0.1% human serum albumin (HSA; CELPROGEN, CA, USA), 1% penicillin/streptomycin, 1% insulin-transferrin-selenium (ITS; Gibco, USA), 1 ng/mL recombinant human FSH (RayBiotech, GA, USA), and 50 µg/mL ascorbic acid (Sigma, USA). Cultures were maintained at 37 °C in a humidified atmosphere containing 5% CO₂ for 24 h. After this initial incubation, the culture medium was replaced with fresh McCoy’s 5 A medium supplemented with 3,000 µg/mL cyclophosphamide, and the tissues were incubated for an additional 24 h. At the conclusion of treatment, conditioned media were collected for enzyme-linked immunosorbent assay (ELISA), and the tissue fragments were harvested for histological and molecular analyses.

Cell proliferation/viability assay and cell cycle analysis

To assess cell proliferation and viability, the Cell Counting Kit-8 (CCK-8; APEXBIO, USA) assay was performed according to the manufacturer’s protocol. HGrC1 cells were seeded at a density of 5000 cells per well in 96-well plates and incubated overnight at 37 °C in a humidified atmosphere containing 5% CO₂. The following day, cells were divided into two groups: one group was treated with 1.5 × 10⁹ particles/mL of enhanced exosomes, while the other group remained untreated and served as the control. After 24 hours of pretreatment, both groups were exposed to DMEM-F12 supplemented with 200 µg/mL cyclophosphamide, according to our previously published protocol, and incubated for an additional 24 hours³⁸. Subsequently, 10 µL of CCK-8 reagent was added to each well, followed by a 4-hour incubation at 37 °C. The absorbance was measured at 450 nm using a Varioskan™ LUX multimode microplate reader (Thermo Scientific, USA) to determine relative cell viability.

For cell cycle analysis, HGrC1 cells from both treatment groups, those treated with enhanced exosomes and untreated controls, were collected following 24 h of exposure to 200 µg/mL cyclophosphamide³⁸. Cells were fixed by the gradual addition of ice-cold 70% ethanol to the pellet, followed by incubation on ice for 1 h. After fixation, 0.5 mL of FxCycle™ PI/RNase Staining Solution (Invitrogen, USA) was added to each sample, and the mixture was incubated in the dark at room temperature for 30 min. Samples were subsequently analyzed using a Penteon flow cytometer (Agilent Technologies, USA) equipped with a 488 nm laser and NovoExpress software.

Protein analysis by immunoblotting

For immunoblot analysis, total protein was extracted from HGrC1 cells subjected to two treatment conditions: untreated controls and cells treated with enhanced exosomes. Protein extraction was carried out using 1× RIPA buffer (Cell Signaling Technology, MA, USA) supplemented with a protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, Inc., USA). Cell lysates were incubated on ice for 20 min and subsequently centrifuged at 14,000 rpm for 20 minutes at 4 °C. The resulting supernatants were collected, and total protein concentrations were determined using the Bradford assay. Equal amounts of protein (15 µg per sample) were mixed with 1× gel loading buffer, resolved by SDS-PAGE using 4–20% gradient gels (Bio-Rad), and transferred onto polyvinylidene difluoride (PVDF) membranes using the Trans-Blot Turbo system (Bio-Rad, USA).

Following transfer, membranes were blocked with 5% bovine serum albumin (BSA; GeminiBio, CA, USA) for one hour at room temperature and then incubated overnight at 4 °C with primary antibodies targeting BCL2 (ab59348, 1:500, Abcam, UK), AKT (4691S, 1:1000, Cell Signaling Technology, USA), Caspase-3 (9662S, 1:2000, Cell Signaling Technology, USA), BCRP (ab207732, 1:1000, Abcam, UK), MRP1 (PA5-114802, 1:1000, Invitrogen, USA), and MDR1 (E1Y7S, 1:1000, Cell Signaling Technology, USA). After incubation with appropriate HRP-conjugated secondary antibodies, signal detection was performed using Trident Femto Western HRP substrate (GeneTex, Irvine, CA, USA), and imaging was conducted using a ChemiDoc XRS+ molecular imager (Bio-Rad, USA). Band intensities were quantified using ImageJ software and normalized to the corresponding GAPDH loading control (5174S, 1:10000, Cell Signaling Technology, USA).

Histological assay

For histological evaluation and follicle quantification, ovaries from four animals per treatment group (n = 4/group) were collected and fixed in 10% neutral buffered formalin (NBF). Following fixation, tissues underwent standard paraffin embedding, sectioning, and hematoxylin and eosin (H&E) staining. Follicle counts were performed manually and classified according to developmental stage, following established protocols described in previous studies. All histological analyses were conducted by the Human Tissue Resource Center (HTRC) at the University of Chicago.

For immunohistochemistry (IHC) analysis, human ovarian biopsy sections were stained to assess the expression of drug efflux transporters. IHC was performed using primary antibodies against BCRP (ab207732, Abcam, Cambridge, UK), MRP1 (907201, BioLegend, USA), and MDR1 (ab170904, Abcam, Cambridge, UK). Staining and imaging procedures were also carried out by the University of Chicago HTRC, following standardized protocols for antigen retrieval, antibody incubation, and detection.

RNA extraction and quantitative real-time PCR

For transcriptomic analysis, total RNA was extracted from HGrC1 cells (in vitro model), rat ovaries, and human ovarian biopsy tissues (ex vivo models) using the Qiagen RNeasy Micro Kit (Cat. No. 74004), following the manufacturer’s protocol. Following RNA isolation, cDNA synthesis was performed using 2 µg of total RNA and the PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa Bio USA).

Quantitative real-time PCR (qPCR) was conducted using a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Amplification reactions were carried out with Universal SYBR Green Supermix (Bio-Rad) and gene-specific primers (listed in Table 1). The thermal cycling conditions consisted of an initial denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 15 s, and extension at 72 °C for 1 minute. Relative gene expression was quantified using the 2^-ΔΔCT method, with all values normalized to housekeeping genes as indicated in the study.

Table 1.

List of Primers

Gene	Forward Primer (5’-3’)	Reverse Primer (5’-3’)
Human GAPDH	TCCAAAATCAAGTGGGGCGA	GAGATGATGACCCTTTTGGCTC
Human Ki67	TCCCGCCTGTTTTCTTTCTGA	CTCTCCAAGGATGATGATGCTTTAC
Human Bax	ATGTTTTCTGACGGCAACTTC	AGTCCAATGTCCAGCCCAT
Human Casp3	TGTTTGTGTGCTTCTGAGCC	CACGCCATGTCATCATCAAC
Human AKT	ACCTCTGAGACTGACACCATG	CACTGGCTGAGTAGGAGAAC
Human BCL2	AACGTGCCTCATGAAATAAG	TTATTGGATGTGCTTTGCATTC
Human StAR	GCTGACGTGGGCTATTACTCC	CCGAGGTGGGTATTTGGGATG
Human CYP19A1	GGTCACCACGTTTCTCTGCT	GCAAGCTCTCCTCATCAAACCA
Human FSHR	TTCAAGAACAAGGATCCATTCC	CCTGGCCCTCAGCTTCTTAA
Human BCRP	CAGGTCTGTTGGTCAATGTCACA	TCCATATCGTGGAATGCTGAAG
Human MRP1	GTCCAGATTACATCCTACCCTGC	GCCAACACCTCTAGCCCTATG
Human MDR1	CCCATCATTGCAATAGCAGG	GTTCAAACTTCTGCTCCTGA
Human PRKCD	GCCGCTTTGAACTCTACCG	ATGTTCTCTTTGCACATCCCA
Rat CYP19A1	ATGAAAGTTGTCCTGGTTACACT	GACAGACCCCACTTGTTCACT
Rat StAR	GGCTCTGGAAGAACAAATCCC	TGCCTCAGTCCTTTCATGTTCCG
Rat Bax	ATTGGCGATGAACTGGACAACAAC	AGCAAAGTAGAAAAGGGCAACCAC
Rat Bcl2	ATCGCTCTGTGGATGACTGAGTAC	AGAGACAGCCAGGAGAAATCAAAC
Rat BCRP	CAGGTAGGCAATTGTGAGGAAGA	AATCAGGGCATCGATCTGTCA
Rat MRP1	GCCACTGCCTCATGCCTATT	GCAAGACCTGAAGGCAAGATACA
Rat MDR1a	GCAGGTTGGCTGGACAGATT	GGAGCGCAATTCCATGGATA
Rat MDR1b	AAACATGGCACGTAACCAAAGTT	AAAATGTGGCCCTGTTTAATGATT
Rat GAPDH	GCCAAAAGGGTCATCATCTCCG	TGAGCCCTTCCACGATGCCAAA

RNA isolation and quantification of mature miRNAs

Total RNA was extracted from HGrC1 cells (in vitro model) and human ovarian biopsies (ex vivo model) using the RNeasy Micro Kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocol. For cDNA synthesis and subsequent quantitative PCR analysis, the QuantiMir RT Kit (System Biosciences, USA) was used following the provided instructions. Quantitative real-time PCR was performed using Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on a compatible real-time PCR system. Amplification reactions included a miR-224-5p-specific forward primer (5′-AACAGATCAAGTCACTAGTGGTTCC-3′), the universal reverse primer, and primers for the U6 small nuclear RNA, which served as the internal control for normalization. Relative expression levels of miR-224-5p were calculated using the 2^-ΔΔCT method, with results presented as fold changes in expression compared to control samples.

AMH and estrogen ELISAs

The levels of anti-Müllerian hormone (AMH) and estrogen in the conditioned media were quantified using species-specific ELISA kits. For human samples, the Human AMH ELISA Kit (MBS1605908, MyBioSource, Canada) and Human Estrogen ELISA Kit (MBS2606149, MyBioSource, Canada) were used, while the Rat AMH ELISA Kit (AMS.E-EL-R3022-96-T, Amsbio, USA) and Rat Estrogen ELISA Kit (MBS2607338, MyBioSource, Canada) were used for rat samples. Conditioned media were collected from HGrC1 cells, human ovarian biopsies, and rat ovarian tissues—each including both control and enhanced exosome-treated groups—after 24 h of culture. All samples were centrifuged at 2000 × g for 20 min to eliminate cell debris prior to analysis. ELISAs were performed in accordance with the manufacturers’ instructions. The optical density (OD) was measured at 450 nm using a Varioskan™ LUX multimode microplate reader (Thermo Scientific, USA), and hormone concentrations were determined by comparing the OD values to the respective standard curves provided in each kit.

Statistical analysis

Statistical analyses were performed using GraphPad Prism. Data are presented as mean ± SEM unless otherwise indicated. Comparisons between two groups were performed using unpaired two-tailed Student’s t tests. Comparisons among multiple groups were performed using one-way or two-way analysis of variance (ANOVA), as appropriate. When multiple group comparisons were performed, post hoc correction was applied using Tukey’s multiple comparisons test. Statistical significance was defined as p < 0.05.

Author contributions

Mohammad Mousaei Ghasroldasht: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Writing. Hang-Soo Park: Conceptualization, Methodology, Formal analysis, Investigation. Farzana Liakath Ali: Methodology, Formal analysis, Investigation. Jin Seok: Conceptualization, Methodology, Investigation. Analea Beckman: Investigation, Writing-orginal draft. Nina Hafner: Investigation. Hyunho Kim: Investigation. Samar Alkhrait, Mervat M. Omran, and Hiba Alkelani: Investigation. Ayman Al-Hendy: Supervision, Writing-Review & Editing, Funding acquisition. All authors reviewed and approved the final manuscript.

Data availability

All data generated or analyzed during this study are included in this published article and its supplementary information files. Additional datasets are available from the corresponding author upon reasonable request.

Competing interests

The authors declare that a patent application related to this work has been filed under the Patent Cooperation Treaty (PCT) with application number PCT/US2022/073467. The patent covers aspects of the system described in this manuscript. The other authors declare no competing interests.

Supplementary information

The online version contains supplementary material available at https://doi.org/10.1038/s41536-026-00477-8.