PDK1‐mediated PI3K/Akt signaling regulates metabolic and developmental programs in a cosmopolitan pest

Abstract

BACKGROUND

3‐Phosphoinositide‐dependent protein kinase 1 (PDK1) is a central kinase in the phosphatidylinositol 3‐kinase/serine–threonine kinase (PI3K/Akt) pathway that integrates growth and nutrient signals to regulate metabolism and development across diverse animal taxa. However, its functions in insects remain ambiguous.

RESULTS

Here, we identify and characterize PxPDK1 in the diamondback moth, Plutella xylostella, a major agricultural pest. PxPDK1 encodes a conserved kinase containing serine/threonine kinase and pleckstrin homology domains, and is highly expressed during embryonic, pupal and adult stages. CRISPR/Cas9‐mediated knockout of PxPDK1 resulted in developmental delay, failure of pupal–adult eclosion, impaired ovarian development, and sharply reduced fecundity and egg hatchability. Loss of PxPDK1 attenuated Akt phosphorylation and disrupted genes involved in metabolism, reproduction and cuticle formation, accompanied by decreased adult glycogen content. Conversely, PxPDK1 expression promoted Sf9 cell proliferation.

CONCLUSION

These findings establish PxPDK1 as an essential regulator of insect development and metabolism, highlighting PDK1 as a promising molecular target for pest control. © 2026 Society of Chemical Industry.

Knockout of PxPDK1 reduced AKT (Protein kinase B) phosphorylation, thereby perturbing the phosphatidylinositol 3‐kinase/serine–threonine kinase (PI3K/Akt) pathway and the expression of its reproduction‐ and metabolism‐related genes, contributing to the observed developmental retardation and decline in fecundity.

1. INTRODUCTION

Insects constitute a major component of global biodiversity and underpin the structure and function of terrestrial ecosystems. ¹ , ² At the same time, many insect species are among the most destructive agricultural pests worldwide. ³ Climate change and intensified anthropogenic disturbances have amplified the frequency and magnitude of pest outbreaks by accelerating insect development, enhancing reproductive capacity and expanding geographic ranges, thereby posing escalating threats to global food security and agricultural sustainability. ⁴ Elucidating the molecular and cellular mechanisms that govern insect growth, development and reproduction is therefore a prerequisite for the rational design of targeted and sustainable pest control strategies.

Among the conserved signaling networks that coordinate organismal growth and development, the phosphatidylinositol 3‐kinase/serine–threonine kinase (PI3K/Akt) pathway functions as a central regulatory axis. This pathway integrates extracellular growth cues with intracellular programs controlling cell proliferation, survival and metabolic homeostasis. ⁵ , ⁶ , ⁷ Canonical activation is initiated when growth factors bind their cognate transmembrane receptors, triggering receptor dimerization and tyrosine autophosphorylation. These phosphotyrosine motifs recruit the regulatory subunit (p85) of PI3K via its SH2 domains, thereby activating the catalytic subunit (p110). ⁸ , ⁹ Activated PI3K converts phosphatidylinositol 4,5‐bisphosphate (PIP2) into phosphatidylinositol 3,4,5‐trisphosphate (PIP3), generating membrane‐localized signaling platforms that selectively recruit pleckstrin homology (PH) domain‐containing effector kinases, including phosphoinositide‐dependent kinase‐1 (PDK1) and Akt. ¹⁰

Akt activation requires sequential phosphorylation at two conserved residues: Thr308 by PDK1 and Ser473 by the mammalian target of rapamycin complex 2 (mTORC2). Once fully activated, Akt operates as a signaling hub that transduces PI3K inputs into coordinated outputs governing cellular growth, metabolic flux and survival decisions. ¹¹ Importantly, PI3K/Akt signaling does not act in isolation but engages in extensive cross‐talk with other major pathways, including MAPK, Wnt/β‐catenin and NF‐κB, enabling fine‐tuned regulation of developmental and physiological processes. ¹² , ¹³ , ¹⁴ , ¹⁵ In insects, this pathway has emerged as a key determinant of growth and life‐history traits, influencing body size, tissue patterning, reproductive output, endocrine regulation, lifespan and xenobiotic metabolism. ¹⁶ , ¹⁷ , ¹⁸ , ¹⁹ , ²⁰ , ²¹ , ²²

PDK1 is a highly conserved member of the AGC kinase family and occupies a pivotal position within the PI3K signaling hierarchy. Structurally, PDK1 comprises an N‐terminal catalytic domain and a C‐terminal PH domain that mediates membrane recruitment in response to PIP3 accumulation. ²³ Beyond its canonical role in phosphorylating Akt at Thr308, ²⁴ PDK1 acts as a master regulator of AGC kinases, including S6 kinase beta‐2 (S6K), serum and glucocorticoid‐regulated kinase (SGK) and protein kinase C (PKC) isoforms. Through these substrates, PDK1 exerts broad control over protein synthesis, metabolic regulation, neuronal function and organismal growth, highlighting its capacity to couple upstream nutrient and growth signals with downstream developmental outputs. ²⁵ , ²⁶ , ²⁷ , ²⁸ , ²⁹

The diamondback moth, Plutella xylostella (L.) (Lepidoptera: Plutellidae), is one of the most destructive pests of cruciferous crops worldwide and imposes severe economic losses on agricultural production systems. ³⁰ , ³¹ Its extraordinary ability to rapidly evolve resistance to multiple classes of insecticides, together with strong environmental plasticity, ensure its persistence as a major threat under current and future climate conditions. ³² , ³³ , ³⁴ The availability of a high‐quality reference genome has further established P. xylostella as a powerful model for functional genetic studies in pest biology. ³⁵ Despite extensive characterization of the PI3K/Akt pathway in mammals, the mechanistic roles of its core components, particularly PDK1, in insect development and reproduction remain poorly understood.

PDK1 is a conserved upstream kinase in the PI3K/Akt signaling pathway, a key regulator of insect growth, metabolism and reproduction. Functioning as a central signaling hub, PDK1 integrates inputs from multiple upstream receptors and phosphorylates downstream effectors, including Akt, thereby serving as a potential bottleneck in pathway regulation. Studies in other species, such as Tuta absoluta, ¹⁹ have shown that disruption of PDK1 causes severe developmental and reproductive defects, suggesting its promise as a candidate target for pest management. In this study, we functionally characterize PxPDK1, a central node of the PI3K/Akt pathway in P. xylostella. Using CRISPR/Cas9‐mediated gene knockout, we demonstrate that loss of PxPDK1 leads to profound defects in larval development, reproductive capacity and metabolic homeostasis. Our findings establish PxPDK1 as an essential regulator linking growth signaling to developmental and reproductive outcomes in an agriculturally important insect. Beyond advancing fundamental understanding of insect developmental biology, this work identifies PDK1 as a promising molecular target for innovative insect pest management strategies in the context of global environmental change.

2. MATERIALS AND METHODS

2.1. Insect strains and cell line

The wild‐type AD strain (WT) of P. xylostella was obtained from the Institute of Zoology, Chinese Academy of Sciences. Insects were maintained in a controlled climate chamber at 26.0 ± 0.5 °C, 60% ± 5% relative humidity, under a 16:8 h light/dark photoperiod. Larvae were reared on an artificial diet and adults were provided with 10% (v/v) honey solution. The Sf9 cell line was cultured at 27 °C in Grace's Insect Medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FSD500, Excell bio, Shanghai, China) and 50 μg mL⁻¹ gentamicin sulfate (Solarbio, Beijing, China).

2.2. RNA extraction and complementary DNA synthesis

Total RNA was isolated using the SteadyPure Rapid RNA Extraction Kit (Accurate Biology, Changsha, China), purified and quantified following the manufacturer's protocol. Complementary DNA (cDNA) was synthesized using the FastKing gDNA Dispelling RT SuperMix (TianGen, Beijing, China). The resulting cDNA was stored at −80 °C for subsequent experiment.

2.3. Gene cloning and sequencing

The coding sequence was amplified via polymerase chain reaction (PCR) using Phanta Max Super‐Fidelity DNA Polymerase (Vazyme, Nanjing, China) (primers see Supporting Information, Table S1). The PCR product was separated by 1% agarose gel, and the target band was gel‐purified using the Universal DNA Gel Extraction Kit (TIANGEN). The purified fragment was cloned into the pESI vector (YEASEN, Shanghai, China) and transformed into DH5α competent cells. Positive clones were verified by sequencing (Sangon Biotech, Shanghai, China).

2.4. Bioinformatic and phylogenetic analysis

The PxPDK1 amino acid sequences were annotated via an NCBI conserved domain search, and aligned against orthologs from diverse species using NCBI BLAST. Then evolutionary relationships were reconstructed using the neighbor‐joining method in MEGA 12.0 with 1000 bootstrap replicates. Domain architecture was analyzed using InterPro and graphically presented with TBtools for visualization. The physicochemical properties [isoelectric point (pI), molecular mass] of PxPDK1 was analyzed using ExPASy. SignalP‐4.1 predicted signal peptide cleavage sites in PxPDK1. Transmembrane domains were identified via TMHMM Server v.2.0. Secondary structures were predicted using SOPMA. Tertiary structures were modeled by SWISS‐MODEL through homology‐based approaches.

2.5. Real‐time quantitative PCR

Total RNA was extracted from P. xylostella across nine developmental stages (egg, first‐ to fourth‐instar larvae, early pupa, mid pupa, late pupa and adult males/females) and ten dissected adult tissues (antennae, head, thorax, wings, legs, midgut, fat body, ovaries, testes and accessory glands). For quantifying other target genes in the mutant strain, newly emerged (24 h) adult moths from both wild‐type and PxPDK1 mutant strains were collected. cDNA was synthesized as described in Section 2.2. Real‐time quantitative PCR (qPCR) was performed using ChamQ™ Blue Universal SYBR qPCR Master Mix (Vazyme) on a CFX96 Real‐Time PCR Detection System (Bio‐Rad). The ribosomal protein L32 (RPL32) gene served as the endogenous control, and relative expression levels were calculated using the 2^−ΔΔCt method, primers detailed in Supporting Information, Table S1. All qPCR experiments were performed with three biological replicates.

2.6. Construction of mutant strain by CRISPR/Cas9

The single‐guide RNA (sgRNA) targeting exon 3 was designed using Benchling (https://www.benchling.com/academic), adhering to the 5′‐NGG‐3′ protospacer adjacent motif (PAM). Potential off‐target sites for selected sgRNAs were evaluated with Cas‐OFFinder (http://www.rgenome.net/cas-offinder). The sgRNA were synthesized by in vitro transcription using the MEGAscript™ T7 Transcription Kit (Thermo) (for primers see Supporting Information, Table S1). Purified sgRNA was complexed with Cas9‐NLS nuclease (GenScript, Piscataway, NJ, USA) in injection buffer (300 ng of sgRNA, 0.75 μL of Cas9 protein, 1 μL of 10× reaction buffer, RNase‐free ddH₂O to 10 μL) and incubated at 37 °C for 20 min to form ribonucleoprotein (RNP) complexes. Newly laid eggs were collected and injected with the RNP mixture using an Olympus SZX16 stereomicroscope equipped with a microinjection system. To identify mutant individuals, genomic DNA was extracted from adult moths using a polyethylene glycol (PEG)‐based method, ³⁶ and the target region was amplified by PCR and sequenced (Sangon Biotech) (for primers see Supporting Information, Table S1). Heterozygous G₀ individuals were identified by overlapping sequencing chromatogram peaks at the target site. Stable homozygous mutant lines were established through successive sibling crosses of heterozygous carriers.

2.7. Age‐stage‐specific sex life table

To compare the life‐history traits of wild‐type and PxPDK1 mutant strains, age‐stage, two‐sex life tables were constructed. For each strain, a cohort of 120 newly laid eggs (<30 min old) was randomly selected and reared under the standard conditions described in Section 2.1. Developmental stages were checked and recorded at 24‐h intervals. Individual pupae were transferred to ventilated 1.5‐mL microcentrifuge tubes. Upon eclosion, single male–female pairs were placed in 25‐mL plastic cups provisioned with a 10% (v/v) honey solution. Daily records were kept for female egg production and the longevity of both sexes. The data were analyzed using the TWOSEX‐MSChart software (http://140.120.197.173/ecology/prod2.htm). ³⁷ The software calculated key population parameters, including the survival rate (S _xj ), age‐specific survival rate (lₓ), female age‐specific fecundity (f _x ), age‐specific fecundity (mₓ), net reproductive rate (R₀), intrinsic rate of increase (r), finite rate of increase (λ) and mean generation time (T). Variance and standard error of population parameters across strains were estimated with 100 000 bootstrap replications.

2.8. Phenotypic and behavioral assays

Developmental morphology was analyzed using a VHX‐1000 deep‐focus digital microscopy system (Keyence). For mating behavior assays, newly eclosed adults (24 h post‐eclosion) were paired in 25‐mL ventilated cups (one female and one male per pair). The mating response duration was recorded (time from pairing to the initiation of copulation). Furthermore, female fecundity (total number of eggs laid) and egg hatchability were quantified for all strains.

2.9. Transcriptome sequencing

Newly eclosed adults (24 h post‐eclosion) of the wild‐type (AD) and PxPDK1 mutant strains were collected, with three biological replicates per strain. Transcriptome sequencing was performed by Majorbio Bio‐Pharm Technology (Shanghai, China). Libraries were constructed using the Illumina Stranded mRNA Prep Kit and sequenced on an Illumina platform. After standard quality control, each sample yielded at least 5.98 Gb of clean data, and the percentage of Q30 bases exceeded 95.89%. Clean reads were mapped to the P. xylostella reference genome (GCF_932276165.1) using TopHAT2 or HISAT2, with mapping rates ranging from 58.06% to 69.81%. Differential gene expression analysis was conducted with the DESeq2 package, applying thresholds of |log₂(fold change)| ≥ 2.5 and P‐adjust ≤0.05. Functional enrichment analysis of the identified differentially expressed genes (DEGs) was performed based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Differential expression analysis was carried out separately for females and males.

2.10. Quantification of phosphorylated AKT levels and glycogen content

Newly eclosed adults (24 h post‐eclosion) from wild‐type and PxPDK1 mutant strains were collected, and total protein was extracted. Protein concentration was determined using a BCA assay kit (Beyotime, Shanghai, China) according to the manufacturer's instructions. Absorbance at 562 nm was measured with a Synergy H1 microplate reader (BioTek), and concentrations were calculated based on a standard curve. The level of phosphorylated AKT (p‐AKT) was quantified using an insect‐specific p‐AKT ELISA kit (Sinobestbio, Nanjing, China). ³⁸ Total glycogen content was measured with an insect glycogen ELISA kit (Sailuofe, Changsha, Chinai). Both assays were performed strictly according to the manufacturer's protocols.

2.11. The PxPDK1 heterologous expression

To investigate PxPDK1 function, a recombinant plasmid for its expression was constructed and transfected into Sf9 cells. The PxPDK1 coding sequence was amplified with primers containing homologous ends and assembled into the linearized vector, pIZT/V5‐His‐superfolder green fluorescent protein (GFP), using a DNA Assembly Mix Plus kit (LabLead, Changsha, China) (for primers see Supporting Information, Table S1). Sf9 cells were transfected with the recombinant plasmid or an empty vector control using Lipofectamine 3000 (Thermo). At 24 h post‐transfection, successful expression of the PxPDK1–sfGFP fusion protein was confirmed by visualizing green fluorescence under a Leica confocal microscope. Cell nuclei were stained with DAPI (4',6‐diamidino‐2'‐phenylindole) (YEASEN) and then performed subcellular localization. The protein expression was verified by western blot (His‐tag, Rabbit pAb, Peroxidase AffiniPure Goat Anti‐Rabbit lgG (H + L), YEASEN) at 48 h. To assess the impact of PxPDK1 on proliferation, cell viability was measured at 0, 6, 24, 48, 72 and 96 h post‐transfection using a CCK‐8 assay kit (TopScience, Shanghai, China) according to the manufacturer's instructions.

2.12. Statistical analysis

Statistical analysis was performed using SPSS Statistics 19.0. Differences between two groups were evaluated using independent samples t‐tests, while comparisons among multiple groups were assessed by one‐way analysis of variance with Tukey's test.

3. RESULTS

3.1. Molecular characterization and phylogenetic analysis of PxPDK1

We cloned and sequenced a 1695 bp open reading frame (ORF) of PxPDK1 from P. xylostella, which encodes a 564 amino acid protein containing a conserved serine/threonine protein kinase domain (STKc_PDK1; residues 98–381) and a PH domain (PH_PDK1; residues 454–555) (Fig. 1(A)). Phylogenetic analysis of PDK1 homologs from diverse insect species revealed that PxPDK1 clusters closely with orthologs from other lepidopterans, forming a branch distinct from those of other orders and separate from other lepidopteran families (Fig. 1(B)). Notably, multiple sequence alignment confirmed the high evolutionary conservation of both the kinase and PH domains across all analyzed insect PDK1 proteins (Fig. 1(C)), underscoring their essential functional roles.

Figure 1.

Sequence analysis and phylogenetic tree of the PxPDK1 protein in P. xylostella. (A) Conserved domain of PxPDK1 in Plutella xylostella. STKc_PDK1, serine/threonine protein kinase domain; PH_PDK1, pleckstrin homology domain. (B) Phylogenetic analysis of PDK1 from different insect species. (C) Structural conservation analysis of PDK1 in insects.

3.2. Bioinformatic analysis of the PxPDK1

PxPDK1 has a predicted pI value of 8.77 and a calculated molecular mass of 64.0 kDa. No canonical signal peptide sequences or transmembrane domains were detected (Supporting Information, Fig. S1A,B). Secondary structure prediction indicated that PxPDK1 is predominantly composed of random coils, followed by α‐helices, extended strands and β‐sheets (Supporting Information, Fig. S1C). Homology modeling further revealed distinct structural features of PxPDK1. The core region adopts a typical globular kinase architecture rich in α‐helices, whereas the peripheral regions contain disordered extensions (Supporting Information, Fig. S1D).

3.3. Spatiotemporal expression profile of PxPDK1

qPCR analysis revealed that PxPDK1 is ubiquitously transcribed throughout all developmental stages of P. xylostella. Its transcript levels were significantly higher during the egg, pupal and adult stages compared with the larval instars (Supporting Information, Fig. S2A). Tissue‐specific expression profiling showed that, in females, the highest expression was detected in the head, legs, thorax and fat body (Supporting Information, Fig. S2B). Similarly, in males, elevated expression was observed in the thorax, legs, head and cuticle (Supporting Information, Fig. S2C).

3.4. Establishment of pure mutant strain for PxPDK1

The PxPDK1 gene contains five exons and sgRNA target sites were designed within exon 3 (5′‐GGTGATTGGTACCATACCAG‐3′) of PxPDK1 (Fig. 2(A)). Following multigenerational screening, an homozygous mutant carrying a 27 bp deletion (resulting in a nine amino acid deletion: Asp251, Pro252, Glu253, Val254, lle255, Arg256, Thr257, lle258, Pro259) at the targeted exon was obtained and designated as PxPDK1(−27) ^(−/−) (Fig. 2(B)). This deletion is located within the conserved serine/threonine protein kinase domain (STKc_PDK1) (residues: 98–381) and is predicted to partially impair the normal function of the PxPDK1 protein.

Figure 2.

CRISPR/Cas9‐mediated knockout of PxPDK1 in Plutella xylostella. (A) Schematic diagram of the PxPDK1 gene structure and the single‐guide RNA target sequence. The target sequence is shown in red, and the protospacer adjacent motif (PAM) sequence in blue. (B) The chromatograms from direct sequencing of PxPDK1 PCR products from wild‐type and PxPDK1 knockout strains. WT(+/+), wild‐type; PxPDK1 (Aa), heterozygous strain; PxPDK1 (‐27) ^(−/−) , homozygous strain with a 27 bp deletion.

3.5. Knockout of PxPDK1 reduced population parameters

Under standardized conditions, the PxPDK1(‐27) ^(−/−) strain exhibited significant life‐history alterations compared with the wild‐type. The durations of the egg, larval and pupal stages, as well as the female adult lifespan and total pre‐oviposition period, were significantly extended, whereas total fecundity was markedly reduced. No significant differences were observed in male adult longevity or the oviposition period. Analysis of population dynamic parameters revealed that the PxPDK1(−27) ^(−/−) strain had a significantly lower intrinsic rate of increase (r), finite rate of increase (λ) and net reproductive rate (R₀), coupled with a significantly longer mean generation time (T) (Table 1).

Table 1.

Different developmental stages of wild‐type and PxPDK1 knockout of Plutella xylostella

Parameter	Wild‐type	PxPDK1(‐27)(−/−)
Egg duration (day)	3.00 ± 0.00	3.06 ± 0.03*
Larva duration (day)	5.93 ± 0.03	6.18 ± 0.05*
Pupa duration (day)	3.52 ± 0.05	4.08 ± 0.10*
Egg–adult female duration (day)	21.29 ± 0.36	23.16 ± 0.56*
Egg–adult male duration (day)	22.84 ± 0.60	24.33 ± 0.76
Fecundity (eggs)	207.86 ± 8.95	99.41 ± 9.13*
Total pre‐oviposition (day)	12.52 ± 0.08	13.48 ± 0.15*
Oviposition period (day)	6.71 ± 0.33	5.90 ± 0.42
r (day−1)	0.294 ± 0.009	0.206 ± 0.012*
λ (day−1)	1.341 ± 0.013	1.229 ± 0.015*
R 0 (eggs per female)	72.750 ± 9.530	26.508 ± 4.686*
T (day)	14.615 ± 0.110	15.896 ± 0.206*

Note: r, intrinsic rate of increase; λ, finite rate of increase; R ₀, net reproductive rate; T, generation time. Data for treatments were compared using the paired bootstrap test (bootstraps: 100 000). Values are mean ±SE. *P < 0.05 difference between wild‐type and PxPDK1(‐27) ^(−/−) strains.

The survival rate, S _xj , defined as the probability that a neonate survives to age x and stage j, was significantly reduced in the PxPDK1(‐27) ^(−/−) strain. The larval survival rate dropped to 56.57% in the knockout compared with 90.00% in the wild‐type. During the adult stage, the survival rates of both males (22.50%) and females (26.67%) were also significantly lower than those of the wild‐type (male: 50.83%; female: 35.00%). The peak of the adult survival curve for the mutant was delayed to day 16, versus day 13 for the wild‐type (Fig. 3(A), (B)).

Figure 3.

Comparison of population parameters among different strains. Age‐stage survival rates (S _xj ) of wild‐type (A) and PxPDK1(‐27) ^(−/−) (B) strains. Age‐specific survival rate (l _x ), female age‐specific fecundity (f _x ), age‐specific fecundity of total population (m _x ) and age‐specific maternity (l _x m _x ) of wild‐type (C) and PxPDK1(‐27) ^(−/−) (D) strains.

Further analysis of life table curves showed a sharp decline in the age‐specific survival curve (lₓ) for mutant larvae. The f _xj curve, representing the daily fecundity (number of eggs per female) at age x and stage j, indicated that peak daily fecundity was severely reduced in the mutant (32.22 eggs) compared with the wild‐type (76.46 eggs). The age‐specific fecundity curve (mₓ) showed that peak daily oviposition occurred later in the mutant (day 13) than in the wild‐type (day 12). Consequently, the maximal value of the age‐specific maternity curve (lₓmₓ) was only 6.45 for the mutant, markedly lower than the 21.95 found for the wild‐type (Fig. 3(C), (D)).

3.6. Knockout of PxPDK1 results in marked phenotypic alterations

Knockout of PxPDK1 severely impairs egg development in P. xylostella. While eggs from the wild‐type strain are plump with a smooth and glossy surface, those from the PxPDK1(‐27) ^(−/−) consistently exhibit empty eggs and developmental arrest (Fig. 4(A)). Consequently, the egg hatch rate of the PxPDK1 mutant is significantly lower (t = 9.643, df = 98, P < 0.001) than that of the wild‐type (Fig. 4(B)). Knockout of PxPDK1 also severely affects pupal development. Pupae of the PxPDK1(‐27) ^(−/−) strain exhibited developmental abnormalities during the late pupal stage, including darkening of the cuticle and cuticular shrinkage (Fig. 4(C)), ultimately failing to eclose successfully. Consequently, the eclosion rate was significantly lower (t = 7.379, df = 4, P < 0.01) than that of the wild‐type (Fig. 4(D)). In adult moths, the PxPDK1 mutation led to defective ovarian development in females, manifested as a significant reduction (t = 4.454, df = 38, P < 0.001) in ovarian tube length compared with the wild‐type strain (Fig. 4(E), (F)). Furthermore, we observed a significantly prolonged (t = −4.004, df = 58, P < 0.001) mating response time (Fig. 4(G)) and a marked decrease (t = 8.885, df = 98, P < 0.001) in total fecundity (Fig. 4(H)).

Figure 4.

Characterization of phenotypes in PxPDK1 knockout strains. (A) Egg phenotypes. (B) Egg hatchability. (C) Pupal phenotypes. (D) Pupal eclosion rate. (E) Ovarian development. (F) Ovariole length. (G) Mating response time. (H) Oviposition capacity of wild‐type and knockout strains. Data are presented as mean ± SE, significant differences were determined using Student's t‐test (**P < 0.01; ***P < 0.001).

3.7. Transcriptome analysis following PxPDK1 knockout

RNA sequencing was performed on newly eclosed adults of both sexes from the PxPDK1 (‐27) ^(−/−) and wild‐type (AD) strains (labeled PxPDK1(‐27) ^(−/−) _F (mutant female), PxPDK1 (‐27) ^(−/−) _M (mutant male), AD_F (wild‐type female), AD_M (wild‐type male)). Principal component analysis confirmed strong intragroup consistency and high reproducibility (Fig. 5(A)). Comparative analysis identified 595 DEGs in mutant females (337 upregulated, 258 downregulated) and 953 DEGs in mutant males (564 upregulated, 389 downregulated) relative to their wild‐type counterparts (Fig. 5(B)).

Figure 5.

Transcriptome analysis of adults from wild‐type and PxPDK1(‐27) ^(−/−) strains. (A) Principal component analysis (PCA) of RNA seqencing data. (B) Number of up‐ and downregulated differentially expressed genes (DEGs). (C, D) Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of DEGs in females (C) and males (D).

KEGG pathway enrichment analysis of these DEGs highlighted significant disruption in multiple biological processes. In females, DEGs were enriched in pathways including the Toll and Imd signaling pathway (pxy04624), starch and sucrose metabolism (pxy00500), pentose and glucuronate interconversions (pxy00040), fatty acid degradation (pxy00071), insect hormone biosynthesis (pxy00981), longevity regulating pathway (pxy04213) and the MAPK signaling pathway (pxy04013) (Fig. 5(C)). In males, enriched pathways included fatty acid degradation, Toll and Imd signaling, galactose metabolism (pxy00052), longevity regulation, pentose and glucuronate interconversions, mTOR signaling (pxy04150), insect hormone biosynthesis, MAPK signaling and fatty acid biosynthesis (pxy00061) (Fig. 5(D)).

3.8. Knockout of PxPDK1 led to reduced expression of downstream genes

As a critical upstream regulator of the PI3K/Akt signaling pathway, knockout of PxPDK1 led to distinct alterations in the expression of key downstream components. Quantitative analysis revealed no significant change in the transcript level of RAC serine/threonine protein kinase (AKT) between wild‐type and PxPDK1 (‐27) ^(−/−) in either sex (Fig. 6(A)). By contrast, significant dysregulation was observed in other pathway targets: the forkhead box protein O (FoxO) was upregulated (t = −5.937, df = 4, P _female < 0.01; t = −3.177, df = 4, P _male < 0.05) in mutant either sex (Fig. 6(B)), MTOR‐associated protein MEAK7 (mTORC1) was downregulated (t = 12.463, df = 4, P < 0.001) in mutant males (Fig. 6(C)), and glycogen synthase kinase 3 beta (GSK3β) was downregulated (t = 17.287, df = 4, P _female < 0.001; t = 5.533, df = 4, P _male < 0.01) in mutants of both sexes (Fig. 6(D)). Conversely, ribosomal protein S6 kinase beta‐2 (S6K) expression was significantly upregulated (t = −13.637, df = 4, P _female < 0.001) in mutant females and showed a similar, though non‐significant, trend in males (Fig. 6(E)). Because Akt primarily functions via phosphorylation, we further assessed its activation status. Consistent with the loss of its upstream kinase, Akt phosphorylation levels were significantly reduced (t = 3.786, df = 10, P _female < 0.01; t = 6.488, df = 10, P _male < 0.001) in the PxPDK1 (−27) ^(−/−) compared to the wild‐type strain (Fig. 6(F)).

Figure 6.

The impact of PxPDK1 knockout on downstream genes of the PI3K/AKT pathway. Expression levels in adults of wild‐type and knockout strains: AKT (A), FoXO (B), mTORC1 (C), GSK3β (D) and S6K (E). (F) Phosphorylation level of AKT in adult of different strains. Data are presented as mean ± SE, significant differences were determined using Student's t‐test (*P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant).

3.9. PxPDK1 knockout reduced the expression of reproduction‐related genes

qPCR analysis indicated that the expression in females of both vitellogenin (Vg) and its receptor (VgR) was markedly downregulated (t = 3.340, df = 4, P _vg  < 0.05; t = 3.909, df = 4, P _VgR  < 0.05) compared with wild‐type controls (Fig. 7(A), (B)). This significant downregulation provides a plausible explanation for the observed ovarian developmental defects and reduced egg production in mutant females (Fig. 4(E), (F), (H)). In mutant males, transcript levels of pheromone‐binding protein 1 (PBP1) were unchanged (Fig. 7(C)), whereas expression of the piwi‐like protein Siwi (Piwi) gene was significantly reduced (t = 3.992, df = 4, P < 0.05) (Fig. 7(D)). Furthermore, key components of the olfactory system, odorant receptor (OR) (t = 5.395, df = 4, P _female < 0.01; t = 2.985, df = 4, P _male < 0.05) and odorant receptor coreceptor (ORCO) (t = 3.564, df = 4, P _female < 0.05; t = 3.212, df = 4, P _male < 0.05) were both significantly downregulated in the mutant strain (Fig. 7(E), (F)). The reduced expression of PiWi and olfactory‐related genes may partially account for the decreased fecundity and prolonged mating response time observed in the P. xylostella mutant strain (Fig. 4(A), (B), (G)).

Figure 7.

Knockout of PxPDK1 affects the expression of reproduction and metabolism‐related genes. Expression levels in adults of wild‐type and knockout strains: Vg (A), VgR (B), PBP1 (C), Piwi (D), OR (E), ORCO (F), FAS (G), HADA (H), GALT (I), CHS (J) and Cht (K). (L) Glycogen content in adults of different strains. Data are presented as mean ± SE, significant differences were determined using Student's t‐test (*P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant).

3.10. Metabolic reprogramming mediated by PxPDK1 knockout

PxPDK1 knockout significantly disrupted multiple metabolic pathways, with notable sex‐specific effects. In fatty acid metabolism, the expression of fatty acid synthase (FAS) and hydroxyacyl‐CoA dehydrogenase (HADH) was significantly downregulated (t = 4.924, df = 4, P _FAS  < 0.01; t = 4.314, df = 4, P _HADH  < 0.05) in mutant females. In males, only FAS expression was significantly reduced (t = 3.955, df = 4, P < 0.05), whereas HADH showed no significant change (Fig. 7(G), (H)). For galactose metabolism, the expression of galactose‐1‐phosphate uridylyltransferase (GALT) was significantly downregulated (t = 3.418, df = 4, P _female < 0.05; t = 3.444, df = 4, P _male < 0.05) in mutant of both sexes (Fig. 7(I)). In the case of chitin metabolism, the genes encoding chitin synthase (CHS) (t = 4.950, df = 4, P _female < 0.01; t = 7.301, df = 4, P _male < 0.01) and chitotriosidase‐1 (Cht) (t = 9.271, df = 4, P _female < 0.001; t = 4.474, df = 4, P _male < 0.05) were both significantly downregulated in mutants of both sexes (Fig. 7(J), (K)). The wrinkled cuticle and eclosion failure phenotypes observed in mutant pupae may be related to disruption of chitin metabolism (Fig. 4(C), (D)). Consistent with the broad metabolic perturbations, total glycogen content was significantly lower (t = 21.388, df = 4, P _female < 0.001; t = 7.914, df = 4, P _male < 0.01) in both female and male mutant adults compared with wild‐type counterparts (Fig. 7(L)).

3.11. Functional validation of PxPDK1 in Sf9 cells

To further elucidate the function of PxPDK1, this gene was transiently transfected into Sf9 cells. At 24 h post‐transfection with pIZT/V5‐His‐sfGFP–PxPDK1 and the empty vector control pIZT/V5‐His‐sfGFP, fluorescence microscopy confirmed robust expression of superfolder green fluorescent protein (sfGFP), indicating efficient transfection (Fig. 8(A)–(C))). Subcellular localization analysis indicated that, the PxPDK1 protein localizes to both the cytoplasm and the cell membrane (Fig. 8(D)). The successful ectopic expression of these sfGFP‐fused PxPDK1 protein was further verified by western blots (Fig. 8(E)). Cell proliferation activity was assessed using the CCK‐8 assay at multiple time points (0, 6, 24, 48, 72 and 96 h) by measuring optical density at 450 nm (OD₄₅₀). Compared with the empty vector control, cells transfected with pIZT/V5‐His‐sfGFP–PxPDK1 exhibited significantly higher OD₄₅₀ values at 24 h (t = −6.644, df = 4, P < 0.01), 48 h (t = −3.500, df = 4, P < 0.05), 72 h (t = −7.356, df = 4, P < 0.01) and 96 h (t = −16.867, df = 4, P < 0.001) (Fig. 8(F)).

Figure 8.

Expression of PxPDK1 protein in Sf9 cells. (A) Fluorescence imaging of transfection efficiency: Sf9 cells. (B) Control group transfected with pIZT/V5‐His‐sfGFP. (C) Experimental group transfected with pIZT/V5‐His‐sfGFP‐PxPDK1. (D) Subcellular localization of PxPDK1 protein. Green fluorescent protein (GFP) signal (green), DAPI (4',‐6‐diamidino‐2‐phenylindole)‐stained cell nuclei (blue), bright field (BF) and merged channels. (E) Western blot analysis of the PxPDK1 fusion protein. (F) Proliferation curves of Sf9 cells transfected with pIZT/V5‐His‐sfGFP or pIZT/V5‐His‐sfGFP‐PxPDK1 at various time points. Data are presented as mean ± SE, significant differences were determined using Student's t‐test (*P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant).

4. DISCUSSION

PDK1 is a central regulatory kinase within the AGC family, best known for activating Akt through phosphorylation at Thr308 and thereby controlling core cellular processes such as growth, metabolism and survival. ³⁹ , ⁴⁰ , ⁴¹ Although the physiological and pathological roles of PDK1 have been extensively characterized in mammalian systems, ⁴² its mechanistic roles in insect development and reproduction, particularly in globally important pest species, have remained largely unexplored. In this study, we provide a comprehensive functional analysis of PxPDK1 in P. xylostella, revealing its essential role as a signaling node linking growth cues to developmental progression, reproductive capacity and metabolic homeostasis in this globally significant pest.

Molecular characterization of PxPDK1 revealed a highly conserved protein architecture, comprising a serine/threonine kinase domain and a C‐terminal PH domain. This organization mirrors that of PDK1 orthologs across metazoans, including Haemonchus contortus, lamprey and T. absoluta, ¹⁹ , ⁴³ , ⁴⁴ underscoring the deep evolutionary conservation of this kinase. Phylogenetic clustering of PxPDK1 within a lepidopteran‐specific clade further suggests functional conservation among related insect taxa. Bioinformatic analyses indicated that PxPDK1 lacks signal peptides and transmembrane domains, consistent with its established role as a cytosolic kinase that is transiently recruited to the plasma membrane via PIP3‐dependent interactions. ⁴⁵ Structural modeling revealed a canonical kinase core supported by α‐helical elements, alongside peripheral disordered regions. These flexible regions are likely critical for dynamic substrate engagement and regulatory interactions, consistent with current models in which PDK1 activity is modulated through coordinated interactions between its kinase domain, PH domain and binding partners. ⁴⁶

Expression profiling revealed that PxPDK1 is ubiquitously expressed throughout development, with pronounced enrichment during embryogenesis, late pupal stages and adulthood. Such temporal dynamics strongly implicate PxPDK1 in regulating key developmental transitions, particularly metamorphosis and reproductive maturation. This pattern aligns with the conserved role of PI3K/Akt signaling in coordinating tissue remodeling and energy allocation during insect metamorphosis. ¹⁹ , ⁴⁷ Tissue‐specific analyses further showed elevated PxPDK1 expression in metabolically active and neuromuscular tissues, including the fat body, thorax, head and appendages, suggesting broad involvement in systemic physiology, locomotion and energy balance. Similar expression patterns reported for PDK1 in other lepidopterans ¹⁹ support a conserved role for this kinase in integrating metabolic and developmental programs.

Functional disruption of PxPDK1 via CRISPR/Cas9‐mediated knockout resulted in profound developmental and reproductive defects, providing direct in vivo evidence for its essential role. Life table analyses demonstrated significant delays in larval and pupal development, consistent with impaired growth signaling. These phenotypes mirror those observed following disruption of insulin/insulin‐like growth factor 1–PI3K signaling in insects, where reduced Akt activation constrains anabolic growth and delays developmental progression. ⁴⁸ , ⁴⁹ At the population level, PxPDK1 deficiency caused a marked collapse in demographic performance, reflected by reduced intrinsic and finite rates of increase and extended generation time. These population‐level effects can be mechanistically attributed to the combined impact of prolonged development and sharply reduced reproductive output. ⁵⁰

Reproductive impairment emerged as one of the most pronounced consequences of PxPDK1 loss. Mutant females exhibited severely reduced fecundity, delayed oviposition, impaired ovarian development and diminished egg viability. These findings are consistent with the conserved role of PI3K/Akt signaling in regulating oogenesis and vitellogenesis across insects. ⁵¹ , ⁵² Disruption of this pathway, whether through viral interference or genetic suppression of Akt, has been shown to compromise ovarian maturation and egg production in multiple species. ⁵³ , ⁵⁴ In addition, PxPDK1 knockout resulted in defective embryogenesis and complete hatching failure, indicating that PDK1‐dependent signaling is required not only for gametogenesis, but also for early embryonic cell proliferation and differentiation. ⁵⁵ The severe pupal abnormalities observed, including cuticular darkening, shrinkage and reduced eclosion success, further point to a critical role for PxPDK1 in coordinating the final metamorphic transition, consistent with observations in T. absoluta following TaPDK1 silencing. ¹⁹

Transcriptomic profiling revealed that PxPDK1 loss induces extensive gene expression reprogramming, reinforcing its role as a high‐level regulatory node. DEGs were enriched in pathways associated with innate immunity, central carbon and lipid metabolism, hormone biosynthesis and growth‐related signaling cascades such as mTOR and MAPK. These results position PxPDK1 as a molecular integrator that couples metabolic state with developmental timing and immune competence, a functional paradigm conserved across insects. ⁵⁶ , ⁵⁷ Such integration is a hallmark of insulin/PI3K signaling, which coordinates nutrient availability with processes including cuticle formation and tissue growth. ⁵⁸ , ⁵⁹

Targeted analysis of the PI3K/Akt pathway confirmed its functional attenuation in PxPDK1 mutants. The observed transcriptional upregulation of FoxO, coupled with downregulation of mTORC1 and GSK3β, is a canonical signature of reduced Akt activity. ⁴⁵ Consistently, reduced Akt phosphorylation was detected, indicating compromised signal propagation downstream of PDK1. Attenuation of this pathway is expected to suppress anabolic processes required for growth and reproduction, including protein synthesis and lipid biosynthesis. ⁶⁰ Interestingly, S6K expression was significantly upregulated, suggesting activation of a compensatory feedback mechanism. Recent studies have shown that S6K can phosphorylate PDK1 to restrain pathway activity, forming a negative feedback loop. ⁴⁰ We propose that loss of PxPDK1 disrupts this feedback control, resulting in compensatory upregulation of S6K.

The reproductive defects observed in PxPDK1 mutants may be associated with dysregulation of key reproductive genes. Vg and VgR were significantly downregulated, consistent with prior reports showing that PI3K/Akt signaling promotes vitellogenesis and ovarian development, silencing of InR, PI3K and Akt in Cyrtorhinus lividipennis resulted in a 92.1%, 72.1% and 57.8% reduction in Vg expression, respectively. ⁶¹ We speculate that, compared with downstream effectors, upstream regulators often control multiple signaling branches and broader physiological process, and their loss may lead to severe pleiotropic effects or early larval mortality. This pathway likely interacts with juvenile hormone signaling to coordinate resource allocation toward reproduction. ⁶² Our data indicated that Vg/VgR are key downstream effectors, the precise mechanism by which PxPDK1 regulates their transcription remains to be elucidated. Nevertheless, consistent with previous studies on PI3K/Akt signaling in other insects, these genes play a central role in reproductive phenotypes. In addition, downregulation of Piwi and olfactory genes (OR, ORCO) suggests a potential link to the combined defects in fertility and mating behavior. Piwi is essential for germline maintenance and fertility, ⁶³ whereas ORCO is indispensable for pheromone perception and mating behavior in insects. ⁶⁴ Reduced expression of these genes may contribute to impaired germline integrity and mate recognition, ⁶⁵ which is consistent with the prolonged mating response times observed in PxPDK1 mutants.

PxPDK1 loss also triggered extensive metabolic reprogramming. Key enzymes involved in fatty acid synthesis and β‐oxidation, including FAS and HADH, were downregulated, consistent with the role of Akt signaling in promoting lipogenesis and energy storage. ⁶⁶ , ⁶⁷ Reduced Akt phosphorylation likely compromises lipid synthesis pathways, as observed in nutrient‐sensing circuits of Drosophila, where fat body‐derived signals regulate systemic growth via insulin/PI3K signaling. ⁶⁸ Downregulation of GALT, a central enzyme in galactose metabolism, further implicates impaired carbohydrate utilization in the observed developmental arrest. GALT deficiency is known to suppress PI3K/Akt signaling and broadly attenuate growth pathways. ⁶⁹ In lepidopteran insects, the IIS–PI3K/Akt axis serves as a master regulator of growth and metabolic coordination, ⁷⁰ suggesting that disruption of carbohydrate and lipid metabolism synergistically exacerbates growth defects in PxPDK1 mutants.

Disruption of chitin metabolism may contribute to the cuticular defects and molting failure observed. Chitin synthesis and degradation depend on precise regulation of CHS and chitinase (Cht) activity. ⁷¹ CHS1, in particular, is essential for cuticle formation and integrity, and its suppression leads to fragile epidermis and lethal molting defects. ⁷² The coordinated downregulation of CHS and Cht in PxPDK1 mutants predicts impaired cuticle synthesis and renewal, thereby linking PxPDK1‐dependent signaling to the ‘molting difficulty–eclosion failure’ phenotype.

Finally, heterologous expression of PxPDK1 in Sf9 cells significantly enhanced cell proliferation, providing direct functional evidence that PxPDK1 promotes growth at the cellular level. This proliferative effect is consistent with activation of the PI3K/Akt axis, in which PDK1 functions as a key upstream kinase and Akt serves as a central hub for growth control. ⁵ Together with the upregulation of FoxO observed in PxPDK1 mutants, these data strongly support a model in which PxPDK1 regulates insect growth and reproduction primarily through the conserved PI3K/Akt/FoxO signaling axis. ⁷³

In summary, our results demonstrate that PxPDK1 is an essential regulator of growth, development, reproduction, and metabolic homeostasis in P. xylostella. Loss of PxPDK1 attenuates PI3K/Akt signaling, disrupts downstream anabolic and metabolic networks, and compromises the energetic and biosynthetic demands required for normal development and fertility. These pleiotropic fitness costs suggest that inhibition or disruption of PDK1 (e.g., via RNA interference or chemical inhibitors) may substantially reduce pest population growth and damage potential. However, PDK1 may affect other AGC pathways, potentially generating broader pleiotropic effects that could complicate its development as a highly selective insecticidal target. Taken together, by integrating phenotypic, transcriptomic and mechanistic analyses, this study elucidates the central role of PxPDK1 in insect developmental biology and identifies this kinase as a promising molecular target for innovative pest management strategies.

However, it should be noted that the 27 bp deletion in the PxPDK1 mutant removes nine amino acids while preserving the ORF, raising the possibility that the mutant allele may retain partial protein function rather than constituting a complete loss‐of‐function. Sequence analysis localized the deleted residues to the conserved serine/threonine protein kinase domain (STKc_PDK1), which catalyzes the phosphorylation of threonine/serine residues on substrate proteins and serves as the core region essential for PDK1 kinase activity. Within the PI3K/Akt signaling pathway, PDK1 mediates the initial activation of Akt by phosphorylating its Thr308 residue. In agreement with this canonical role, we also observed reduced Akt phosphorylation and impaired PI3K/Akt signaling in the mutant. Nevertheless, the precise impact of this deletion on the catalytic activity of PxPDK1 awaits further determination through in vitro kinase assays or complementation experiments.

Furthermore, this study focused on PxPDK1 as a conserved upstream kinase in the PI3K/Akt pathway but did not compare it with other signaling nodes such as Akt or PI3K. We therefore recommend that future research use RNA interference or CRISPR technologies to conduct side‐by‐side comparative evaluations of multiple genes within this pathway, assessing their relative efficacy and safety as pest management targets. The functional characterization of PxPDK1 presented here provides a strong foundation for such future efforts.

CONFLICT OF INTEREST

The authors declare no competing interests.

AUTHOR CONTRIBUTIONS

SY, M Yan and LX designed the research. M Yan, LX, BL, JH and BC performed the research. M Yan and LX wrote the first draft. M You, YL, GG, JL and SY reviewed and edited the manuscript. SY acquired funding for the work. All authors have read and agreed to the published version of the manuscript.

Supporting information

Fig. S1. Bioinformatic analysis of the PxPDK1 protein. (A) Signal peptide prediction of PxPDK1. (B) Transmembrane domain prediction of PxPDK1. (C) Secondary structure prediction of PxPDK1. (D) Homology modeling of PxPDK1.

Fig. S2. Expression of PxPDK1 in different stages and tissues. (A) Relative expression level of PxPDK1 at various developmental stages. Egg, egg; 1 L‐4 L, first to fourth instar larva; P_E‐P_L, pre‐mid‐late pupa; F, female adult; M, male adult. (B, C) Tissue‐specific expression profiles of PxPDK1 in female (B) and male (C) adults. Ant, antenna; Hd, head; Cut, cuticle; Wg, wing; Leg, leg; ThM, thorax; MG, midgut; FB, fat body; Ova, ovary; AG, accessory gland; Tes, testis. Data are presented as mean values ± SE, one‐way ANOVA with Tukey's test was used for comparison.

Table S1. Primers used in this study.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.