Abstract
Background
Swainsonine (SW), the main toxic component of locoweed, can cause livestock poisoning and reproductive damage in male animals; however, the mechanism by which it affects testosterone secretion remains unclear.
Methods
Ten-week-old male C57BL/6 mice were orally administered SW at doses of 0, 0.05, and 0.25 mg/(kg·d) for 28 days. TM3 mouse Leydig cells were treated with SW at concentrations of 0, 1, and 10 nM for 24 h. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed on RNA-seq data from mouse testicular tissues to identify differentially enriched pathways between the control and SW-treated groups. Testosterone secretion levels were measured using an enzyme-linked immunosorbent assay (ELISA). The mRNA expression levels of steroidogenesis-related genes (StAR, Cyp11a1, Hsd3b2, and Hsd17b3) were detected by qPCR, while the expression of the steroidogenic acute regulatory (STAR) protein was detected by western blotting. AutoDock Vina molecular docking was used to predict the binding affinity between SW and the STAR protein.
Results
KEGG analysis revealed a significant enrichment of pathways related to steroid synthesis. In both the mouse model and TM3 cells, SW significantly inhibited testosterone secretion, downregulated the mRNA expression of StAR, Cyp11a1, Hsd3b2, and Hsd17b3, and reduced the protein expression of STAR. Molecular docking analysis revealed multiple potential hydrogen-bond interaction sites between SW and STAR.
Conclusion
SW downregulates the expression of steroidogenesis-related genes and STAR protein, thereby suppressing testosterone secretion in male mice and TM3 cells.
Keywords: mice, reproductive toxicity, Swainsonine, testosterone secretion, TM3
1. Introduction
Swainsonine (SW) is a trihydroxy indolizidine alkaloid and the primary toxic component of locoweed. Oxytropis ochrocephala (O. ochrocephala) Bunge, a common locoweed species distributed in the western grasslands of China, has remarkable adaptability to adverse environmental conditions, including cold temperatures, drought, salinity, alkalinity, and sand storms (1, 2). The common name “locoweed” refers to its toxic effects; ingestion of this plant leads to chronic neurological conditions in animals, which is characterized by a staggering gait and muscular incoordination (3). O. ochrocephala has a complex chemical composition that includes flavonoids, saponins, indolizidine alkaloids, quinolizidine alkaloids, and other compounds (2–6). These compounds exhibit diverse biological activities, including insecticidal, cytotoxic and antineoplastic properties (2, 4, 7). Previous studies have confirmed that the ingestion of plants containing SW can cause tissue damage in multiple organs and systems, including the reproductive, nervous, endocrine and immune systems, with the reproductive system being the most severely affected (8–10).
The reproductive performance of livestock has always been a key area of research because it is closely related to population sustainability and economic benefits. Current research indicates that grazing on locoweed leads to substantial early embryonic loss in both cattle and sheep (11). When pregnant ewes forage on locoweed, it causes fetal and placental dysplasia, and it may also trigger abnormal fetal fluid that leads to abortion (12, 13). Studies have demonstrated that rams that consume locoweed experience significant decreases in body weight, thyroxine concentration, testosterone levels, testicular size, and spermatogenesis (14).
Testosterone, secreted by Leydig cells, is a critical hormone in male reproductive physiology. It plays an essential role in the development and maintenance of secondary sexual characteristics and fertility. It is synthesized from cholesterol, which is transported into mitochondria by steroidogenic acute regulatory (STAR) protein, via a series of sequential enzymatic reactions catalyzed by cytochrome P450 family 11 subfamily A member 1 (CYP11A1), hydroxy-delta-5-steroid dehydrogenase, 3-beta delta-isomerase 2 (HSD3B2), and hydroxysteroid 17-beta dehydrogenase 3 (HSD17B3) (15). Research has shown that decreased testosterone levels can lead to a variety of adverse health outcomes, including sexual dysfunction, reduced energy levels, decreased muscle mass, mood disorders, altered bone mineral density, cardiovascular complications, depression, diminished sexual desire, erectile dysfunction, reduced ejaculatory volume, and loss of body and facial hair (16, 17).
Testosterone is essential for male physiological functions, and it is well documented that the consumption of locoweed suppresses testosterone secretion. However, the specific causative agent responsible for this effect has not yet been confirmed. Accordingly, this study was designed to assess the effect of SW, the primary toxic component of locoweed, on testosterone production in mouse testes and TM3 Leydig cells, with the aim of exploring the molecular basis underlying the observed reduction in testosterone secretion.
2. Materials and methods
2.1. Animals
All animal-handling procedures were approved by the Ethics Committee of Qinghai University, Qinghai, China (Approval No. SL-2022002). A total of 18 pubertal male C57BL/6J mice (6 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). After arrival and before the experiment, all mice were acclimated to the animal facility for 1 month to eliminate the effects of transportation and were housed under controlled temperature (22 °C−23 °C) and a standard 12-h light/12-h dark cycle. According to previous reports (8), mice were randomly divided into three groups with six mice in each group, and they received SW at doses of 0, 0.05, and 0.25 mg/(kg·d) by daily oral gavage. After 28 days, blood and testicular tissue samples were collected from the anesthetized mice. The testes were immediately snap-frozen in liquid nitrogen and then transferred to an ultra-low temperature freezer at −80 °C for storage until further analysis.
2.2. Cell cultures
TM3 cell lines (Mouse Leydig cells, ATCC CRL-1714, Washington, USA) were used in this experiment. The cells were cultured in DMEM-F/12 (DF12, Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% antibiotic-antimycotic (AA, Invitrogen, Carlsbad, CA, USA), and maintained in a 37 °C humidified atmosphere containing 5% CO2.
2.3. Measurement of cell proliferation and viability
TM3 cell viability was measured using a Cell Counting Kit-8 assay (CCK-8, Beyotime, Shanghai, China). Briefly, TM3 cells were seeded at a density of 2 × 103 cells per well in 96-well plates. The cells were treated with 100 μL of SW at gradient concentrations (0, 0.1, 1, 10, 100, 1,000 nM) for 24 h. After treatment, 10 μL of CCK-8 solution was added to each well, and the plates were incubated for an additional 2 h at 37 °C in a humidified 5% CO2 atmosphere. We compared the relative optical density of each treatment group to that of the untreated control group. Based on the assay results, 1 nM and 10 nM SW were selected for subsequent cell-based experiments, aligning with the treatment concentrations used in previous studies.
2.4. RNA-sequencing
Testicular tissues were collected from the NC group and the daily 0.25 mg/(kg·d) SW-treated group, with six biological replicates per group. Transcriptome sequencing was conducted by Beijing CapitalBio Technology with the Illumina NovaSeq 6,000 platform. After differential gene screening, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis and intergroup difference analysis were performed.
2.5. Testosterone assay
Blood was collected from the mice, and after 2 h of rest, serum was separated by centrifugation at 2,000 r/min for 10 min. Culture supernatants were collected at 24 h after SW treatment. Next, testosterone concentration was measured using commercial enzyme-linked immunosorbent assay (ELISA) kits (ABclonal, China) following the manufacturer's instructions. Fluorescence intensity was measured using a microplate reader at a wavelength of 450 nm. The minimum detectable concentration of testosterone was 0.02 ng/mL. The intra-assay and inter-assay coefficients of variation were less than 10% and 15%, respectively, and three biological replicates were performed for each treatment in each assay.
2.6. RNA extraction and real-time quantitative PCR (qPCR)
Testis tissue and TM3 cell samples from different treatment groups were collected, and total RNA was extracted using the TRIzol method (TaKaRa, Japan). The extracted RNA samples were diluted with RNase-free water (TianGen, China), and OD values and total RNA concentrations were measured using a biospectrophotometer (Thermo Fisher, USA). RNA integrity was detected via 2% agarose gel electrophoresis using a gel imaging system (Thermo Fisher, USA). A total of 1 μg of each qualified RNA sample was taken for reverse transcription into cDNA using the TaKaRa kit (TaKaRa, Japan). Appropriate qPCR primers were designed according to the mRNA sequences of steroidogenesis-related genes, and the primer sequences are shown in Table 1. The 20 μL reaction system used a SYBR (Synergetic binding reagent) Green Mix kit (TaKaRa, Japan), and samples mixed on ice were transferred away from light to the QuantStudio 6 Flex system (Thermo Fisher, USA); all reactions were performed in accordance with the operating instructions. Melting curve analysis was conducted after the reaction to verify the specificity of amplified products. Based on the Ct values of samples, relative quantification was performed using the 2−ΔΔCt method, with 36b4 as the reference gene. The effects of SW on the transcription levels of steroidogenesis-related genes were analyzed and compared.
Table 1.
Primer sequences.
| Names | GenBank accession no. | Primer sequences (5′-3′) | Product size (bp) |
|---|---|---|---|
| StAR | NM_011485.5 | F:TAAACTCACTTGGCTGCTCAGTATTG | 101 |
| R:GGTGGTTGGCGAACTCTATCTG | |||
| Hsd3b2 | NM_001359741.1 | F:CCAGGGCATCTCTGTTGTCAT | 105 |
| R:GGTTCTGGGTACCTTTCAGATTGA | |||
| Cyp11a1 | NM_019779.4 | F:AGGTCCTTCAATGAGATCCCTT | 137 |
| R:TCCCTGTAAATGGGGCCATAC | |||
| Hsd17b3 | NM_008291.3 | F:ATGAGCCCGTTTGCCTCTG | 244 |
| R:CCACAGGTAACAAGTCTTGGTC | |||
| 36b4 | NM_007475.5 | F:CTCACTGAGATTCGGGATAAG | 223 |
| R:CTCCCACCTTGTCTCCAGTC |
2.7. Protein extraction and western blotting (WB)
Total protein was extracted from testicular tissue and TM3 cells with RIPA (Radio immunoprecipitation assay) lysis buffer (Thermo Fisher, USA). Equal volumes of total cellular proteins were resolved using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis after determining the protein concentration using the BCA (Bicinchoninic acid) method and diluting to the corresponding concentration, and electrophoretically transferred onto PVDF (Polyvinylidene difluoride) membranes (Thermo Fisher, USA). After blocking with 10% skim milk (Solarbio, China) dissolved in Tris-buffered saline containing 0.1% Tween 20 (TBST) at 25 °C for 2 h, the membranes were incubated with primary antibodies diluted in TBST overnight at 4 °C, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies diluted in TBST at 4 °C for 2 h. Peroxidase activity was detected with an ECL hypersensitive solution kit (Thermo Fisher, USA). Immunoreactive bands were imaged with a Gel Image system (Bio-Rad Laboratories, USA) and digitized with Quantity One software (Bio-Rad Laboratories, USA). The primary antibodies used were rabbit anti-STAR (A22166, ABclonal, China; 1:1,000) and mouse anti-β-actin (TA-09, Zhongshan Jinqiao, China; 1:2,000). The secondary antibodies used were HRP-conjugated goat anti-rabbit (Zhongshan Jinqiao, China; 1:2,000) and HRP-conjugated goat anti-mouse (Zhongshan Jinqiao, China; 1:2,000).
2.8. Molecular docking
The crystal structures of the STAR candidate protein targets (PDB ID: 1JSS) were retrieved from the RCSB Protein Data Bank (https://www.rcsb.org/) and subsequently modified using Autodock Tools 1.5.6 software: Scripps Research Institute, La Jolla, CA, USA, which involved removing ligands and water molecules, adding hydrogen atoms, and assigning Gasteiger partial charges. The 3D structural files of the SW (PubChem CID: 51683) were obtained from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/). The structural files were imported into ChemBio3D software and subjected to energy minimization using the MMFF94 force field to relieve spatial strain. All files were saved in the “PDBQT” format and subsequently imported into AutoDock Vina 1.2.0 for global blind docking, with the docking box defined by the following parameters: center_x = 41.699, center_y = 9.705, center_z = 26.956; dimensions: size_x = 47.25, size_y = 47.25, size_z = 46.5; and the grid spacing is 0.375 Å. The exhaustiveness parameter was set to 128 to improve the completeness of conformational sampling. After docking is complete, the software automatically outputs binding poses ranked by binding free energy from lowest to highest. Generally, a binding energy below −5 kcal/mol is accepted as the criterion for a potentially stable interaction. The five conformations with the lowest binding energies were selected as candidate binding poses, and for each conformation, the number of hydrogen bonds, bond lengths (in Å), and the involved amino acid residues were recorded. Finally, the molecular docking results were visualized using PyMOL software (18).
2.9. Data and statistical analyses
All data are expressed as the Mean ± SD. Statistical analyses were performed using one-way analysis of variance (ANOVA) with GraphPad Prism 7.0: GraphPad Software San Diego, CA, USA. Transcriptome sequencing data were analyzed using R 4.2.2: R Foundation for Statistical Computing, Vienna, Austria. (R Foundation for Statistical Computing). Differences were considered significant at a P-value of < 0.05. Statistical power analysis was conducted to calculate the number of animals required to detect significant differences.
3. Results
3.1. Transcriptome sequencing revealed that SW impairs steroid hormone biosynthesis in male mice
To elucidate the impact of SW on testicular function in male mice, transcriptomic profiling was performed on testicular tissues obtained from both the control and SW-treated groups. Differentially expressed genes (DEGs) in mouse testes were identified based on fold change (log2FC > 1.0) and significance (P < 0.05). As shown in the statistical bar chart (Figure 1A), a total of 506 DEGs were identified: after SW treatment, 286 genes were significantly upregulated, and 220 genes were downregulated. The volcano plot (Figure 1B) further illustrates the expression variation and statistical significance of all detected genes: red dots represent significantly upregulated DEGs, blue dots indicate significantly downregulated DEGs, and gray dots denote genes with no significant difference in expression. We then performed KEGG enrichment analysis on these DEGs, and the top 20 most significantly enriched pathways are shown in Figure 1C, covering key research areas including energy metabolism, autophagy, the cell cycle, and the mTOR and AMPK signaling pathways. Steroid hormones secreted by the testes are critical reproductive hormones in male animals, playing pivotal roles in population reproduction and economic productivity. Accordingly, we focused our analysis on the steroid hormone biosynthesis pathway. KEGG enrichment analysis showed that the DEGs in testes were mainly enriched in the steroid hormone biosynthesis pathway (Figure 1C). Among these DEGs, the upregulated genes included Cyp1b1, Cyp2c29, Cyp2e1, and others, while the downregulated genes included H2-Ke6, Cyp21a1, Hsd3b6, and others.
Figure 1.
Differential gene expression in the testicles of mice. Testicular tissues were obtained from the NC group and mice fed with SW at a dose of 0.25 mg/(kg·d). (A) Numbers and (B) volcano plots of differential genes in the testis. (C) Top 20 KEGG pathways enriched in differential genes in the testis (n = 6).
3.2. SW inhibited testosterone levels and the expression of steroidogenic genes and protein in male mice
To confirm the findings from transcriptome sequencing, serum testosterone levels were quantified by ELISA in the NC group and in groups treated with SW at doses of 0.05 mg/(kg·d) and 0.25 mg/(kg·d). As shown in Figure 2A, compared with the NC group, serum testosterone levels in the 0.05 mg/(kg·d) and 0.25 mg/(kg·d) groups were significantly decreased (P < 0.001). Additionally, serum testosterone in the 0.25 mg/(kg·d) group was significantly lower than that in the 0.05 mg/(kg·d) group (P < 0.001). Testosterone is synthesized from steroid precursors through a cascade of reactions mediated by steroidogenic genes including StAR, Cyp11a1, Hsd3b2, and Hsd17b3. In the 0.05 mg/(kg·d) SW-treated group, the expression levels of StAR (P < 0.05), Cyp11a1 (P < 0.05), Hsd3b2 (P < 0.01), and Hsd17b3 (P < 0.001) were significantly lower than those in the NC group. Notably, compared with the NC group, 0.25 mg/(kg·d) SW significantly suppressed the relative expression of all four genes, with all differences reaching statistical significance (P < 0.001). Furthermore, compared with the 0.05 mg/(kg·d) group, the 0.25 mg/(kg·d) group showed significant decreases in the expression of StAR (P < 0.001), Cyp11a1 (P < 0.05), Hsd3b2, and Hsd17b3 (P < 0.01), as presented in Figure 2B. WB analysis further corroborated this trend, demonstrating a significant reduction in STAR protein levels in the testes of mice treated with 0.05 mg/(kg·d) SW (P < 0.001) and 0.25 mg/(kg·d) SW (P < 0.001) compared with the NC group. The STAR protein level in the 0.25 mg/(kg·d) group was also significantly lower than that in the 0.05 mg/(kg·d) group (P < 0.05), as shown in Figures 2C, D. We therefore conclude that SW reduces testosterone secretion in mice by downregulating steroidogenesis-related genes and proteins.
Figure 2.
Effect of Swainsonine on testosterone synthesis in mice. Testes and serum samples were collected from mice in the control group, low-dose group, and high-dose group that were fed SW (0, 0.05, and 0.25 mg/(kg·d), respectively) after the completion of the modeling period. (A) Serum testosterone levels were measured using an ELISA kit. (B) Total RNA was extracted from testis tissues, and mRNA levels of steroidogenesis-related genes were quantified by qPCR. (C) STAR levels were examined through western blotting. (D) The ratio of the levels of STAR and β-actin was determined from the densities of the immunoreactive bands. Data shoulder mark * indicates significant difference (P < 0.05), ** indicates significant difference (P < 0.01), *** indicates significant difference (P < 0.001), and no asterisk indicates no significant difference (P > 0.05); The data are displayed as mean ± standard deviation (n = 3).
3.3. SW inhibited testosterone levels and the expression of steroidogenic genes and proteins in TM3 cells
TM3 cells, derived from mouse Leydig cells, stably express genes involved in steroid synthesis and secrete testosterone, making them a valuable tool for investigating testosterone secretion. Based on cell viability results (Supplementary Figure S1), we selected 1 and 10 nM as the optimal concentrations for treating TM3 cells with SW to conduct subsequent experiments. Supernatant and TM3 cells were collected after 24 h of treatment with SW at 0 nM (NC), 1 nM, or 10 nM. Compared to the NC group, testosterone levels in the supernatant were significantly reduced in the 1 nM (P < 0.01) and 10 nM (P < 0.001) groups, with the 10 nM group showing a statistically greater reduction in testosterone than the 1 nM group (P < 0.001) (Figure 3A). The expression of genes related to steroidogenesis was detected. The results showed that compared to the NC group, significant reductions in StAR, Cyp11a1, and Hsd17b3 were observed in the 1 nM group (P<0.05), while highly significant reductions in StAR (P < 0.001), Cyp11a1 (P < 0.001), Hsd3b2 (P < 0.01), and Hsd17b3 (P < 0.01) were found in the 10 nM group. Additionally, compared with the 1 nM group, significant decreases in Hsd3b2 (P < 0.01) and Hsd17b3 (P < 0.05) were observed in the 10 nM group (Figure 3B). The STAR protein levels showed a similar trend. Compared with the NC group, STAR protein levels were significantly decreased in the 1 nM group (P < 0.05) and the 10 nM group (P < 0.01). Furthermore, STAR protein levels were lower in the 10 nM group than in the 1 nM group, although this difference did not reach statistical significance (Figures 3C, D). Collectively, these findings demonstrate that SW exposure modulates STAR protein expression levels in TM3 cells in a concentration-dependent manner. These data suggest that SW reduces testosterone secretion in TM3 cells by downregulating steroidogenesis-related genes and the STAR protein.
Figure 3.
Effect of Swainsonine on testosterone synthesis in TM3. (A) The supernatant testosterone levels were measured using an ELISA kit. (B) Total RNA was extracted from TM3 cells, and the mRNA levels of steroidogenesis-related genes were quantified by qPCR. (C) Representative images of STAR protein levels detected by western blotting. (D) The ratio of the levels of STAR and β-actin was determined from the densities of the immunoreactive bands. Data marked with * indicate significant difference (P < 0.05), ** indicates significant difference (P < 0.01), *** indicates significant difference (P < 0.001), and no asterisk indicates no significant difference (P > 0.05). The data are displayed as mean ± standard deviation (n = 3).
3.4. Molecular docking predicted a potential interaction between SW and the STAR protein
In this study, molecular docking was performed between SW and STAR to investigate the mechanism by which SW affects STAR. The top five binding sites with the highest affinity are presented, where lower binding energy indicates stronger binding capacity. The predicted binding energies of SW and STAR were all below −5 kcal/mol (Table 2), suggesting a strong binding potential. SW was found to interact with STAR through multiple hydrogen bonds, with key binding residues including Ser136, Ser147, Arg92, and Cys148 (Table 2 and Figure 4). Therefore, SW is might to interact with the STAR protein through this potential binding mode.
Table 2.
Molecular docking results of Swainsonine with the STAR protein were obtained.
| Binding site | Connected residues | Hydrogen bond number | Docking scores (kcal/Mol) |
|---|---|---|---|
| 1 | SER136, CYS148 | 3 | −6.2 |
| 2 | ARG92, SER136, SER147, CYS148 | 4 | −6.1 |
| 3 | ARG92, TRP171 | 3 | −5.8 |
| 4 | ILE86, ARG92, SER147 | 4 | −5.6 |
| 5 | ASN65, LEU193, GLN199 | 3 | −5.6 |
Figure 4.
Computational simulation of the binding modes between Swainsonine and the STAR protein was visualized. (A) The general locations of the top five binding sites with the highest binding energies are displayed as follows: Top1 in red, Top2 in yellow, Top3 in blue, Top4 in green, and Top5 in cyan. (B–F) The schematic illustrates Top1–Top5, where yellow represents Swainsonine, pink denotes the residues interacting with Swainsonine, and their names are labeled adjacent to them. The white connecting lines between pink and yellow indicate hydrogen bonds, with the numerical values above the lines representing the bond lengths (Unit: Ångströms, Å).
4. Discussion
SW is a characteristic toxic alkaloid produced by locoweeds, including plant species in the genus Oxytropis. When livestock ingest locoweed over a long period, it causes multi-system damage to the nervous, endocrine, and reproductive systems. A typical symptom of intoxication in male animals is reduced testosterone levels and impaired reproductive performance. Previous studies have only observed decreased serum testosterone in rams fed roughage containing locoweed, but could not distinguish the effects of individual plant components (13). To date, the molecular mechanism by which the SW monomer regulates testosterone synthesis in male animals remains unclear. In this study, we established both a subchronic in vivo exposure model using adult male mice and an in vitro model using TM3 mouse Leydig cells. By integrating testicular transcriptome sequencing, quantification of key steroidogenic molecules, and AutoDock Vina molecular docking, we systematically elucidated the complete molecular pathway through which SW inhibits testosterone secretion.
After 28 days of feeding, we collected testes from mice in the NC group and the 0.25 mg/(kg d) SW-treated group and performed RNA transcriptome sequencing. The results showed that a large number of differentially expressed genes were identified in mouse testes between the control and SW-treated groups. KEGG enrichment analysis revealed significant differences in the steroid biosynthesis pathway, mTOR signaling pathway, and AMPK signaling pathway, all of which play critical roles in male reproduction. Among the enriched genes, Hsd3b6, a member of the 3β-hydroxysteroid dehydrogenase family that catalyzes a key step in steroid synthesis (19), was significantly downregulated. This indicates that Hsd3b6 is the primary target of the steroidogenic process in SW-induced testicular injury.
Testosterone, the primary steroid secreted by the testes, is critical to male reproductive health and serves as a core indicator of male reproductive potential. It plays an essential role in driving male genital development and facilitating (20), stimulates the development of secondary sexual characteristics that help males compete for mates and attract (21–23) partners, and supports mating-related behaviors by boosting libido and aggression in reproductive contexts (24, 25). Previous studies have found that testosterone levels decrease in rams after ingestion of locoweed (14). Our study further demonstrated that SW reduces testosterone levels in both mice and TM3 Leydig cells in a dose-dependent manner, confirming that SW acts directly on Leydig cells rather than indirectly inhibiting testosterone secretion through the hypothalamic-pituitary-testicular axis (26). Gonadotropin-releasing hormone (GnRH), secreted by the hypothalamus, stimulates the pituitary gland to synthesize and release luteinizing hormone (LH) (20, 27). LH binds to the luteinizing hormone receptor on Leydig cells and promotes testosterone biosynthesis by enabling STAR to transport cholesterol into mitochondria. Cholesterol is rapidly converted to pregnenolone by the CYP11A1 enzyme located on the inner mitochondrial membrane. Pregnenolone then enters the endoplasmic reticulum, where a series of enzymatic reactions catalyzed by HSD3B2 and HSD17B3 ultimately convert it into testosterone (15).
Previous studies have reported similar regulatory patterns. Fluoride simultaneously downregulates StAR, Cyp11a1, Hsd3b2, and Hsd17b3, which is consistent with the toxicity pattern of SW (27, 28). Arsenic epigenetically inhibits StAR through histone acetylation (29). Protective trace elements (selenium and silicon), upregulate the complete set of steroidogenic genes and completely antagonize the inhibitory effects of SW (30, 31). Trace mineral elements and plant-derived alkaloid toxins exert bidirectional, opposing regulatory effects on Leydig cell function (32). Locoweed fed to cows temporarily alters ovarian function, increases estrous cycle length, alters reproductive behavior, reduces conception rates, and leads to birth defects in offspring (33). SW can induce apoptosis in goat luteal cells and trophoblast cells, interfere with progesterone and estradiol secretion, and cause estrus disorders, embryo implantation failure, and abortion in female livestock (9, 34, 35). Consistent with previous studies, our study found that SW reduces testosterone secretion and downregulates the expression levels of StAR, Cyp11a1, Hsd3b2, and Hsd17b3 mRNA, as well as STAR protein in mice and mouse Leydig cells. These findings demonstrate that SW inhibits testosterone secretion by suppressing the expression of steroidogenesis-related genes and proteins in mouse testes.
To further explore the underlying molecular mechanism, we conducted molecular docking simulations. The results showed that SW can form hydrogen bonds with residues such as Ser136, Arg92, and Cys148 of the STAR protein. The binding energies of the top five binding conformations were all less than −5 kcal/mol, indicating a stable binding potential. STAR is a nuclear-encoded, mitochondria-targeted protein. Following its phosphorylation and activation in the cytoplasm at human Ser195 or murine Ser194 and Ser232, STAR translocates into mitochondria (36–38). Within mitochondria, STAR facilitates cholesterol transport to the inner mitochondrial membrane, where it is converted to pregnenolone, the precursor for all steroid hormones. However, unphosphorylated STAR in the cytoplasm is rapidly degraded (39). Based on these findings and our sequencing results, we hypothesize that SW binds to STAR and inhibits its phosphorylation-dependent activation, which reduces the efficiency of cholesterol transport. Additionally, SW may also suppress StAR gene transcription by disrupting testicular transcriptome signaling (through the mTOR/AMPK pathway), ultimately leading to decreased mRNA synthesis (40). However, molecular docking is only a static computational simulation and cannot replicate the dynamic physiological conditions inside cells, such as intracellular pH, accessory proteins, and the lipid microenvironment. At present, this conclusion remains only a theoretical inference and requires direct biochemical verification through assays such as SPR and cellular STAR overexpression rescue experiments.
This study is the first to demonstrate that the SW is the core toxic substance responsible for locoweed-induced testosterone reduction and reproductive decline in males. This finding clarifies the difference between the combined toxicity of multiple locoweed components and the independent reproductive damage caused by SW. From a grazing management perspective, breeding males, including rams and bulls, must be strictly managed to prevent them from ingesting locoweed. Even long-term exposure to low doses of SW can persistently suppress testosterone secretion, impair mating ability, and ultimately reduce the reproductive efficiency of an entire herd. This study also defines clear targets for developing detoxification agents for locoweed poisoning and protective additives for male reproduction. The reproductive toxicity data obtained from multiple dose gradients in this study can provide toxicological support for hazard classification of locoweed in western grasslands and the formulation of regional grazing management standards, which in turn will help reduce economic losses in pastoral livestock production.
We identified key differentially expressed genes in the testes of SW-exposed mice, analyzed their enriched pathways, and paid special attention to pathways related to steroid synthesis. Our experimental results confirmed that SW suppresses testosterone secretion in both mice and TM3 cells. Furthermore, SW may suppress the phosphorylation-dependent activation of STAR, consequently blocking cholesterol translocation into mitochondria. In conclusion, this study demonstrates that SW inhibits testosterone secretion by downregulating the expression of steroidogenesis-related genes and the STAR protein in mouse Leydig cells (Figure 5).
Figure 5.
Diagram of the pathway by which Swainsonine regulates testosterone secretion in male mice.
Funding Statement
The author(s) declared that financial support was received for this work and/or its publication. This research was supported by National Natural Science Foundation of China (No.32260907), the Project of Qinghai Provincial Department of Science and Technology (2025-NK-P02) and the Haixi Prefecture Science and Technology Bureau Project in Qinghai Province (2024-ZD-Q02).
Edited by: Ling Yang, Hebei University of Engineering, China
Reviewed by: Huang Liu, Guangdong Provincial Reproductive Science Institute (Guangdong Provincial Fertility Hospital), China
Owona Pascal Emmanuel, University of Yaounde I, Cameroon
Abbreviations: StAR, Steroidogenic acute regulatory protein; Cyp11a1, Cytochrome P450 family 11 subfamily A member 1; Hsd3b2, Hydroxy-delta-5-steroid dehydrogenase, 3-beta delta-isomerase 2; Hsd17b3, Hydroxysteroid 17-beta dehydrogenase 3; NC, Negative control; ELISA, Enzyme-linked immunosorbent assay; qPCR, Real-time quantitative PCR; SW, Swainsonine; WB, Western blotting; CCK8, Cell counting kit-8; KEGG, Kyoto encyclopedia of genes and genomes; DEGs, Differentially expressed genes; GnRH, Gonadotrophin-releasing hormone; LH, Luteinizing hormone.
Data availability statement
The data presented in the study are deposited in the RCSB Protein Data Bank (https://www.rcsb.org/)(accession number 1JSS) and the PubChem database (https://pubchem.ncbi.nlm.nih.gov/) (accession number 51683).
Ethics statement
The animal study was approved by Ethics Committee of Qinghai university. The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
ZC: Writing – original draft, Data curation, Methodology, Software. YZhou: Data curation, Visualization, Formal analysis, Writing – original draft. XH: Software, Data curation, Writing – original draft. JiamL: Writing – original draft, Validation. YZhao: Data curation, Writing – original draft. JiayL: Writing – original draft, Data curation. SS: Data curation, Writing – original draft. YG: Data curation, Writing – original draft. JH: Writing – review & editing. DY: Writing – review & editing. LG: Writing – review & editing, Funding acquisition, Conceptualization.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that Generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher's note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fvets.2026.1912572/full#supplementary-material
References
- 1.Hu X, Liu Y, Chen J, Su X. The complete chloroplast genome of Oxytropis ochrocephala Bunge 1874 (Fabaceae) and its phylogenetic analysis. Mitochondrial DNA Part B. (2024) 9:641–6. doi: 10.1080/23802359.2024.2350626 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Liu LN, Ran JQ, Li LJ, Zhao Y, Goto M, Morris-Natschke SL, et al. Ochrocephalamine A, a new quinolizidine alkaloid from Oxytropis ochrocephala Bunge. Tetrahedron Lett. (2016) 57:5047–9. doi: 10.1016/j.tetlet.2016.10.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Molyneux RJ, James LF. Loco intoxication: indolizidine alkaloids of spotted locoweed (Astragalus lentiginosus). Science. (1982) 216:190–1. doi: 10.1126/science.6801763 [DOI] [PubMed] [Google Scholar]
- 4.Zhou KS, Yi P, Yang T, Tian W, Yang FM, Lee KH, et al. Ochrocephalamines B–D, three alkaloids from Oxytropis ochrocephala Bunge. Org Lett. (2019) 21:5051–4. doi: 10.1021/acs.orglett.9b01643 [DOI] [PubMed] [Google Scholar]
- 5.Li X, Zhang SD, Jin HZ, Dong F, Shan L, Zhang WD, et al. A new flavonol from Oxytropis ochrocephala Bunge. Nat Prod Res. (2013) 27:554–7. doi: 10.1080/14786419.2012.678350 [DOI] [PubMed] [Google Scholar]
- 6.Sun RQ, Jia ZJ, Cheng DL, Zhu ZQ. Four saponins from Oxytropis ochrocephala. Planta Med. (1992) 58:211–3. doi: 10.1055/s-2006-961432 [DOI] [PubMed] [Google Scholar]
- 7.Tan C, Zhao Y, Goto M, Hsieh KY, Yang X, Morris-Natschke SL, et al. Alkaloids from Oxytropis ochrocephala and antiproliferative activity of sophoridine derivatives against cancer cell lines. Bioorg Med Chem Lett. (2016) 26:1495–7. doi: 10.1016/j.bmcl.2015.09.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Fu K, Chen X, Shou N, Wang Z, Yuan X, Wu D, et al. Swainsonine induces liver inflammation in mice via disturbance of gut microbiota and bile acid metabolism. J Agric Food Chem. (2023) 71:1758–67. doi: 10.1021/acs.jafc.2c08519 [DOI] [PubMed] [Google Scholar]
- 9.Huang Y, Dong F, Du Q, Zhang H, Luo X, Song X, et al. Swainsonine induces apoptosis through mitochondrial pathway and caspase activation in goat trophoblasts. Int J Biol Sci. (2014) 10:789–97. doi: 10.7150/ijbs.9168 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Stegelmeier BL, James F. The lesions of locoweed (Astragalus mollissimus), swainsonine, and castanospermine in rats. Vet Pathol. (1995) 32:289–98. doi: 10.1177/030098589503200311 [DOI] [PubMed] [Google Scholar]
- 11.Wu C, Han T, Lu H, Zhao B. The toxicology mechanism of endophytic fungus and swainsonine in locoweed. Environ Toxicol Pharmacol. (2016) 47:38–46. doi: 10.1016/j.etap.2016.08.018 [DOI] [PubMed] [Google Scholar]
- 12.Van Kampen KR, James LF. Ovarian and placental lesions in sheep from ingesting locoweed (Astragalus lentiginosus). Vet Pathol. (1971) 8:193–9. doi: 10.1177/030098587100800301 [DOI] [PubMed] [Google Scholar]
- 13.Ortiz AR, Hallford DM, Galyean ML. Schneider FA, Kridli R.T. Effects of locoweed (Oxytropis sericea) on growth, reproduction, and serum hormone profiles in young rams J Anim Sci. (1997) 75:3229. doi: 10.2527/1997.75123229x [DOI] [PubMed] [Google Scholar]
- 14.Chenchen W, Wenlong W, Xiaoxue L, Feng M, Dandan C, Xiaowen Y, et al. Pathogenesis and preventive treatment for animal disease due to locoweed poisoning. Environ Toxicol Pharmacol. (2014) 37:336–47. doi: 10.1016/j.etap.2013.11.013 [DOI] [PubMed] [Google Scholar]
- 15.Payne AH, Hales DB. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr Rev. (2004) 25:947–70. doi: 10.1210/er.2003-0030 [DOI] [PubMed] [Google Scholar]
- 16.Bassil N, Mb JEM. Late-life onset hypogonadism: a review. Clin Geriatr Med. (2010) 26:197–222. doi: 10.1016/j.cger.2010.02.003 [DOI] [PubMed] [Google Scholar]
- 17.Mulligan T, Frick MF, Zuraw QC, Stemhagen A, Mcwhirter C. Prevalence of hypogonadism in males aged at least 45 years: the HIM study. Int J Clin Pract. (2008) 60:762–9. doi: 10.1111/j.1742-1241.2006.00992.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Eberhardt J, Santos-Martins D, Tillack AF, Forli S. AutoDock Vina 120: New docking methods, expanded force field, and python bindings. J Chem Inf Model. (2021) 61:3891–8. doi: 10.1021/acs.jcim.1c00203 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lin H, Hu GX, Dong L, Dong Q, Mukai M, Chen BB, et al. Increased proliferation but decreased steroidogenic capacity in Leydig cells from mice lacking cyclin-dependent kinase inhibitor 1B. Biol Reprod. (2009) 80:1232–38. doi: 10.1095/biolreprod.108.074229 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Liang HY, Peng F, Pan MJ, Liao SL, Wei C, Wei GY, et al. Exosomes derived from BMSCs ameliorate cyclophosphamide-induced testosterone deficiency by enhancing the autophagy of Leydig cells via the AMPK-mTOR signaling pathway. Asian J Androl. (2023) 25:474–83. doi: 10.4103/aja202286 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Bribiescas RG. Reproductive ecology and life history of the human male. Am J Phys Anthropol. (2001) 116:148–76. doi: 10.1002/ajpa.10025 [DOI] [PubMed] [Google Scholar]
- 22.Kemnitz JW, Sladky KK, Flitsch TJ, Pomerantz SM, Goy RW. Androgenic influences on body size and composition of adult rhesus monkeys. Am J Physiol Endocrinol Metab. (1988) 255:E857–64. doi: 10.1152/ajpendo.1988.255.6.E857 [DOI] [PubMed] [Google Scholar]
- 23.Setchell JM, Smith T, Wickings EJ, Knapp LA. Social correlates of testosterone and ornamentation in male mandrills. Horm Behav. (2008) 54:365–72. doi: 10.1016/j.yhbeh.2008.05.004 [DOI] [PubMed] [Google Scholar]
- 24.Archer J. Testosterone and human aggression: an evaluation of the challenge hypothesis. Neurosci Biobehav Rev. (2006) 30:319–45. doi: 10.1016/j.neubiorev.2004.12.007 [DOI] [PubMed] [Google Scholar]
- 25.Isidori AM, Giannetta E, Gianfrilli D, Greco EA, Bonifacio V, Aversa A, et al. Effects of testosterone on sexual function in men: results of a meta-analysis. Clin Endocrinol. (2005) 63:381–94. doi: 10.1111/j.1365-2265.2005.02350.x [DOI] [PubMed] [Google Scholar]
- 26.Kaprara A, Huhtaniemi IT. The hypothalamus-pituitary-gonad axis: tales of mice and men. Metabolism. (2018) 86:3–17. doi: 10.1016/j.metabol.2017.11.018 [DOI] [PubMed] [Google Scholar]
- 27.Acevedo-Rodriguez A, Kauffman AS, Cherrington BD, Borges CS, Roepke TA, Laconi M. Emerging insights into hypothalamic-pituitary-gonadal axis regulation and interaction with stress signaling. J Neuroendocrinol. (2018) 30:e12590. doi: 10.1111/jne.12590 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Talebi SF, Seify M, Bhandari RK, Shoorei H, Oskuei SD. Fluoride-induced testicular and ovarian toxicity: evidence from animal studies. Biol Res. (2025) 58:6. doi: 10.1186/s40659-025-00586-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Rachamalla M, Chinthada J, Kushwaha S, Putnala SK, Sahu C, Jena G, et al. Contemporary comprehensive review on arsenic-induced male reproductive toxicity and mechanisms of phytonutrient intervention. Toxics. (2022) 10:744. doi: 10.3390/toxics10120744 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Zhao H, Zhu Y, Zhao Y, Wang T, Li H, Yang J, et al. Alleviating effects of selenium on fluoride-induced testosterone synthesis disorder and reproduction toxicity in rats. Ecotoxicol Environ Saf. (2022) 247:114249. doi: 10.1016/j.ecoenv.2022.114249 [DOI] [PubMed] [Google Scholar]
- 31.Yuan D, Shen K, Dong X, Yang Y, Wang B, Feng X, et al. Selenium improves arsenic-induced male reproductive dysfunction by regulating H3K14ac level. Biol Trace Elem Res. (2024). doi: 10.1007/s12011-024-04392-1 [DOI] [PubMed] [Google Scholar]
- 32.Ren XM, Wang GG, Xu DQ, Luo K, Liu YX, Zhong YH, et al. The protection of selenium on cadmium-induced inhibition of spermatogenesis via activating testosterone synthesis in mice. Food Chem Toxicol. (2012) 50:3521–9. doi: 10.1016/j.fct.2012.07.021 [DOI] [PubMed] [Google Scholar]
- 33.Panter K, Ralphs M, James L, Stegelmeier B, Molyneux R. Effects of locoweed (Oxytropis sericea) on reproduction in cows with a history of locoweed consumption. Vet Hum Toxicol. (1999) 41:282–6. [PubMed] [Google Scholar]
- 34.Huang Y, Li W, Zhao X, Ding L, Yu G, Dong F, et al. Swainsonine differentially affects steroidogenesis and viability in caprine luteal cells in vitro. Theriogenology. (2013) 80:41–9. doi: 10.1016/j.theriogenology.2013.03.007 [DOI] [PubMed] [Google Scholar]
- 35.Wu C, Feng K, Lu D, Yan D, Han T, Zhao B. Reproductive toxicities caused by swainsonine from locoweed in mice. BioMed Res Int. (2016) 2016:1–9. doi: 10.1155/2016/6824374 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Arakane F, King SR, Du Y, Kallen CB, Walsh LP, Watari H, et al. Phosphorylation of steroidogenic acute regulatory protein (StAR) modulates its steroidogenic activity. J Biol Chem. (1997) 272:32656–62. doi: 10.1074/jbc.272.51.32656 [DOI] [PubMed] [Google Scholar]
- 37.Duarte A, Castillo AF, Podestá EJ, Poderoso C. Mitochondrial fusion and ERK activity regulate steroidogenic acute regulatory protein localization in mitochondria. PLoS ONE. (2014) 9:e100387. doi: 10.1371/journal.pone.0100387 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Sasaki G, Zubair M, Ishii T, Mitsui T, Hasegawa T, Auchus RJ. The contribution of serine 194 phosphorylation to steroidogenic acute regulatory protein function. Mol Endocrinol. (2014) 28:1088–96. doi: 10.1210/me.2014-1028 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Bose M, Whittal RM, Miller WL, Bose HS. Steroidogenic activity of StAR requires contact with mitochondrial VDAC1 and phosphate carrier protein. J Biol Chem. (2008) 283:8837–45. doi: 10.1074/jbc.M709221200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Tremblay JJ. Molecular regulation of steroidogenesis in endocrine leydig cells. Steroids. (2015) 103:3–10. doi: 10.1016/j.steroids.2015.08.001 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data presented in the study are deposited in the RCSB Protein Data Bank (https://www.rcsb.org/)(accession number 1JSS) and the PubChem database (https://pubchem.ncbi.nlm.nih.gov/) (accession number 51683).