Thymoquinone attenuates tricyclazole-induced testicular dysfunction through endocrine, redox, histomorphometric and sperm function changes in rats

Abstract

Male infertility is increasingly linked to environmental toxicants that perturb redox and endocrine homeostasis. Thymoquinone, a bioactive quinone with antioxidant, anti-inflammatory, and mitochondrial-stabilizing properties, may protect the seminiferous epithelium from such insults. Here, we tested whether thymoquinone attenuates tricyclazole-induced testicular injury across endocrine, redox, structural, molecular, and functional endpoints in adult rats assigned to four groups: Vehicle, tricyclazole, thymoquinone, and tricyclazole plus thymoquinone for 58 days. An integrated workflow combined serum testosterone and gonadosomatic index with testicular oxidative-stress biomarkers, qualitative histopathology, quantitative histomorphometry, spermatogenesis indices, stage-resolved transcript profiling, and epididymal sperm assessment using computer-assisted motion analysis and eosin–nigrosin viability staining. Tricyclazole reduced testosterone and gonadosomatic index, increased lipid peroxidation, suppressed superoxide dismutase activity, and disrupted seminiferous architecture, with epithelial thinning, vacuolization, germ-cell sloughing, and luminal enlargement. It also reduced differentiation and late maturation indices, whereas the repopulation index remained largely preserved, indicating that early spermatogonial repopulation was not detectably impaired under the present exposure conditions. In parallel, tricyclazole produced stage-resolved transcriptional suppression across selected pre-meiotic, meiotic, and post-meiotic markers, suggesting downstream disruption of spermatogenic progression rather than uniform impairment of all spermatogenic compartments. Thymoquinone alone was comparable to Vehicle across most endpoints. Co-treatment produced coherent but incomplete attenuation, improving endocrine and redox status, shifting epithelial organization, luminal geometry, transcript levels, and sperm performance toward baseline without full normalization. These data support thymoquinone as a pharmacognostically relevant protective compound against pesticide-associated male reproductive toxicity and justify dose optimization, steroidogenic profiling, and fertility-confirmation studies.

Introduction

Male infertility imposes a substantial and rising global burden, contributing to nearly half of infertility cases and exacting social and economic costs that extend beyond the clinic¹. A growing body of evidence indicates a secular decline in semen quality that tracks, at least in part, with increasing environmental contamination². Among the leading suspects are endocrine-disrupting chemicals (EDCs), a heterogeneous group of xenobiotics capable of perturbing hormonal signaling and redox homeostasis. In the testis, the seminiferous epithelium is uniquely sensitive to such perturbations: oxidative stress, inflammatory signaling, and apoptotic cascades undermine Sertoli–germ cell interactions, shrink epithelial height, and derail the stage-dependent emergence of differentiating germ cells^3,4. These insults compromise the architecture of seminiferous tubules and ultimately degrade sperm output and function. Identifying toxicant-specific injury patterns and developing effective countermeasures that restore epithelial integrity and spermatogenic fidelity is therefore a priority in reproductive toxicology⁵.

Within the pharmacognosy domain, thymoquinone, a major quinone constituent of the volatile oil of black cumin (Nigella sativa), provides a chemically defined compound for mechanistic evaluation of the pharmacological potential attributed to black cumin preparations. N. sativa seed and oil have a long history of human exposure in traditional medicine, including use for respiratory and gastrointestinal complaints, inflammatory conditions, general well-being, vitality, and reproductive health⁶. However, purified thymoquinone should not be considered equivalent to whole N. sativa seeds, oils, or extracts used in traditional practice. These preparations contain multiple bioactive constituents that may modify efficacy, bioavailability, and safety through additive, synergistic, or antagonistic interactions. Thus, in the present study, thymoquinone was used as a standardized marker compound and mechanistic probe rather than as a direct surrogate for whole-plant preparations. Mechanistically, thymoquinone scavenges reactive oxygen species, activates endogenous cytoprotective pathways, dampens NF-κB–driven cytokine output, and stabilizes mitochondrial function, features that may converge on preserving germ-cell survival and Sertoli/Leydig cell support during toxicant stress^7,8. Across diverse reproductive injury models, thymoquinone improves spermatogenic indices, restores endogenous antioxidant defenses, and suppresses apoptotic signaling, supporting its candidacy for mechanism-anchored intervention studies^9,10.

As a stringent challenge model, tricyclazole, a triazole fungicide widely used against rice blast, offers both endocrine and oxidative axes of injury¹¹. Although its antifungal efficacy stems from inhibition within the ergosterol pathway, the mammalian toxicological resonance reflects the centrality of cytochrome P450 enzymes to cholesterol biosynthesis and steroidogenic signaling¹². In vivo, azole-class perturbations can reduce testicular weight, disturb androgen homeostasis, and alter tubule morphometrics; accumulating evidence implicates mitochondrial dysfunction and antioxidant system exhaustion as pivotal mechanisms^13,14. Tricyclazole therefore provides a clinically relevant stressor for evaluating whether thymoquinone’s pleiotropy extends from generic redox buffering to preservation of the spermatogenic program itself.

To move beyond descriptive histology toward causal inference, stage-aware molecular markers are essential. We therefore anchored our analysis to a staged gene panel spanning key junctures in spermatogenesis: DAZL (a master RNA-binding regulator indispensable for pre-meiotic germ-cell maintenance and meiotic entry)¹⁵, SYCP3 (a structural component of the synaptonemal complex required for homologous chromosome synapsis)¹⁶, and the post-meiotic factors TSGA10 and AKAP4 (critical for head–tail coupling, flagellar assembly, fibrous-sheath architecture, and PKA-dependent signaling that directly impinges on sperm motility)^17,18. This panel situates tissue-level readouts within a mechanistic framework and provides responsive biomarkers to test whether a natural product, thymoquinone, can normalize a genetic program perturbed by a pesticide toxicant.

To bridge tissue architecture with functional fertility, we integrated quantitative histomorphometry (tubular differentiation, repopulation, and spermiogenesis indices; seminiferous tubule diameter; germinal epithelial height; and luminal geometry) with epididymal sperm profiling aligned to rat-adapted standards, including computer-assisted semen analysis for motility and kinematics and eosin–nigrosin staining for viability. This framework was complemented by endocrine and redox readouts, namely serum testosterone and gonadosomatic index, together with malondialdehyde (MDA) and superoxide dismutase (SOD) activity, and interpreted in the context of a stage-aware gene panel spanning pre-meiotic, meiotic, and post-meiotic compartments (DAZL, SYCP3, TSGA10, AKAP4). In combination, these hierarchical endpoints enable a rigorous, pharmacognosy-focused evaluation of thymoquinone as a cytoprotective intervention against an agrichemical stressor. Although the biological plausibility of tricyclazole injury and thymoquinone protection is recognized, prior work has often relied on coarse histology or generic oxidative-stress markers^11,19, leaving unresolved whether tricyclazole perturbs the genetic choreography that stages spermatogenesis and whether any phytochemical countermeasure can re-establish a stage-consistent transcriptional signature while improving the terminal sperm phenotype. Here, within the same animals, we map endocrine and redox perturbations to structural injury, transcriptional programs, and sperm function. We hypothesized that tricyclazole concurrently reduces testosterone, promotes oxidative imbalance, degrades epithelial organization, and down-modulates stage-dependent transcripts, whereas thymoquinone co-treatment preserves morphometric integrity and partially normalizes gene expression and epididymal performance.

Materials and methods

Ethics, reporting and study design

All animal procedures conformed to institutional and national guidelines for the care and use of laboratory animals and were approved by the Institutional Animal Ethics Committee of Islamic Azad University, Babol Branch (approval code IR.IAU.BABOL.REC.1399.033). Reporting follows ARRIVE 2.0 (Essential 10 and Recommended Set) to support transparency, reproducibility, and risk-of-bias control. Animals were randomly allocated to treatment groups, and data collection/analysis were conducted under pre-specified criteria with outcome assessment blinded where feasible. The experiment employed a randomized, controlled, factorial 2 × 2 design to test whether thymoquinone mitigates tricyclazole–induced testicular injury. Endpoints integrated unbiased histomorphometry (tubular differentiation, repopulation, spermiogenesis indices; seminiferous tubule diameter, epithelial height, luminal geometry) with stage-aware gene expression and epididymal sperm profiling (CASA kinematics and viability). Animal welfare was prioritized throughout, with routine monitoring and predefined humane considerations.

Animals and housing

Adult male Wistar rats (10–12 weeks; 250–300 g) were procured from an accredited vendor and acclimatized for 7 days under SPF conditions (22 ± 2 °C; 50–60% RH; 12:12 h light–dark) with ad libitum chow and water. Animals were housed 3–4 per cage on corn-cob bedding. Inclusion criteria were health on veterinary exam and weight within ± 10% of cohort mean; predefined exclusion criteria were illness unrelated to protocol or major protocol deviation.

Randomization, blinding and sample size

Rats were randomly assigned to four groups (Vehicle, TRZ, TQ, and TRZ + TQ) using computer-generated block randomization with concealed allocation. Outcome assessors for histology, morphometry, RT-qPCR, testosterone measurement, oxidative-stress assays, and sperm endpoints were blinded to treatment codes during acquisition and analysis. An a priori power analysis (two-way ANOVA, α = 0.05, power = 0.80, moderate interaction effect size f = 0.25 for TDI) supported the allocation of n = 8 rats per group for the dosing phase, allowing limited attrition across endpoint-specific workflows and remaining consistent with repeated-dose oral exposure studies of comparable duration.

No animal died during the 58-day protocol, and no animal was removed because of illness, overt systemic toxicity unrelated to the planned exposure, or major protocol deviation. Although n = 8 rats per group were allocated to dosing, several endpoints were analyzed at n = 6 per group. This difference reflected post-sampling technical quality criteria applied at the endpoint level under blinded conditions, rather than animal mortality or treatment-related loss. Quality exclusions included hemolyzed serum samples, RNA integrity below predefined thresholds for RT-qPCR, and inadequate sperm counts or field quality for CASA tracking. These exclusions yielded balanced analyzed datasets of n = 6 per group for the affected outcomes. The number of animals contributing to each endpoint is reported in the corresponding figure legends and tables.

Chemicals, vehicles and dosing rationale

Tricyclazole (Sigma; CAS 41814-78-2; ≥98%) is a triazolobenzothiazole fungicide that inhibits DHN-melanin biosynthesis in plant pathogens; in rodents, it is orally bioavailable and well characterized in regulatory dossiers. We selected 20 mg/kg/day (oral gavage) as a challenge dose informed by regulatory no-observed-adverse-effect-level and lowest-observed-adverse-effect-level ranges in rats and mice (developmental no-observed-adverse-effect-level approximately 5–8 mg/kg/day; lowest-observed-adverse-effect-level around 20 mg/kg/day) to induce measurable testicular stress without undue systemic toxicity. Tricyclazole was suspended in 0.5% carboxymethylcellulose (CMC) and administered at 5 mL/kg for 58 consecutive days²⁰.

Thymoquinone was evaluated as a purified, chemically defined marker compound of N. sativa rather than as a whole-plant preparation. This approach was selected to ensure dose accuracy, batch-to-batch reproducibility, cross-study comparability, and mechanistic attribution in a controlled toxicological model linking testicular injury to stage-resolved transcriptional outcomes. Because N. sativa seeds, oils, and extracts contain multiple constituents whose concentrations may vary with seed origin, cultivation conditions, storage, processing, and extraction method, use of a purified commercial standard minimized matrix-related variability and enabled quantitative dosing. However, this design does not reproduce the full phytochemical complexity of traditional N. sativa preparations, in which other constituents may modify efficacy, bioavailability, or safety. Thymoquinone (CAS 490-91-5; ≥98%; light-protected) was purchased from Sigma (Germany), dissolved in corn oil, and administered at 10 mg/kg/day by oral gavage (5 mL/kg) for 58 days, a regimen widely used and well tolerated in rat toxicology models²¹. Doses were given between 09:00 and 11:00 daily; body weight and clinical signs were recorded three times per week.

Because TRZ and TQ required different vehicles for stable oral administration, the study used a matched dual-vehicle design. TRZ was suspended in 0.5% CMC, whereas TQ was dissolved in corn oil. To control for potential vehicle-related effects, all groups received both vehicle matrices in matched gavage volumes. Thus, Vehicle rats received 0.5% CMC plus corn oil, TRZ rats received TRZ in 0.5% CMC plus corn oil, TQ rats received 0.5% CMC plus TQ in corn oil, and TRZ + TQ rats received both active compounds in their respective vehicles. Therefore, between-group comparisons reflected the presence or absence of TRZ and/or TQ under matched vehicle exposure rather than exposure to CMC or corn oil alone.

Dosing duration rationale

The 58-day regimen was selected to span a complete spermatogenic output window in the rat, approximating one cycle of the seminiferous epithelium (≈ 49 days) plus epididymal transit (≈ 10–15 days), thereby allowing treatment effects to manifest in both testicular staging and cauda epididymal sperm endpoints. Blood and tissues were collected 24 h after the final dose to minimize acute gavage-related fluctuations while preserving exposure relevance for endocrine and redox biomarkers.

Experimental groups and dosing schedule

Table 1 summarizes groups, vehicles and dosing. Volumes were matched across groups.

Table 1.

Experimental groups and dosing schedule (58-day oral gavage).

Group	TRZ (mg/kg/day)	TRZ vehicle	TQ (mg/kg/day)	TQ vehicle	Route	Volume (mL/kg)	Dosing window	n
Vehicle	0	0.5% CMC	0	Corn oil	Oral gavage	5 + 5*	09:00–11:00	8
TRZ	20	0.5% CMC	0	Corn oil	Oral gavage	5 + 5*	09:00–11:00	8
TQ	0	0.5% CMC	10	Corn oil	Oral gavage	5 + 5*	09:00–11:00	8
TRZ + TQ	20	0.5% CMC	10	Corn oil	Oral gavage	5 + 5*	09:00–11:00	8

* Co-gavage on the same day with volumes matched to control for vehicle effects.

Daily gavage volumes were matched across groups, and all animals received both the TRZ vehicle and the TQ vehicle. This design was used to minimize confounding by vehicle exposure when comparing Vehicle, TRZ, TQ, and TRZ + TQ groups.

Euthanasia, tissue collection, serum testosterone, and gonadosomatic index

Twenty-four hours after the last dose, rats were anesthetized (ketamine 80 mg/kg plus xylazine 10 mg/kg, i.p.) and euthanized by exsanguination. Blood was collected by cardiac puncture, allowed to clot at room temperature, and centrifuged (3,000 × g, 10 min, 4 °C) to obtain serum. Serum was aliquoted and stored at − 80 °C until analysis. Serum testosterone (ng/mL) was quantified using a competitive enzyme immunoassay (Testosterone ELISA Kit, Cayman Chemical, Item No. 582701, Ann Arbor, MI, USA) according to the manufacturer’s protocol. Absorbance was measured with a microplate reader, and concentrations were derived from a standard curve generated in the same run. All samples were assayed in duplicate, and assay performance was monitored using kit-provided controls.

Immediately after euthanasia, testes and epididymides were excised and weighed on an analytical balance. Gonadosomatic index (GSI) was calculated as (combined testes weight/final body weight) × 100 and reported as g/100 g body weight. The left testis was snap-frozen in liquid nitrogen for RNA extraction, and the right testis was fixed for histological evaluation.

Histology and unbiased morphometry

Right testes were immersion-fixed in 10% neutral-buffered formalin (24 h), processed, embedded in paraffin and sectioned at 5 μm; sections were stained with H&E. Morphometry used ImageJ with stage-micrometer calibration. Per animal, 30–50 round/near-round seminiferous tubule cross-sections (circularity > 0.85) were sampled at 100× to minimize obliquity. We quantified seminiferous tubule diameter (STsD), germinal epithelium height (GEH), luminal diameter and luminal area (µm, µm²), following validated quantitative protocols in rodent testes; two blinded raters provided measurements and inter-observer reliability was reported²².

Spermatogenesis indices (stage-aware histology)

Spermatogenesis indices were calculated from one standardized mid-parenchymal testicular section per animal. To reduce sampling bias within each section, the section was selected from a comparable anatomical plane across animals, and at least 200 seminiferous tubules were evaluated per animal from non-overlapping microscopic fields. Tubules with severe obliquity, folding artefacts, incomplete profiles, or poor staining quality were excluded. TDI was defined as the percentage of tubules containing at least three differentiated germ-cell layers, RI as the ratio of active type-B to inactive type-A spermatogonia, and SI as the percentage of tubules containing spermatozoa. All scoring was performed under blinded conditions using predefined criteria²³. This standardized within-section approach was used to provide a comparable group-level estimate of spermatogenic status across treatment arms.

Epididymal sperm analysis

Cauda epididymides were minced in pre-warmed HTF medium at 37 °C, and sperm suspensions were allowed to disperse before analysis. Sperm count was determined using a hemocytometer, whereas motility and kinematic parameters were quantified by computer-assisted sperm analysis (CASA) using at least 10 fields per sample and a minimum of 200 spermatozoa when technically feasible. Before CASA acquisition, each chamber was visually inspected, and fields containing excessive tissue fragments, immature germ-cell debris, cell aggregates, air bubbles, or uneven sperm distribution were excluded. CASA threshold settings were manually verified against phase-contrast images to confirm that counted objects showed sperm-compatible morphology. Objects lacking a recognizable sperm head or showing debris-like optical features were excluded from final analysis. Immotile spermatozoa were retained only when a sperm-compatible head, and when visible a tail, could be distinguished from nonspecific cellular debris. This manual verification was applied across all groups, with particular attention to TRZ samples because histology showed germ-cell sloughing and luminal debris²⁴.

RNA extraction and RT-qPCR

Frozen testis (~ 30 mg) was homogenized in TRIzol; RNA was purified using silica-membrane columns with on-column DNase I. RNA integrity (RIN ≥ 7.0) and purity (A260/280 = 1.9–2.1) were verified. cDNA synthesis used random hexamers + oligo(dT) (10 ng RNA/µL). Primers for Dazl, Sycp3, Tsga10, Akap4 (rat orthologs) were designed across exon–exon junctions (amplicons 80–150 bp) (Table 2) and validated for specificity and efficiency (90–110%) by standard curves and melt curves. Candidate reference genes (Gapdh and Actb) were stability-screened (geNorm/NormFinder); the two most stable were geometric-averaged. Reactions used SYBR Green chemistry (technical duplicates; NRT/NTC controls). Relative expression was calculated by 2^−ΔΔCt using Vehicle as calibrator.

Table 2.

Primer sequences used for real-time PCR.

Gene	Forward primer	Reverse primer
Dazl	TAACTACCAGATGCCACCGC	CACAGACTTCTTTTGCGGGC
Sycp3	TGGAGCTGACATCAACAAAGC	CCCACTGCTGCAACACATTC
TSGA10	TCCATGCAGAATCTCGAGGC	TCTGAACTGTGCCACGTCTC
AKAP4	GACAACAAGATCAGGACCGAAAAG	GGCATACAGATCCCTCCGTC
Actb	GTCCCTCACCCTCCCAAAAG	CTCAGACCTGGGCCATTCAG
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA

Statistics

Normality and homoscedasticity were assessed for each endpoint using Shapiro–Wilk and Levene’s tests, respectively. Primary inference followed the 2 × 2 factorial design using two-way ANOVA with fixed factors TRZ, TQ, and TRZ × TQ interaction. When significant main or interaction effects were detected, Tukey’s HSD tests were applied to estimated marginal means for comparisons among Vehicle, TRZ, TQ, and TRZ + TQ groups. Non-normal outcomes were Box–Cox transformed; if assumptions remained unmet, aligned-rank transform ANOVA was used. Effect sizes are reported as partial η² with 95% confidence intervals. Because several endpoint-level analyses were performed with n = 6 per group after quality-based exclusions, inference considered effect direction, magnitude, and confidence-interval precision, not p values alone. Effects with 95% CIs crossing the null were considered statistically uncertain, and non-significant findings were not interpreted as definitive absence of effect. Statistical significance was set at α = 0.05.

Results

Endocrine endpoint (serum testosterone) and organ-level index (GSI)

Serum testosterone and the gonadosomatic index (GSI) were assessed 24 h after the final dose to evaluate endocrine and organ-level outcomes (Fig. 1). TRZ administration significantly reduced circulating testosterone compared with Vehicle (1.17 ± 0.09 vs. 2.90 ± 0.19 ng/mL; p < 0.05). TQ alone did not differ from Vehicle (2.70 ± 0.17 ng/mL). In the TRZ + TQ group, testosterone was significantly higher than in the TRZ group (2.40 ± 0.20 ng/mL; p < 0.05), although it remained lower than Vehicle (p < 0.05; Fig. 1A). A similar pattern was observed for GSI (g/100 g BW). TRZ significantly decreased GSI compared with Vehicle (0.70 ± 0.07 vs. 1.20 ± 0.09; p < 0.05), whereas TQ alone showed values comparable to Vehicle (1.30 ± 0.11). TRZ + TQ significantly increased GSI relative to TRZ (0.95 ± 0.08; p < 0.05), but values remained lower than Vehicle (p < 0.05; Fig. 1B).

Fig. 1.

Endocrine and organ-level outcomes following TRZ and/or TQ treatment. (A) Serum testosterone (ng/mL) and (B) gonadosomatic index (GSI; g/100 g body weight) across Vehicle, TRZ, TQ, and TRZ + TQ groups. Box plots display median and interquartile range with whiskers spanning minimum to maximum values; individual animals are shown as dots. TRZ decreased testosterone and GSI, whereas TQ alone remained comparable to Vehicle. Co-treatment partially reversed TRZ-induced reductions.

Serum testosterone was used as a functional endocrine endpoint reflecting androgen status after TRZ and/or TQ exposure. Steroidogenic enzymes and regulatory proteins, including StAR, CYP11A1, and 3β-HSD, were not measured in the present study. Therefore, the testosterone data are reported as endocrine outcome measures and not as direct evidence of steroidogenic-pathway regulation.

Qualitative histopathology of testicular architecture

Representative H&E sections of rat testes (Fig. 2) provided a coherent qualitative context for the quantitative endpoints. In the Vehicle group, seminiferous tubules displayed regular, round profiles with a well-stratified germinal epithelium, densely populated late spermatids/spermatozoa, and small, uniform lumina. The thymoquinone group closely resembled Vehicle, with no overt degenerative changes. In contrast, tricyclazole exposure produced diffuse architectural disruption characterized by thinning and disorganization of the germinal epithelium, frequent cytoplasmic vacuolization at the Sertoli–germ cell interface, and sloughing of immature germ cells into enlarged lumina. Occasional multinucleated germ cells were noted, together with a conspicuous depletion of late spermatids; the interstitium showed mild vascular congestion without prominent inflammatory infiltrates. Co-treatment attenuated these lesions: many tubules exhibited partial reconstitution of epithelial layering, reduced vacuolization, and less luminal distension compared with TRZ alone, although heterogeneity persisted and lumina generally remained wider than in Vehicle (Fig. 2). No frank necrosis or tubular collapse was observed in any group. Overall, the histological impression is that tricyclazole compromises seminiferous architecture and spermiogenesis fidelity, whereas thymoquinone at 10 mg/kg confers a partial structural protection, consistent with downstream improvements in differentiation indices and directionally favorable, though incomplete, normalization of testicular microanatomy.

Fig. 2.

Qualitative histopathology of rat seminiferous tubules across treatments (H&E; scale bar, 100 μm). Representative micrographs illustrate treatment-dependent alterations in testicular architecture. In Vehicle and thymoquinone groups, tubules exhibit a well-stratified germinal epithelium with abundant late spermatids/spermatozoa and small, compact lumina. In contrast, tricyclazole exposure is characterized by epithelial thinning/disorganization and luminal dilatation, consistent with sloughing of immature germ cells and depletion of late spermatids. Co-treatment (TRZ + TQ) shows partial preservation or reconstitution of epithelial layering and reduced luminal expansion relative to TRZ alone, although heterogeneity persists. Color-coded overlays are used for orientation: green arrows denote late spermatids/spermatozoa, orange brackets indicate germinal epithelium thickness, and blue double-headed arrows mark luminal diameter.

Spermatogenesis indices

Spermatogenesis indices indicated that TRZ impaired seminiferous epithelial differentiation and late maturation rather than early repopulation (Fig. 3). TRZ markedly reduced the tubular differentiation index (TDI) relative to Vehicle, indicating fewer tubules with multilayered differentiating germ-cell organization (Vehicle − TRZ = + 15.37% points; 95% CI + 8.81 to + 21.93; p < 0.001; Fig. 3A). TRZ + TQ shifted TDI toward Vehicle values by approximately 6.2% points relative to TRZ alone, consistent with directionally favorable attenuation of the TRZ-associated deficit. However, the confidence interval for this contrast crossed zero (95% CI − 12.78 to + 0.34), indicating limited precision and statistical uncertainty; therefore, this effect was interpreted as a trend toward partial recovery rather than definitive restoration. In contrast, the repopulation index (RI) remained essentially stable across groups, with mean differences clustered within a narrow range and no statistically supported treatment effect (Fig. 3B). This finding suggests that early spermatogonial repopulation capacity was not detectably impaired under the present exposure conditions, although small effects cannot be excluded at the analyzed sample size. The spermiogenesis index (SI) showed a pattern broadly consistent with TDI. TRZ reduced SI relative to Vehicle (Vehicle − TRZ = + 6.34% points; 95% CI + 2.00 to + 10.67; p = 0.006), whereas TRZ + TQ produced a modest shift toward Vehicle values (Fig. 3C). Because the TRZ + TQ versus TRZ confidence interval overlapped the null, this change was considered directionally favorable but not conclusive. Overall, the index-based data support a differentiation- and maturation-biased impairment rather than global suppression of all spermatogenic stages.

Fig. 3.

Spermatogenesis indices (TDI, RI, SI). Violin–box plots show animal-level estimates for Vehicle, tricyclazole (20 mg/kg), TQ (10 mg/kg), and TRZ + TQ (n = 6/group). The violin encodes the kernel-density of the data; the box spans the interquartile range (IQR, Q1–Q3) with the central line = median; whiskers extend to Q1 − 1.5×IQR and Q3 + 1.5×IQR; filled dots are individual animals. Axes in A–B are restricted to 60–100% to emphasize the physiological band. Inference used two-way ANOVA (factors: TRZ, TQ; two-sided α = 0.05) with Tukey HSD for multiple comparisons; planned contrasts are reported as mean differences in percentage points (pp) with 95% CIs. As summarized in Results, tricyclazole reduced TDI (~ 15 pp) and SI (~ 6 pp) with no effect on RI; thymoquinone alone ≈ Vehicle, and TRZ + TQ shifted TDI and SI toward Vehicle values; however, because some 95% CIs crossed the null, these changes should be interpreted as directionally favorable attenuation rather than definitive rescue (≈ 40% for TDI; ≈33% for SI). Indices were calculated from one standardized mid-parenchymal section per animal, with ≥ 200 seminiferous tubules scored from non-overlapping fields under blinded conditions; therefore, values represent standardized section-level estimates of spermatogenic status.

Morphometry

Morphometric analysis quantified treatment-related alterations in seminiferous tubular structure and supported the qualitative histopathological findings. In superplots, TRZ increased tubular caliber and, more prominently, luminal dimensions relative to Vehicle, whereas GEH showed only minor changes. Estimated TRZ-associated increases were approximately 13.9% for STsD, 16.4% for luminal diameter, and 24.1% for luminal area. TQ alone remained close to Vehicle across morphometric endpoints (Fig. 4). The TRZ × TQ interaction plots showed broadly parallel TQ strata across TRZ levels, indicating little evidence of a strong interaction at the tested dose (Fig. 5). TRZ + TQ shifted several morphometric estimates toward Vehicle values, particularly for tubular and luminal measures. Forest-plot estimates showed directional attenuation of TRZ-associated changes, with rescue contrasts of approximately − 9% for STsD, − 8% for luminal diameter, and − 11% for luminal area (Fig. 6). However, several 95% confidence intervals crossed the null, indicating limited precision at n = 6 per group. Thus, these data support directionally favorable structural attenuation rather than confirmed morphometric normalization.

Fig. 4.

Tubular morphometry (A–D). Superplots display group means with 95% CIs (n = 6/group) for (A) STsD (µm); (B) GEH (µm); (C) luminal diameter (µm); and (D) luminal area (µm²) across Vehicle, tricyclazole (20 mg/kg), thymoquinone (10 mg/kg), and TRZ + TQ. tricyclazole enlarged tubules, most prominently luminal area ( ~ + 26% vs. Vehicle) and STsD ( ~ + 16%), while GEH shifted minimally ( ~ + 2%). Thymoquinone alone was near-baseline. Co-treatment shifted several estimates toward Vehicle values, but some 95% CIs overlapped the null, indicating directional attenuation with limited precision rather than confirmed morphometric normalization.

Fig. 5.

TRZ×TQ interaction (cell means ± 95% CI). Two-factor display with TRZ on the x-axis (No→Yes) and thymoquinone as strata (blue: No; green: Yes). (A) STsD; (B) GEH; (C) luminal diameter; (D) luminal area. Points are EMM-like cell means with 95% CIs. Lines are roughly parallel, indicating little evidence of interaction at these doses. tricyclazole shifts STsD ( ~ + 14%) and luminal metrics (diameter ~ + 16%, area ~ + 24%) upward with minimal change in GEH, while TRZ + TQ showed a directional downward shift relative to TRZ for several tubular and luminal measures.

Fig. 6.

Morphometric effect sizes (%Δ vs. Vehicle and Rescue; 95% CI). Forest plot summarizing percent change relative to Vehicle for each group (TRZ, TQ, TRZ + TQ) and the Rescue contrast, defined as 100×[(TRZ + TQ − TRZ)/(Vehicle − TRZ)]. Points show mean effects; bars are 95% CIs; the dashed line at 0% is the null. Across endpoints, tricyclazole generally increases tubular caliber, most prominently the lumen (LuminalA), whereas thymoquinone alone centers near zero. Co-treatment shifts estimates toward control (negative Rescue), typically ~ 8–11% for luminal metrics. Illustrative values: STsD, TRZ + 13.9% (− 6.9, + 34.7); LuminalA, TRZ + 24.1% (− 12.9, + 61.1) with Rescue − 11.3% (− 41.5, + 19.0). Wide CIs reflect n = 6/group and align with Fig. 4. Rescue is used as an operational effect-size contrast and does not imply statistically confirmed restoration when the 95% CI crosses the null.

Epididymal sperm analysis

A one-way ANOVA confirmed a robust treatment effect across all CASA and viability readouts (Tukey-adjusted). Tricyclazole imposed a coherent, multi-domain impairment: sperm output dropped by ≈ 40% versus Vehicle; total and progressive motility declined by ≈ 36% and 45%, respectively. The kinematic profile shifted uniformly leftward, VCL, VSL, and VAP fell by ≈ 23%, 33%, and 28%, accompanied by a ≈ 19% reduction in linearity (LIN), a ≈ 23% decrease in ALH, and a ≈ 24% slowing of BCF. Viability likewise decreased by ≈ 21% (Table 3). Collectively, these changes indicate fewer sperm and diminished motile competence across velocity, trajectory, and beat dynamics.

Table 3.

Epididymal sperm analysis.

Parameter	Vehicle	TRZ	TQ	TRZ + TQ	ΔTRZ vs. Veh (%)	Rescue (%)
Sperm count (×106/mL)	85 ± 9 a	51 ± 8 c	87 ± 10 a	66 ± 9 b	-40.0	44
Total motility (%)	78 ± 6 a	50 ± 7 c	80 ± 6 a	61 ± 7 b	-35.9	39
Progressive motility (%)	56 ± 7 a	31 ± 6 c	58 ± 6 a	41 ± 6 b	-44.6	40
VCL (µm/s)	110 ± 12 a	85 ± 11 c	112 ± 13 a	95 ± 11 b	-22.7	40
VSL (µm/s)	60 ± 8 a	40 ± 7 c	62 ± 8 a	48 ± 7 b	-33.3	40
VAP (µm/s)	80 ± 10 a	58 ± 9 c	82 ± 10 a	67 ± 9 b	-27.5	41
LIN (%)	54 ± 6 a	44 ± 5 c	55 ± 6 a	48 ± 5 b	-18.5	40
ALH (µm)	4 ± 0 a	3 ± 0 c	4 ± 0 a	3 ± 0 b	-22.9	37
BCF (Hz)	12 ± 1 a	10 ± 1 c	13 ± 1 a	11 ± 1 b	-24.0	40
Viability (%)	86 ± 5 a	68 ± 6 c	88 ± 4 a	75 ± 5 b	-20.9	39

Values are mean ± SD (n = 6 per group). Two-way ANOVA (factors: TRZ, TQ, and TRZ×TQ), with Tukey HSD post-hoc comparisons across the four treatment cells. Within a row, values with different superscript letters differ at p < 0.05. ΔTRZ vs. Veh (%) is the percent change for TRZ relative to Vehicle; Rescue (%) = 100 × (TRZ + TQ – TRZ) / (Vehicle – TRZ). CASA fields and tracking thresholds were manually verified to exclude nonsperm debris, tissue fragments, aggregates, and objects lacking sperm-compatible morphology before final analysis.

CASA parameters: VCL, curvilinear velocity; VSL, straight-line velocity; VAP, average path velocity; LIN, linearity = VSL/VCL × 100; ALH, amplitude of lateral head displacement; BCF, beat cross frequency.

TQ alone remained essentially baseline (deviations clustered within a few percent of Vehicle across endpoints), indicating no detectable detriment at the administered dose. In contrast, TRZ + TQ produced a directionally consistent partial attenuation of the TRZ-associated deficits, with approximately 38–44% operational recovery across primary and secondary sperm endpoints. Practically, group means shifted toward—but did not reach—Vehicle, with the canonical rank order preserved (Vehicle ≈ TQ > TRZ + TQ > TRZ) across nearly all variables (Table 3). Notably, the relative gains were most evident for progressive motility and VSL, mirroring protection of post-meiotic performance features that depend on intact flagellar assembly and signaling.

Altogether, the CASA/viability profile dovetails with the histology, spermatogenesis indices, morphometry, and staged gene expression: tricyclazole reduces both the quantity (count) and quality (motility/kinematics/viability) of the final gamete, while thymoquinone co-administration confers a multi-parameter functional benefit of moderate magnitude without full normalization. The use of rat-adapted CASA standards (≥ 10 fields; ≥200 cells/sample) enhances reproducibility and underscores that the observed ~ 40% pattern of loss, and partial recovery, is not assay-idiosyncratic but reflects a biologically integrated response. Because TRZ-treated testes showed germ-cell sloughing histologically, CASA outputs were interpreted after manual verification of counting thresholds and exclusion of debris-like objects. Therefore, the observed reduction in motility and kinematic performance was not attributed to automated misclassification of nonsperm debris as immotile spermatozoa.

Testicular oxidative stress markers: lipid peroxidation (MDA) and antioxidant enzyme activity (SOD)

To characterize oxidative stress status in testicular tissue, lipid peroxidation (MDA) and antioxidant capacity (SOD activity) were quantified 24 h after the final dose (Fig. 7). TRZ markedly increased MDA compared with Vehicle (70.15 ± 5.80 vs. 32.50 ± 4.10 nmol/mg protein; p < 0.05), indicating enhanced membrane lipid peroxidation. In contrast, TQ alone reduced MDA relative to Vehicle (26.24 ± 3.60 nmol/mg protein; p < 0.05; Fig. 7A). Co-treatment (TRZ + TQ) significantly attenuated the TRZ-induced rise in MDA (36.00 ± 5.10 nmol/mg protein), restoring values to a level comparable with Vehicle (p > 0.05) and significantly lower than TRZ (p < 0.05).

Fig. 7.

Oxidative stress biomarkers in testicular tissue following TRZ and/or TQ treatment. (A) Malondialdehyde (MDA; nmol/mg protein) as an index of lipid peroxidation and (B) superoxide dismutase (SOD; U/mg protein) activity as an enzymatic antioxidant marker in Vehicle, TRZ, TQ, and TRZ + TQ groups. Box plots show median and interquartile range with whiskers spanning minimum to maximum values; individual animals are displayed as dots. TRZ increased MDA and suppressed SOD, whereas TQ mitigated TRZ-associated oxidative imbalance. Two-way ANOVA (factors: TRZ, TQ, and TRZ×TQ), with Tukey HSD post-hoc comparisons across the four treatment cells.

A reciprocal pattern was observed for SOD activity. TRZ significantly decreased SOD compared with Vehicle (9.80 ± 1.40 vs. 28.70 ± 3.40 U/mg protein; p < 0.05), consistent with impaired enzymatic antioxidant defense. TQ alone maintained SOD at control-like levels (29.50 ± 3.41 U/mg protein; p > 0.05 vs. Vehicle). Notably, TRZ + TQ significantly improved SOD activity relative to TRZ (24.10 ± 2.60 U/mg protein; p < 0.05), although it remained modestly below Vehicle (p < 0.05; Fig. 7B).

Gene-expression profiling

Gene-expression profiling showed a coordinated TRZ-associated suppression across selected spermatogenesis-related transcripts, providing a stage-resolved transcriptional readout rather than direct histological evidence of equivalent injury across all spermatogenic compartments. In the heatmap, TRZ-exposed animals showed a broad downward shift in log2FC spanning the pre-meiotic marker Dazl, the meiotic marker Sycp3, and the post-meiotic markers Tsga10 and Akap4; TQ alone clustered close to Vehicle, whereas TRZ + TQ generally shifted expression values toward baseline (Fig. 8A). Standardized Hedges’ g estimates confirmed negative TRZ versus Vehicle effects across the gene panel, with moderate-to-large effects for Dazl/Sycp3 and moderate effects for Tsga10/Akap4 (Fig. 8B). Gene-level estimation plots further quantified these patterns. Dazl and Sycp3 showed negative TRZ versus Vehicle contrasts and positive TRZ + TQ versus TRZ contrasts, indicating partial movement toward baseline expression (Fig. 8C, D). Post-meiotic transcripts followed the same directionality, with Tsga10 and Akap4 suppressed by TRZ and shifted upward in TRZ + TQ animals (Fig. 8E, F). Representative log2FC estimates suggested that TRZ reduced transcript abundance by approximately 25–45%, whereas TRZ + TQ recovered approximately 10–25% of this loss. However, some 95% confidence intervals overlapped zero, particularly for rescue contrasts. Interpreted alongside the unchanged RI, these data indicate preserved early repopulation but impaired differentiation, meiotic/post-meiotic transcriptional programs, and terminal sperm performance.

Fig. 8.

Multiview analysis summarizes stage-resolved log2FC responses to tricyclazole (TRZ) and thymoquinone (TQ). (A) Per-animal heatmaps for DAZL, SYCP3, TSGA10, and AKAP4 across Vehicle, TRZ, TQ, and TRZ + TQ (n = 6) use a zero-centered diverging scale. TRZ induces a broad downward shift spanning pre-meiotic (DAZL), meiotic (SYCP3), and post-meiotic (TSGA10/AKAP4) markers; TQ clusters near Vehicle. Co-treatment shifted expression values toward baseline, although some gene-level rescue contrasts showed 95% CIs overlapping zero and should therefore be interpreted as statistically uncertain. (B) Dot–whisker standardized effects (Hedges g, 95% CI) show TRZ vs. Vehicle is moderate-to-large negative for DAZL/SYCP3 and moderate negative for TSGA10/AKAP4. Rescue (TRZ + TQ vs. TRZ) is positive across all genes, largest for TSGA10/AKAP4; some CIs overlap zero given n = 6. (C–F) Gardner–Altman plots confirm patterns: negative toxicant contrasts, positive rescue contrasts, and near-zero TQ vs. Vehicle. Overall, per-gene estimates align with heatmaps and contrasts. The gene panel provides a stage-resolved transcriptional readout across representative pre-meiotic, meiotic, and post-meiotic markers and should be interpreted alongside the preserved RI.

Discussion

This study shows that tricyclazole induced coordinated reproductive injury involving seminiferous epithelial disruption, impaired differentiation and late maturation, stage-resolved transcriptional suppression, and reduced epididymal sperm performance. Thymoquinone co-treatment shifted several structural, molecular, and functional endpoints toward baseline, but this attenuation was incomplete and statistically uncertain for some contrasts. The internal coherence of these modalities strengthens causal inference: epithelial thinning and germ cell sloughing co-occurred with depressed differentiation/maturation indices, expanded tubular lumina, and downregulation of pre-, meiotic-, and post-meiotic transcripts. Such convergence is typical for toxicant-driven degeneration of the seminiferous epithelium.

Situating tricyclazole within the broader azole landscape clarifies the biological context of the endocrine findings. Azole fungicides are recognized endocrine-active compounds that can interfere with steroid biosynthesis through CYP-related and aromatase-associated pathways and may variably perturb androgen homeostasis^25,26; however, the present study did not directly measure steroidogenic regulators such as StAR, CYP11A1, 3β-HSD, or Leydig-cell-specific protein expression. Therefore, the reduction in circulating testosterone and gonadosomatic index observed after TRZ exposure should be interpreted as evidence of altered androgen status and organ-level reproductive impact, rather than definitive proof of steroidogenic-enzyme suppression. Similarly, the increase in testosterone and GSI in the TRZ + TQ group indicates a shift toward endocrine recovery but does not establish restoration of steroidogenic pathway activity. This endocrine pattern aligns with the seminiferous rarefaction observed histologically and with previous rodent evidence linking tricyclazole exposure to altered testicular architecture and testosterone perturbation²⁷. Importantly, androgen imbalance alone does not explain the full phenotype. The histological pattern of vacuolization, germ-cell sloughing, and late-spermatid depletion is also consistent with oxidative injury and stress-linked germ-cell loss²⁸; in direct support, TRZ increased MDA and reduced SOD activity in testicular homogenates. Apoptotic, inflammatory, and Leydig-cell steroidogenic pathways remain plausible mediators, but they require direct validation in future studies.

The staged gene panel provides mechanistic granularity. DAZL, a master RNA-binding regulator of germ cell translation, is essential for licensing gametogenesis; stress-responsive phosphorylation can dampen DAZL’s translational control, linking environmental stress signaling to impaired germline programs^29,30. SYCP3 is a core component of the synaptonemal complex, required for chromosome synapsis and meiotic architecture; its loss compromises prophase I fidelity³¹. At the post-meiotic level, AKAP4 scaffolds PKA signaling within the fibrous sheath; genetic ablation abolishes progressive motility and causes male infertility, and proAKAP4 is now explored as a clinical biomarker of sperm quality³². TSGA10 supports mitochondrial sheath/flagellar organization; human and mouse evidence shows that deficiency produces severe head–tail coupling defects and male infertility¹⁷. TRZ-induced downregulation across this panel therefore maps coherently onto the observed histology (loss of late spermatids) and morphometry (luminal expansion consistent with diminished intratubular cellular content).

Why does thymoquinone help, and why only partly? Thymoquinone is a pleiotropic cytoprotective compound with antioxidant, anti-inflammatory, anti-apoptotic, and mitochondrial-modulatory actions. Across diverse injury models, including lead, mercury, hypothyroidism, and cisplatin exposure, thymoquinone has been reported to improve sperm parameters, support endogenous antioxidant defenses, and modulate reproductive hormone profiles, consistent with combined redox and endocrine-related effects^33–35. In the present study, TRZ + TQ increased testosterone and GSI relative to TRZ and attenuated oxidative imbalance by lowering MDA and increasing SOD activity. These coordinated changes provide a plausible basis for the directionally favorable shifts observed in seminiferous architecture, spermatogenic indices, staged transcript expression, and sperm kinematics. However, these effects should be interpreted as partial attenuation rather than definitive restoration, because testosterone and GSI did not fully return to Vehicle levels and several morphometric, index-based, and transcriptional contrasts showed statistical uncertainty. The positive shifts in post-meiotic transcripts, particularly TSGA10 and AKAP4, are consistent with improved support for later spermiogenic and motility-linked processes, which are sensitive to redox injury³². Nevertheless, TQ should not be interpreted as a pathway-specific testicular protectant. The present design cannot distinguish direct gonadal cytoprotection from indirect systemic effects, because TQ may also influence hepatic xenobiotic metabolism, CYP-dependent pathways, systemic inflammatory tone, mitochondrial function, or TRZ toxicokinetics. Thus, the TRZ + TQ phenotype should be interpreted as the net biological effect of co-treatment under the present exposure conditions rather than evidence for a single testis-specific mechanism. The pharmacognostic interpretation should also remain conservative. Thymoquinone was used here as a purified marker compound and mechanistic probe, not as a direct substitute for whole N. sativa seeds, oils, or extracts used in traditional practice. Whole-plant preparations contain additional quinones, alkaloids, phenolics, fatty acids, and volatile constituents that may modify thymoquinone activity through additive, synergistic, antagonistic, or bioavailability-dependent interactions. Therefore, these findings show that purified thymoquinone can attenuate several TRZ-associated reproductive alterations under controlled dosing conditions, but they cannot be directly extrapolated to traditional N. sativa preparations. Translation to whole-plant use requires chemically standardized oils or extracts, quantitative thymoquinone profiling, safety assessment, and direct comparison with purified thymoquinone. Dose-response work in allied models further suggests that optimized exposure regimens, pharmacokinetic profiling, xenobiotic-metabolism markers, and pathway-specific experiments are required when endocrine and redox disruption occur together³⁶.

The preserved RI alongside reduced TDI, SI, and staged transcript expression clarifies the nature of the spermatogenic defect. Rather than indicating uniform disruption of all spermatogenic stages, the data suggest that early spermatogonial repopulation was relatively preserved under the present TRZ regimen, whereas downstream differentiation, meiotic/post-meiotic transcriptional programs, and sperm functional maturation were more vulnerable. In this context, “stage-resolved” is more appropriate than “stage-specific,” because the gene panel was used to map transcriptional changes across representative spermatogenic phases rather than to demonstrate equivalent histological impairment at each stage. Reduced DAZL and SYCP3 are consistent with altered germ-cell licensing and meiotic synapsis, whereas lower TSGA10 and AKAP4 align with impaired post-meiotic differentiation, flagellar organization, and motility-linked structures^17,37. Therefore, the unchanged RI does not contradict the transcriptional findings; instead, it indicates that TRZ-induced injury preferentially affected progression beyond early repopulation. Similar oxidative-injury phenotypes have been reported for other agricultural toxicants, including imidacloprid, reinforcing external validity and situating TRZ within a broader toxicological pattern in which antioxidant interventions confer partial, but not complete, attenuation^38,39.

From a translational perspective, our findings convey two actionable messages. First, they reinforce concern that environmental pesticide exposures, particularly azole fungicides, can compromise male reproductive health by jointly perturbing steroidogenic control and redox homeostasis within the testis²⁵. This inference is directly supported here by the concurrent suppression of serum testosterone and gonadosomatic index, coupled with elevated MDA and reduced SOD activity in TRZ-exposed animals, linking endocrine disruption to a measurable oxidative shift at the organ level. Second, they position thymoquinone as a pharmacognostically relevant and mechanistically plausible adjunctive countermeasure, while underscoring the limits of antioxidant monotherapy when endocrine signaling and stage-specific gene programs are simultaneously derailed¹⁰. Although co-treatment restored testosterone, improved GSI, normalized lipid peroxidation, and partially recovered SOD activity, these corrections were not uniformly complete across the spermatogenic hierarchy, paralleling the incomplete normalization of morphometric indices, staged transcripts, and sperm kinematics.

Several limitations temper this interpretation. Although n = 8 animals per group were allocated to dosing, several endpoint-level analyses were performed with n = 6 animals per group after blinded, quality-based exclusions. This reduced statistical power, widened confidence intervals, and increased the possibility of Type II error, particularly for small-to-moderate effects and interaction terms. Thus, non-significant findings should not be interpreted as definitive absence of effect, and TQ-associated shifts with 95% CIs overlapping zero should be considered directional attenuation rather than proven rescue or full restoration. Spermatogenesis indices were calculated from one standardized mid-parenchymal section per animal; although ≥ 200 seminiferous tubules were scored from non-overlapping fields under blinded conditions, this approach cannot fully capture three-dimensional intra-testicular heterogeneity. Mechanistically, serum testosterone and GSI support endocrine involvement, while MDA and SOD indicate redox imbalance; however, StAR, CYP11A1, 3β-HSD, LH, FSH, inhibin B, inflammatory mediators, apoptotic markers, DNA damage, and blood-testis barrier integrity were not assessed. Therefore, steroidogenic disruption or restoration cannot be directly inferred. TQ was tested as a purified marker compound rather than as a standardized N. sativa seed, oil, or extract preparation, limiting extrapolation to whole-plant preparations. In addition, TQ is pleiotropic, and potential off-target effects on hepatic xenobiotic metabolism, CYP-dependent pathways, systemic inflammatory tone, mitochondrial function, or TRZ toxicokinetics were not assessed. Finally, although TRZ and TQ vehicles were controlled through a matched dual-vehicle design, bioavailability, tissue distribution, and toxicokinetics were not measured. Therefore, vehicle-dependent or TQ-mediated effects on absorption or metabolism cannot be excluded, and future studies should incorporate pharmacokinetic profiling, xenobiotic-metabolism markers, standardized N. sativa preparations, and multi-level histological or stereological sampling.

In conclusion, TRZ induced coordinated reproductive injury involving androgen suppression, redox imbalance, seminiferous epithelial disruption, impaired differentiation and late maturation indices, stage-resolved transcriptional suppression, and reduced epididymal sperm performance. TQ co-treatment shifted several endocrine, oxidative, structural, transcriptional, and functional endpoints toward baseline, supporting a coherent protective pattern. However, this protection was incomplete, and several contrasts showed confidence intervals crossing the null. Therefore, the data support partial attenuation rather than definitive rescue or full normalization. Larger studies incorporating steroidogenic markers, expanded molecular endpoints, toxicokinetic profiling, and fertility-confirmation assays are needed to verify moderate protective effects and strengthen translational interpretation.

Author contributions

Conceptualization: [RKK], [SGAJ] Methodology: [RKK], [SK], [EF] Formal analysis: [MGTT], [EF] Resources: [SGAJ] Data curation: [SK] Visualization: [RKK], [MGTT] Writing – original draft: [RKK], [EF] Writing – review & editing: [SGAJ], [SK], [MGTT] Supervision: [SGAJ]. All authors have read and approved the final version of the manuscript and agree to be accountable for all aspects of the work.

Data availability

The datasets generated and/or analyzed during this study are available from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.