MYC Addiction as a Targetable Vulnerability in Nelarabine‐Resistant T‐Cell Acute Lymphoblastic Leukemia

Jingjing Gao; Chunxu Lin; Suchang Chen; Qi Mo; Chu Bao; Huali Deng; Ziyin Chen; Weichao Hao; Luyong Zhang; Min Wei

doi:10.1111/cas.70382

. 2026 Apr 8;117(6):1608–1622. doi: 10.1111/cas.70382

MYC Addiction as a Targetable Vulnerability in Nelarabine‐Resistant T‐Cell Acute Lymphoblastic Leukemia

Jingjing Gao ¹, Chunxu Lin ², Suchang Chen ¹, Qi Mo ¹, Chu Bao ¹, Huali Deng ¹, Ziyin Chen ¹, Weichao Hao ^3,^4,^✉, Luyong Zhang ^1,^5,^✉, Min Wei ^1,^✉

PMCID: PMC13580862 PMID: 41947770

ABSTRACT

Acquired resistance represents a fundamental obstacle limiting the long‐term efficacy of cancer chemotherapy. In T‐cell acute lymphoblastic leukemia (T‐ALL), the nucleoside analog prodrug nelarabine is a critical salvage therapy for relapsed/refractory (R/R) patients; however, resistance is common and rapid, worsening prognosis. The molecular mechanisms underlying this process remain largely to be elucidated. Here, we identify the oncogene MYC as a key functional mediator driving nelarabine resistance. Through unbiased transcriptomic profiling and functional validation, we demonstrate that nelarabine‐resistant T‐ALL cells develop a profound addiction to a hyperactive MYC transcriptional program. Critically, MYC knockdown restores nelarabine sensitivity, causally linking MYC to the resistant phenotype. While this discovery reveals a therapeutic vulnerability, MYC itself is considered an ‘undruggable’ protein, making direct inhibition a formidable challenge. We therefore pursued an indirect strategy, employing BET family protein degraders to dismantle the upstream epigenetic machinery essential for MYC transcription. Consistent with a MYC‐driven mechanism, treatment with ARV‐771 and ARV‐825 induced potent degradation of BET proteins, suppressed MYC transcription, and profoundly impaired the viability and proliferation of nelarabine‐resistant cells. Importantly, this strategy showed strong therapeutic efficacy in an in vivo model of nelarabine‐resistant T‐ALL, significantly reducing leukemia burden and extending survival. Our work establishes the first mechanistic link between nelarabine resistance and MYC dependency, providing a compelling preclinical rationale and therapeutic strategy to overcome this challenge. Collectively, this study offers a paradigm for reversing chemotherapy resistance by exploiting acquired transcriptional addictions.

Trial Registration: Registry and the Registration No. of the study/trial. Yes, approved number: IRB Approval No.: Med‐Ethics [2026] IIT No. (19)

Keywords: acute lymphoblastic leukemia, BET, MYC, nelarabine resistance, T‐ALL

MYC drives nelarabine resistance in T‐ALL via a hyperactive transcriptional program. Pharmacological degradation of BET proteins dismantles this addiction, restoring drug sensitivity and extending survival in vivo.

graphic file with name CAS-117-1608-g007.webp

Abbreviations

BET: Bromodomain and extra‐terminal
IC50: Half‐inhibitory concentrations
NSG: Non‐obese diabetic/severe combined Immunodeficiency/Interleukin‐2 receptor γ chain‐deficient
R/R: relapsed and refractory
RT‐qPCR: Quantitative reverse transcription polymerase chain reaction
T‐ALL: T‐cell acute lymphoblastic leukemia

1. Introduction

Acquired drug resistance represents a fundamental barrier to durable responses in cancer therapy and a primary cause of patient mortality [1, 2, 3, 4]. Cancer cells exhibit a remarkable capacity to adapt and evolve under therapeutic pressure, often by hijacking core cellular programs to bypass drug‐induced cytotoxicity [5]. Elucidating the molecular mechanisms that underpin this adaptive resistance is therefore a critical objective in oncology, as it provides the essential blueprint for designing rational second‐line therapies and strategies to prevent relapse [6, 7]. While much attention has been focused on resistance to targeted kinase inhibitors, the mechanisms driving resistance to conventional chemotherapies, which remain the backbone of treatment for many hematologic malignancies, are often more complex and less understood [8]. T‐cell acute lymphoblastic leukemia (T‐ALL) is an aggressive malignancy of developing T‐cells. Patients who relapse or are refractory to frontline chemotherapies demonstrate a poor prognosis [9, 10].

The purine nucleoside analogue nelarabine serves as a critical salvage agent in this setting [11], yet its clinical benefit is frequently transient due to the rapid emergence of resistance [12]. This clinical reality presents a formidable challenge, as effective therapeutic options for nelarabine‐failed patients are severely limited [13]. The molecular pathways that are specifically co‐opted by T‐ALL cells to survive nelarabine treatment remain largely unelucidated. This gap in our knowledge not only hinders the prediction of which patients will fail therapy but also precludes the development of mechanism‐based strategies to overcome drug resistance.

Here, we identify a pivotal mechanism of nelarabine resistance centered on an acquired addiction to the MYC oncogene [14]. Using unbiased transcriptomic profiling, we discovered that resistant T‐ALL cells are characterized by a profound and stable upregulation of a MYC‐driven transcriptional program. Functional studies, including shRNA‐mediated gene suppression, established that this hyperactive MYC state is not merely a correlative marker but a key functional driver required to maintain the resistant phenotype [15]. Confronted with the challenge of targeting the ‘undruggable’ MYC protein [16, 17, 18], we pursued a strategy of indirect targeting by employing PROTAC‐based BET protein degraders, ARV‐825 and ARV‐771 [19, 20, 21]. We demonstrate that this approach leads to the efficient elimination of BET family proteins, causing a catastrophic collapse of the MYC transcriptional network, and selectively triggering cell death in nelarabine‐resistant cells. Our findings, validated in preclinical in vivo models, reveal a key therapeutic vulnerability in resistant T‐ALL and provide a robust rationale for a novel therapeutic strategy to rescue nelarabine failure.

2. Materials and Methods

2.1. Cell Lines and Reagents

The human T‐cell acute lymphoblastic leukemia (T‐ALL) cell lines CCRF‐CEM and Jurkat were obtained from the Cell Bank of the Chinese Academy of Sciences. Their nelarabine‐resistant sublines (CCRF‐NelR, Jurkat‐NelR) were established and characterized as previously described [22]. All cell lines were authenticated by STR profiling and tested for mycoplasma. Cells were maintained in RPMI 1640 medium (Gibco) with 10% FBS (ExCell Bio) and 1% penicillin–streptomycin solution (Gibco) and cultured at 37°C in a humidified incubator containing 5% CO₂.

ARV‐825 (Cat# HY‐16954) and ARV‐771 (Cat# HY‐100972) were purchased from MedChemExpress. For in vivo use, ARV‐771 was formulated in 5% DMSO, 10% PEG300, and 85% saline. Antibodies used in the study include: rabbit anti‐BRD4 (Cat# A12677, Abclonal), rabbit anti‐BRD3 (Cat# A19001, Abclonal), rabbit anti‐BRD2 (Cat# A23166, Abclonal), rabbit anti‐c‐Myc (Cat# 10828–1‐AP, Proteintech), and mouse anti‐β‐actin (Cat# AC026, Abclonal), anti‐human CD45 (Elabscience, Cat# PTM‐6132), and anti‐human CD3 (Biolegend, Cat# 317306). All antibodies were used according to the manufacturers' instructions.

2.2. Cell Viability, Apoptosis, and Cell Cycle Assays

Cell viability was assessed by trypan blue exclusion after 72‐h drug treatment, with IC50 values calculated via non‐linear regression (GraphPad Prism), following our established protocol [22]. For apoptosis, cells were stained using the Annexin V/DAPI Kit (Elabscience, Cat# E‐CK‐A217) and analyzed on an Attune NxT flow cytometer (Thermo Fisher). Cell cycle distribution was determined by propidium iodide (PI) staining of ethanol‐fixed cells and analyzed using ModFit LT 5.0. Specific experimental conditions (e.g., drug concentrations, shRNA) are detailed in the figure legends.

2.3. RNA Sequencing and Analysis

Total RNA from triplicate samples was sequenced by GENEWIZ (Ilumina, 2 × 150 bp). Reads were aligned to the human genome (GRCh38) using HISAT2 (v2.2.1), and quantified with featureCounts. Differential expression analysis between resistant and parental cells was performed using the edgeR (FDR < 0.05, |log₂FC| > 1). GSEA was performed using the pre‐ranked gene lists against the MSigDB Hallmark collection.

2.4. Western Blot Analysis

Protein lysates were separated by SDS‐PAGE, immunoblotted, and quantified using ImageJ with β‐actin normalization, strictly following our previous protocol [23].

2.5. Lentiviral Knockdown

Lentiviral particles expressing MYC‐targeting shRNAs (shMYC 1: GGAACTATGACCTCGACTACG, shMYC 2: GCGAGGATATCTGGAAGAAA) or a non‐targeting control (pLKO.1‐GFP) were generated to transduce resistant cells. Knockdown efficiency was validated by Western blot. Nelarabine sensitivity was assessed by a competitive apoptosis assay, comparing the apoptotic rates of transduced (GFP⁺) versus non‐transduced (GFP⁻) internal control cells within the same culture after 48 h drug exposure.

2.6. Isolation of PBMCs From Human Peripheral Blood

PBMCs were isolated from EDTA‐anticoagulated blood of healthy donors using Ficoll‐Paque PLUS, density centrifugation at 800 × g for 25 min. The mononuclear cell layer was collected and washed twice with PBS and resuspended in complete medium for subsequent experiments. Ethical approval was obtained from the institutional review board [Approval No. Med‐Ethics [2026] IIT No. (19)].

2.7. In Vivo Xenograft Studies

All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Guangdong Pharmaceutical University (Approval No. Gdpulacspf 2,022,803). All mice were housed in a specific‐pathogen‐free (SPF) facility. To establish T‐ALL xenograft model, 5 week old male NOD‐SCID IL2Rγ‐null (NSG) mice (from Guangzhou Nanmo Biotechnology Co. Ltd.) were inoculated via tail vein injection with 5 × 10⁶ CCRF‐NelR cells, resuspended in 100 μL of sterile PBS. Successful engraftment was monitored by quantifying the percentage of human CD45⁺(hCD45⁺) cells in peripheral blood via flow cytometry. Once peripheral blood chimerism reached an average of approximately 1%–5%, mice were randomized into treatment cohorts. For efficacy study, engrafted mice were randomly assigned to three groups (n = 5 mice per group): (1) Vehicle control (5% DMSO, 10% PEG300, 85% saline); (2) ARV‐771 (10 mg/kg); and (3) ARV‐771 (20 mg/kg). Treatments were administered daily via subcutaneous (s.c.) injection for 25 consecutive days. Leukemia burden (hCD45⁺%) was quantified using a no‐lyse, no‐wash flow cytometry protocol, gating on hCD45‐PE⁺events within the leukocyte population. Survival endpoints included > 15% weight loss or hind‐limb paralysis [24].

2.8. Statistical Analysis

Data are presented as mean ± SD from at least three independent experiments. Differences were analyzed by unpaired Student's t‐test (two groups) or one‐way ANOVA with Tukey's test (multiple groups). Survival was analyzed by the log‐rank test. p < 0.05 was considered significant. Significance levels are indicated as follows: p* ≤ 0.05, p** ≤ 0.01, p*** ≤ 0.001, p*** ≤ 0.0001; ns, not significant.

3. Results

3.1. Nelarabine‐Resistant T‐ALL Cells Acquire a Hyperactive MYC Transcriptional Program

To elucidate the molecular mechanisms underlying nelarabine resistance, we performed transcriptome sequencing on the parental CCRF‐CEM T‐ALL cell line and its derived resistant subline, CCRF‐NelR. This analysis revealed widespread alterations in gene expression upon the acquisition of resistance (Figure 1A, Table S1). To identify the key dysregulated biological programs, we performed Gene Set Enrichment Analysis (GSEA). This analysis revealed a profound enrichment of the Hallmark MYC Targets gene set, alongside significant enrichment of pathways related to E2F targets and interferon responses (IFN‐γ, IFN‐α) in the resistant cells (Figure 1B, Figure S1). To address the potential heterogeneity of T‐ALL, we validated these transcriptomic findings in a second, genetically distinct model. RNA sequencing of Jurkat‐NelR versus parental Jurkat cells similarly revealed a significant enrichment of the Hallmark MYC Targets (V1 and V2) and E2F Targets gene sets (Figure S2, Table S2). This consistency across different cell lines underscores the universality of MYC pathway hyperactivation as a core driver of Nelarabine resistance.

Nelarabine‐resistant T‐ALL cells display upregulation of the MYC transcriptional program. (A) Volcano plot of differentially expressed genes from RNA‐seq of parental CCRF‐CEM versus Nelarabine‐resistant (NelR) cells. Red and blue dots indicate significantly up‐ and downregulated genes (FDR < 0.05, |log₂FC| > 1); MYC and selected targets are highlighted. (B) GSEA of RNA‐seq data showing enrichment of Hallmark MYC Targets and other indicated gene sets in CCRF‐NelR cells. NES, normalized enrichment score. (C, D) RT‐qPCR of MYC and selected target mRNAs in CCRF‐CEM/CCRF‐NelR (C) and Jurkat/Jurkat‐NelR (D) cells. (E) Representative Western blot of baseline MYC and BET proteins (BRD4, BRD3, BRD2) in parental and NelR T‐ALL cells. β‐actin as loading control. (F) Densitometric quantification of (E), normalized to β‐actin.

To validate these transcriptomic findings, the expression of key molecules was assessed at the mRNA and protein levels. Consistent with the sequencing data, quantitative real‐time PCR (RT‐qPCR) analysis confirmed that the mRNA levels of several MYC pathway‐associated genes, including MYC, MCM5, PPAN, PLK1, CDK4, and MYBBP1A, were significantly elevated in both CCRF‐NelR and Jurkat‐NelR cells compared to their parental counterparts (Figure 1C,D). At the protein level, Western blot analysis confirmed that MYC was significantly upregulated in both resistant cell lines (Figure 1E,F, Figure S3).

Given the critical role of BET bromodomain proteins in regulating MYC transcription [16, 25], we next examined the baseline expression of these proteins in our resistant and sensitive cell lines. Interestingly, while BRD3 and BRD4 protein levels were comparable between the groups, BRD2 expression was also significantly higher in the resistant cells (Figure 1E,F, Figure S3).

Collectively, these data demonstrate that the development of nelarabine resistance is tightly associated with the overexpression of MYC at both the mRNA and protein levels, and is correlated with a specific upregulation of the BET family member BRD2.

3.2. Suppression of MYC Restores Nelarabine Sensitivity in Resistant T‐ALL Cells

To determine the functional role of MYC in mediating nelarabine resistance, we specifically knocked down MYC expression in these resistant T‐cell acute lymphoblastic leukemia (T‐ALL) cell lines using a lentiviral vector‐mediated short hairpin RNA (shRNA) approach (Figure 2A). This system utilized a co‐expressed green fluorescent protein (GFP) marker, allowing for the direct comparison of transduced (GFP‐positive) cells with non‐transduced (GFP‐negative) internal control cells within the same culture. MYC knockdown rendered a significant increase in nelarabine‐induced apoptosis in both CCRF‐NelR and Jurkat‐NelR cells when compared directly to the GFP‐negative internal controls (Figure 2B,D, Figure S4). This sensitization effect was confirmed using two independent shRNAs, demonstrating that MYC expression is functionally required for nelarabine resistance.

Suppression of MYC restores nelarabine sensitivity in resistant T‐ALL cells. (A) Schematic of lentivirus‐mediated MYC knockdown and its effect on drug sensitivity in Nelarabine‐resistant T‐ALL cells. Apoptosis was compared between MYC‐knockdown and control cells after Nelarabine treatment. (B, D) Quantification of apoptosis in bulk‐transduced CCRF‐NelR (B) and Jurkat‐NelR (D) cells. Apoptotic rates of transduced (GFP⁺) versus non‐transduced (GFP⁻) cells were compared as internal controls. Cells were transduced with two shRNAs targeting MYC (shMYC‐1, shMYC‐2) and treated with indicated Nelarabine concentrations for 48 h before Annexin V‐APC/DAPI staining and flow cytometry. (C, E) Representative Western blots showing MYC knockdown efficiency in CCRF‐NelR (C) and Jurkat‐NelR (E) cells. BET protein levels were also assessed. β‐actin was used as a loading control.

Collectively, these results from two independent shRNAs demonstrate that MYC expression is essential for maintaining the nelarabine‐resistant phenotype in T‐ALL cells.

Western blot analysis confirmed a marked reduction in MYC protein levels in the transduced cells, validating the efficiency of both shRNAs (Figure 2C,E). Interestingly, this analysis also revealed a concurrent and marked decrease in BRD2 protein levels, while the expression of BRD3 and BRD4 remained largely unaffected.

3.3. BET Degraders Suppress Proliferation and Induce Apoptosis and Cell Cycle Arrest in Nelarabine‐Resistant Cells

Based on the observed MYC dependency, we next sought to determine the therapeutic efficacy of targeting the upstream BET proteins using the PROTAC‐based degraders ARV‐825 and ARV‐771. We first assessed the anti‐proliferative activity of both compounds in parental and nelarabine‐resistant cell lines. The half‐maximal inhibitory concentration (IC₅₀) of ARV‐825 was determined to be between 0.06 and 0.29 μM, while ARV‐771 exhibited greater potency, with IC₅₀ values ranging from 13.43 to 20.34 nM (Figure 3A,B). Importantly, both degraders retained potent activity against the nelarabine‐resistant sublines.

BET degraders suppress the proliferation of nelarabine‐resistant T‐ALL cells by inducing apoptosis and cell cycle arrest. (A, B) Dose–response curves of cell viability after 72 h treatment with ARV‐825 (A) or ARV‐771 (B) in parental and Nelarabine‐resistant CCRF‐CEM and Jurkat cells. Calculated IC₅₀ values are shown. (C–F) Apoptosis analysis in CCRF‐NelR and Jurkat‐NelR cells after 48 h treatment with indicated concentrations of ARV‐825 or ARV‐771. (C, E) Representative Annexin V‐APC/DAPI flow cytometry plots. (D, F) Quantification of apoptotic (Annexin V⁺) cells. (G–L) Cell cycle analysis in CCRF‐NelR and Jurkat‐NelR cells after 48 h treatment. (G, J) Representative PI‐stained histograms. (H, I, K, L) Quantification of cells in G₀/G₁, S, G₂/M phases.

To elucidate the mechanisms underlying this anti‐proliferative effect, we next assessed apoptosis and cell cycle distribution by flow cytometry after a 48 h drug treatment. Treatment with either ARV‐825 or ARV‐771 markedly induced apoptosis in a dose‐dependent manner in both CCRF‐NelR and Jurkat‐NelR cells (Figure 3C–F, Figure S5). In addition to inducing apoptosis, cell cycle analysis revealed that both compounds caused a significant accumulation of cells in the G₀/G₁ phase, with a corresponding decrease in the proportion of cells in the S phase (Figure 3G–L, Figure S6).

Taken together, these data demonstrate that BET protein degraders effectively suppress the proliferation of nelarabine‐resistant T‐ALL cells by concurrently inducing G₀/G₁ phase arrest and promoting apoptosis.

3.4. BET Degraders Induce Degradation of BET Proteins and Suppress the MYC Pathway

To confirm the on‐target mechanism of the BET degraders, we assessed their effects on the protein levels of BET family members and their key downstream target, MYC, in resistant T‐ALL cells [26]. Western blot analysis demonstrated that both ARV‐825 and ARV‐771 induced a potent, dose‐dependent degradation of BRD4, BRD3, and BRD2. The degradation of these BET proteins was accompanied by a profound reduction in MYC protein levels (Figure 4A–H, Figure S7).

BET degraders induce the degradation of BET proteins and suppress MYC expression in nelarabine‐resistant cells. (A–H) Western blot of BET proteins (BRD4, BRD3, BRD2) and MYC in CCRF‐NelR and Jurkat‐NelR cells treated 48 h with indicated concentrations of ARV‐825 (A–D) or ARV‐771 (E–H). (A, B, E, F) Representative blots; β‐actin as loading control. (C, D, G, H) Densitometric quantification normalized to β‐actin. I. Heatmap of relative mRNA levels of BET genes, MYC, and selected MYC targets in CCRF‐NelR cells after 48 h ARV‐825 or ARV‐771 treatment, determined by RT‐qPCR.

To confirm that the reduction in BET protein levels was due to degradation rather than transcriptional suppression, we next measured mRNA levels by RT‐qPCR following drug treatment. While the mRNA levels of MYC and its downstream targets were significantly downregulated, consistent with transcriptional suppression, the mRNA levels of BRD4, BRD3, and BRD2 were not decreased. In fact, a modest upregulation of some BET family transcripts was observed (Figure 4I).

Taken together, these data confirm that ARV‐825 and ARV‐771 function by directly inducing the post‐transcriptional degradation of BET proteins, thereby leading to transcriptional suppression of the MYC pathway in nelarabine‐resistant cells.

3.5. BET Degrader ARV‐771 Significantly Inhibited Leukemia Progression in a Nelarabine‐Resistant T‐ALL Mouse Model

To evaluate the in vivo anti‐leukemic activity of ARV‐771, we established a xenograft model by intravenous injection of CCRF‐NelR cells into NSG mice. After confirming leukemia engraftment on day 5, mice were randomized into three treatment cohorts: vehicle, ARV‐771 (10 mg/kg), and ARV‐771 (20 mg/kg), and treated with daily subcutaneous injections (Figure 5A).

BET degrader ARV‐771 suppresses leukemia progression in a nelarabine‐resistant T‐ALL xenograft model. (A) Schematic of the in vivo efficacy study design. NSG mice bearing CCRF‐NelR xenografts were treated daily with vehicle or ARV‐771 at the indicated doses (n = 5 mice/group). (B) Longitudinal monitoring of leukemia burden, measured as the percentage of human CD45+ (hCD45+) cells in peripheral blood at the indicated time points. (C–E) Quantification of leukemia burden (percentage of hCD45 + cells) in the bone marrow (C), peripheral blood (D), and spleen (E) at the experimental endpoint on day 30. (F, G) Assessment of drug tolerance. (F) shows the body weight changes of mice throughout the treatment period and (G) shows the organ‐to‐body‐weight ratios (organ coefficients) for the indicated organs at the endpoint. (H) Representative hematoxylin and eosin (H&E) stained sections of liver and spleen tissues from each treatment group. (I, J) Western blot analysis of MYC and BET protein levels in bone marrow lysates from each treatment group at the endpoint.

Leukemia burden was monitored longitudinally by quantifying the percentage of circulating human CD45⁺ (hCD45⁺) cells (Figure S8). While the vehicle‐treated group showed progressive disease, treatment with ARV‐771 led to a dose‐dependent control of leukemia progression in the peripheral blood (Figure 5B). At the experimental endpoint on day 30, ARV‐771 treatment had significantly reduced the percentage of hCD45⁺cells in both the bone marrow and peripheral blood compared to the vehicle control (Figure 5C,D, Figure S9). No significant differences in spleen infiltration were observed between the groups (Figure 5E).

The treatment was generally well‐tolerated. No significant differences in body weight were observed between the treatment and vehicle groups over the course of the study (Figure 5F), and there were no significant changes in organ‐to‐body‐weight ratios at the endpoint (Figure 5G). Furthermore, histopathological analysis of liver and spleen sections revealed no signs of drug‐induced toxicity (Figure 5H, Figure S10).

To confirm the in vivo mechanism of action, we performed Western blot analysis on bone marrow lysates from the treated mice. Consistent with its mechanism, ARV‐771 treatment resulted in a dose‐dependent reduction of both BRD4 and MYC protein levels, while the expression of BRD2 and BRD3 was not substantially affected (Figure 5I,J).

3.6. ARV‐771 Treatment Prolongs the Survival of Mice Bearing Nelarabine‐Resistant T‐ALL Xenografts

To determine the impact of ARV‐771 on overall survival, we established a CCRF‐NelR xenograft model in NSG mice. Following confirmation of engraftment (Figure S11), mice were randomized to receive daily subcutaneous injections of either vehicle or ARV‐771 (20 mg/kg) (Figure 6A). Analysis of terminal disease burden at the humane endpoint revealed that ARV‐771 treatment significantly reduced the percentage of hCD45⁺ leukemia cells in the bone marrow compared to the vehicle control (Figure 6B). No significant differences were observed in the peripheral blood or spleen (Figure 6C,D).

ARV‐771 treatment prolongs survival in a nelarabine‐resistant T‐ALL xenograft model. Schematic of the in vivo survival study design. NSG mice bearing CCRF‐NelR xenografts were treated daily with vehicle or ARV‐771 (20 mg/kg, n = 5 mice/group). (B–D) Quantification of terminal leukemia burden, measured as the percentage of hCD45+ cells in the bone marrow (B), peripheral blood (C), and spleen (D) of mice at the pre‐defined humane endpoint. (E) Kaplan–Meier survival curves for mice treated with vehicle or ARV‐771. Statistical significance was determined by the log‐rank (Mantel‐Cox) test. (F) Body weight changes of mice throughout the treatment period. (G) Organ‐to‐body‐weight ratios (organ coefficients) for the indicated organs at the experimental endpoint.

Crucially, ARV‐771 treatment significantly prolonged the overall survival of the mice (Figure 6E; median survival: 31 days for the treatment group vs. 27 days for the vehicle group; p = 0.03). In line with the efficacy data, vehicle‐treated mice exhibited significant body weight loss prior to reaching the humane endpoint, a sign of progressive disease that was mitigated in the ARV‐771‐treated group (Figure 6F). Furthermore, analysis of organ‐to‐body‐weight ratios at the endpoint revealed no significant differences, indicating a favorable safety profile (Figure 6G).

3.7. Nelarabine‐Resistant T‐ALL Cells Exhibit Higher In Vitro Sensitivity to ARV‐771 Than Normal Immune Cells

To evaluate the safety profile of ARV‐771, we treated peripheral blood mononuclear cells (PBMCs) from healthy donors and compared the sensitivities of CD3⁺ primary T cells and CD3⁻ non‐T cell populations. While ARV‐771 potently inhibited resistant CCRF‐NelR cells (IC₅₀: 20.34 nM), normal CD3⁺ T cells exhibited significantly lower sensitivity (IC₅₀: 144 nM) representing a ~7‐fold therapeutic window (Figure 7A,B,D, Figure S12). Furthermore, CD3⁻ non‐T lymphocytes displayed higher tolerance to the drug (IC₅₀: 8347 nM) (Figure 7C,D). These results indicate that ARV‐771 selectively targets nelarabine‐resistant T‐ALL cells while sparing normal immune effector cells in vitro.

Selective toxicity of ARV‐771 toward T‐ALL cells and the proposed mechanism of action. (A) Gating strategy used to identify CD3+ or CD3‐ T cells and determination of apoptotic percentage. (B and C) Dose–response curves of CD3⁺T cells (B) and CD3⁻non‐T cells (C) from healthy donors (n = 5) treated with ARV‐771 for 72 h. (D) Representative flow cytometry dot plots showing apoptosis in lymphocyte sub populations. (E) Schematic model: Nelarabine resistance is driven by transcriptional addiction to a hyperactive MYC pathway. BET degraders (e.g., ARV‐771) induce the degradation of upstream BET proteins to collapse the MYC program, thereby reversing resistance, inducing apoptosis, and suppressing leukemia growth.

4. Discussion

In this study, we provide a new mechanistic framework for acquired nelarabine resistance in T‐ALL, demonstrating that it is driven by a functional addiction to a hyperactive MYC transcriptional program. We further establish that this acquired dependency creates a potent therapeutic vulnerability that can be successfully exploited by the targeted degradation of BET proteins using the PROTAC degrader ARV‐771 [26]. Our findings establish a direct causal link between the clinical challenge of nelarabine failure and a core oncogenic pathway, thereby providing a robust preclinical rationale for a novel strategy to overcome resistance.

While the efficacy of BET degraders such as ARV‐825 has been previously reported in treatment‐naïve T‐ALL models [27, 28], our study addresses a distinct and critical clinical challenge: acquired resistance to the salvage agent nelarabine. Our work offers novel insights in two specific aspects. First, we identify that nelarabine resistance is functionally driven by an acquired addiction to the MYC program, accompanied by a unique upregulation of BRD2, distinguishing it from the biology of primary T‐ALL. Second, we demonstrate that this specific resistant state creates a heightened therapeutic threshold.

Our investigation was strategically guided by the hypothesis that a master transcriptional regulator, rather than a single effector protein like a drug transporter, might serve as a more fundamental and actionable node in the complex network of chemoresistance. Traditional resistance mechanisms, such as altered drug efflux or metabolism, often represent downstream adaptations [29]. In contrast, a master transcription factor like MYC orchestrates a multitude of cellular programs—including proliferation, metabolism, and apoptosis—making it a prime candidate for a central driver of a stable resistant phenotype [30, 31]. Our unbiased transcriptomic analysis validated this hypothesis, identifying the MYC program as the most significantly enriched pathway in resistant cells. Crucially, our functional data confirmed this observation, demonstrating that genetic suppression of MYC was sufficient to restore nelarabine sensitivity.

A key finding of our study is the limited in vivo efficacy of ARV‐825 in the nelarabine‐resistant xenograft model (Figure S13), in contrast to previous reports demonstrating robust antitumor activity in various T‐ALL models [27, 28]. This discrepancy likely reflects a distinct biological property of the acquired resistance phenotype rather than a general limitation of ARV‐825. We propose that nelarabine resistance induces an intensified dependency on the MYC program, thereby elevating the therapeutic threshold required for tumor regression. Accordingly, while ARV‐825–mediated MYC suppression may suffice for parental MYC‐dependent T‐ALL [26, 32, 33], it appears insufficient to disrupt the highly stabilized MYC network characteristic of resistant cells.

In contrast, the superior efficacy of ARV‐771 in our model suggests it possesses more optimal pharmacological properties [34, 35]‐be it greater potency, stability, or tissue exposure‐that allow it to surpass this heightened threshold [36, 37] This finding underscores a potentially crucial concept: overcoming acquired resistance driven by master transcription factors may demand pharmacologically superior agents capable of achieving deeper target inhibition than what is required for treating the primary disease.

While our study provides a compelling preclinical proof‐of‐concept, several limitations and translational hurdles warrant consideration. Our work relied on established cell lines and their derived xenograft models; future validation in patient‐derived xenograft (PDX) models, which better recapitulate the heterogeneity of T‐ALL, is an essential next step. Furthermore, while we have causally linked MYC hyperactivity to the resistant phenotype, the precise upstream signaling events that initiate this transcriptional reprogramming under prolonged nelarabine exposure remain to be fully elucidated [38].

Finally, the safety profile of ARV‐771 requires careful consideration for clinical translation. In our in vitro toxicity assessment, we observed a favorable therapeutic window: ARV‐771 selectively targeted nelarabine‐resistant T‐ALL cells (IC50 ~ 20 nM) while sparing normal human CD3⁺ T cells (IC50 ~ 144 nM) and CD3‐ non‐T lymphocytes (IC50 > 8000 nM) (Figure 7). This suggests a significant margin of safety for normal immune effectors. However, in our in vivo model, we observed significant, albeit transient, skin discoloration at the injection site, which aligns with previously reported skin‐related side effects of this compound [37, 39]. This suggests that while systemic toxicity appears low in our models, optimizing the delivery route and local toxicity will be critical for future clinical development.

Ultimately, our research has significant and immediate translational implications. It provides a strong, mechanistically grounded rationale for the clinical investigation of potent BET degraders like ARV‐771 as a salvage therapy for patients with nelarabine‐refractory T‐ALL. More broadly, our findings champion a forward‐looking strategy of using upfront combination therapy to prevent, rather than simply treat, the emergence of acquired chemoresistance. This approach of identifying a transcriptional addiction and exploiting it with a targeted degrader serves as a powerful and generalizable blueprint for overcoming resistance driven by other “undruggable” transcription factors across a spectrum of human cancers [40, 41]. In conclusion, our work deciphers a critical resistance mechanism in T‐ALL and offers a robust therapeutic strategy to subvert it, a comprehensive process summarized in our proposed model (Figure 7E), which holds the potential to alter the treatment landscape for this devastating disease.

Author Contributions

Jingjing Gao: data curation, formal analysis, investigation, writing – original draft, visualization, methodology. Chunxu Lin: methodology, investigation, data curation, formal analysis. Suchang Chen: methodology, data curation. Qi Mo: software, visualization. Chu Bao: data curation, investigation. Huali Deng: investigation, data curation. Ziyin Chen: investigation, data curation. Weichao Hao: methodology, resources. Luyong Zhang: conceptualization, writing – review and editing, resources, supervision. Min Wei: conceptualization, supervision, funding acquisition, writing – review and editing, project administration.

Funding

This work was supported by Department of Education of Guangdong Province, 2024KTSCX169.

Ethics Statement

Approval of the research protocol by an Institutional Reviewer Board (Approved number: gdpulacspf 2022803).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: Expanded Gene Set Enrichment Analysis of the Transcriptome of CCRF‐NelR and CCRF‐CEM Cells, related to Figure 1.

Figure S2: Transcriptomic validation in Jurkat‐NelR cells, related to Figure 1.

Figure S3: Independent biological replicates for the Western blot analysis shown in Figure 1, related to Figure 1E and F.

Figure S4: Gating strategy and flow cytometry plots for the competitive apoptosis assay, related to Figure 2B and D.

Figure S5: Independent biological replicates for the BET degrader‐induced apoptosis assay, related to Figure 3C–F.

Figure S6: Independent biological replicates for the BET degrader‐induced cell cycle arrest, related to Figure 3G–L.

Figure S7: Independent biological replicates for the Western blot analysis of BET protein degradation, related to Figure 4.

Figure S8: Gating strategy and validation of leukemia engraftment for in vivo studies, related to Figure 5.

Figure S9: Flow cytometry data for the terminal leukemia burden analysis, related to Figure 5C and D.

Figure S10: Histopathological analysis of liver and spleen tissues from all mice in the efficacy study, related to Figure 5H.

Figure S11: Validation of leukemia engraftment for the in vivo survival study, related to Figure 6.

Figure S12: Schematic showing apoptosis of PBMC‐derived CD3+ and CD3− cells from four additional healthy donors, related to Figure 7.

Figure S13: ARV‐825 exhibits limited in vivo efficacy against nelarabine‐resistant T‐ALL xenografts.

CAS-117-1608-s001.doc^{(18.1MB, doc)}

Table S1: Differentiated Gene Expression between CCRF CEM and CCRF‐NelR cells.

CAS-117-1608-s002.xlsx^{(3.4MB, xlsx)}

Table S2: Differentiated Gene Expression between Jurkat and Jurkat‐NelR cells.

CAS-117-1608-s003.xlsx^{(2.4MB, xlsx)}

Contributor Information

Weichao Hao, Email: haoweichao@gdpu.edu.cn.

Luyong Zhang, Email: lyzhang@gdpu.edu.cn.

Min Wei, Email: min.wei@gdpu.edu.cn.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

1. Samuels A. L., Beesley A. H., Yadav B. D., et al., “A Pre‐Clinical Model of Resistance to Induction Therapy in Pediatric Acute Lymphoblastic Leukemia,” Blood Cancer Journal 4, no. 8 (2014): e232, 10.1038/bcj.2014.52. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Olesinski E. A., Bhatia K. S., Wang C., et al., “Acquired Multidrug Resistance in AML Is Caused by Low Apoptotic Priming in Relapsed Myeloblasts,” Blood Cancer Discov 5, no. 3 (2024): 180–201, 10.1158/2643-3230.BCD-24-0001. [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Brown R., Curry E., Magnani L., Wilhelm‐Benartzi C. S., and Borley J., “Poised Epigenetic States and Acquired Drug Resistance in Cancer,” Nature Reviews. Cancer 14, no. 11 (2014): 747–753, 10.1038/nrc3819. [DOI] [PubMed] [Google Scholar]
4. Kim J., Shim M. K., Yang S., et al., “Combination of Cancer‐Specific Prodrug Nanoparticle With Bcl‐2 Inhibitor to Overcome Acquired Drug Resistance,” Journal of Controlled Release 330 (2021): 920–932, 10.1016/j.jconrel.2020.10.065. [DOI] [PubMed] [Google Scholar]
5. Mikubo M., Inoue Y., Liu G., and Tsao M. S., “Mechanism of Drug Tolerant Persister Cancer Cells: The Landscape and Clinical Implication for Therapy,” Journal of Thoracic Oncology 16, no. 11 (2021): 1798–1809, 10.1016/j.jtho.2021.07.017. [DOI] [PubMed] [Google Scholar]
6. Dagogo‐Jack I. and Shaw A. T., “Tumour Heterogeneity and Resistance to Cancer Therapies,” Nature Reviews. Clinical Oncology 15, no. 2 (2018): 81–94, 10.1038/nrclinonc.2017.166. [DOI] [PubMed] [Google Scholar]
7. Hofmann W. K., Trumpp A., and Müller‐Tidow C., “Therapy Resistance Mechanisms in Hematological Malignancies,” International Journal of Cancer 152, no. 3 (2023): 340–347, 10.1002/ijc.34243. [DOI] [PubMed] [Google Scholar]
8. Bukowski K., Kciuk M., and Kontek R., “Mechanisms of Multidrug Resistance in Cancer Chemotherapy,” International Journal of Molecular Sciences 21, no. 9 (2020): 3233, 10.3390/ijms21093233. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Huang Y. H., Wan C. L., Dai H. P., and Xue S. L., “Targeted Therapy and Immunotherapy for T Cell Acute Lymphoblastic Leukemia/Lymphoma,” Annals of Hematology 102, no. 8 (2023): 2001–2013, 10.1007/s00277-023-05286-3. [DOI] [PubMed] [Google Scholar]
10. Belver L. and Ferrando A., “The Genetics and Mechanisms of T Cell Acute Lymphoblastic Leukaemia,” Nature Reviews. Cancer 16, no. 8 (2016): 494–507, 10.1038/nrc.2016.63. [DOI] [PubMed] [Google Scholar]
11. Hormann F. M. and Rudd S. G., “Nelarabine in T‐Cell Acute Lymphoblastic Leukemia: Intracellular Metabolism and Molecular Mode‐Of‐Action,” Leukemia 39, no. 3 (2025): 531–542, 10.1038/s41375-025-02529-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Gökbuget N., Basara N., Baurmann H., et al., “High Single‐Drug Activity of Nelarabine in Relapsed T‐Lymphoblastic Leukemia/Lymphoma Offers Curative Option With Subsequent Stem Cell Transplantation,” Blood 118, no. 13 (2011): 3504–3511, 10.1182/blood-2011-01-329441. [DOI] [PubMed] [Google Scholar]
13. Shimony S., Liu Y., Valtis Y. K., et al., “Nelarabine Combination Therapy for Relapsed or Refractory T‐Cell Acute Lymphoblastic Lymphoma/Leukemia,” Blood Advances 7, no. 7 (2023): 1092–1102, 10.1182/bloodadvances.2022008280. [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Jakobsen S. T., Jensen R. A. M., Madsen M. S., et al., “MYC Activity at Enhancers Drives Prognostic Transcriptional Programs Through an Epigenetic Switch,” Nature Genetics 56, no. 4 (2024): 663–674, 10.1038/s41588-024-01676-z. [DOI] [PubMed] [Google Scholar]
15. Lee K. M., Giltnane J. M., Balko J. M., et al., “MYC and MCL1 Cooperatively Promote Chemotherapy‐Resistant Breast Cancer Stem Cells via Regulation of Mitochondrial Oxidative Phosphorylation,” Cell Metabolism 26, no. 4 (2017): 633–647.e7, 10.1016/j.cmet.2017.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Minko T., “Nanoformulation of BRD4‐Degrading PROTAC: Improving Druggability to Target the “Undruggable” MYC in Pancreatic Cancer,” Trends in Pharmacological Sciences 41, no. 10 (2020): 684–686, 10.1016/j.tips.2020.08.008. [DOI] [PubMed] [Google Scholar]
17. Jiang J., Wang J., Yue M., et al., “Direct Phosphorylation and Stabilization of MYC by Aurora B Kinase Promote T‐Cell Leukemogenesis,” Cancer Cell 37, no. 2 (2020): 200–215.e5, 10.1016/j.ccell.2020.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Ortega M., Bhatnagar H., Lin A. P., et al., “A microRNA‐Mediated Regulatory Loop Modulates NOTCH and MYC Oncogenic Signals in B‐ and T‐Cell Malignancies,” Leukemia 29, no. 4 (2015): 968–976, 10.1038/leu.2014.302. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Kotekar A., Singh A. K., and Devaiah B. N., “BRD4 and MYC: Power Couple in Transcription and Disease,” FEBS Journal 290, no. 20 (2023): 4820–4842, 10.1111/febs.16580. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Delmore J. E., Issa G. C., Lemieux M. E., et al., “BET Bromodomain Inhibition as a Therapeutic Strategy to Target c‐Myc,” Cell 146, no. 6 (2011): 904–917, 10.1016/j.cell.2011.08.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Aird F., Kandela I., and Mantis C., “Replication Study: BET Bromodomain Inhibition as a Therapeutic Strategy to Target c‐Myc,” eLife 6 (2017): e21253, 10.7554/eLife.21253. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Ximei W., Lin C., Wang H., et al., “Connectivity‐Map Unveils Gemcitabine's Efficacy in Overcoming Nelarabine Resistance in T‐Cell Acute Lymphoblastic Leukemia,” Biochemical and Biophysical Research Communications 769 (2025): 151971, 10.1016/j.bbrc.2025.151971. [DOI] [PubMed] [Google Scholar]
23. Wang H., Wu X., Gao J., et al., “Targeting Myc Through BET‐PROTAC Elicits Potent Anti‐Lymphoma Activity in Diffuse Large B Cell Lymphoma,” Investigational New Drugs 43, no. 3 (2025): 621–633, 10.1007/s10637-025-01535-6. [DOI] [PubMed] [Google Scholar]
24. Mekouar H., Mullier F., Dinon Q., Bailly N., Cornet Y., and Chatelain B., “No Effect of Lysis Solutions on Absolute CD19+ Lymphocytes Count and CD45 Index in Chronic Lymphocytic Leukemia,” Cytometry. Part B, Clinical Cytometry 80, no. 6 (2011): 369–372, 10.1002/cyto.b.20604. [DOI] [PubMed] [Google Scholar]
25. Slavish P. J., Chi L., Yun M. K., et al., “Bromodomain‐Selective BET Inhibitors Are Potent Antitumor Agents Against MYC‐Driven Pediatric Cancer,” Cancer Research 80, no. 17 (2020): 3507–3518, 10.1158/0008-5472.CAN-19-3934. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Sun B., Fiskus W., Qian Y., et al., “BET Protein Proteolysis Targeting Chimera (PROTAC) Exerts Potent Lethal Activity Against Mantle Cell Lymphoma Cells,” Leukemia 32, no. 2 (2018): 343–352, 10.1038/leu.2017.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Wu S., Jiang Y., Hong Y., et al., “BRD4 PROTAC Degrader ARV‐825 Inhibits T‐Cell Acute Lymphoblastic Leukemia by Targeting “Undruggable” Myc‐Pathway Genes,” Cancer Cell International 21, no. 1 (2021): 230, 10.1186/s12935-021-01908-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Piya S., Yang Y., Bhattacharya S., et al., “Targeting the NOTCH1‐MYC‐CD44 Axis in Leukemia‐Initiating Cells in T‐ALL,” Leukemia 36, no. 5 (2022): 1261–1273, 10.1038/s41375-022-01516-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Lan Y., Tao W., Ma L., et al., “The RNA Sequencing Results Revealed the Expression of Different Genes and Signaling Pathways During Chemotherapy Resistance in Peripheral T‐Cell Lymphoma,” BMC Medical Genomics 17, no. 1 (2024): 74, 10.1186/s12920-024-01842-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Ahmadi S. E., Rahimi S., Zarandi B., Chegeni R., and Safa M., “MYC: A Multipurpose Oncogene With Prognostic and Therapeutic Implications in Blood Malignancies,” Journal of Hematology & Oncology 14, no. 1 (2021): 121, 10.1186/s13045-021-01111-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Dhanasekaran R., Deutzmann A., Mahauad‐Fernandez W. D., Hansen A. S., Gouw A. M., and Felsher D. W., “The MYC Oncogene ‐ The Grand Orchestrator of Cancer Growth and Immune Evasion,” Nature Reviews. Clinical Oncology 19, no. 1 (2022): 23–36, 10.1038/s41571-021-00549-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Liao X., Qian X., Zhang Z., et al., “ARV‐825 Demonstrates Antitumor Activity in Gastric Cancer via MYC‐Targets and G2M‐Checkpoint Signaling Pathways,” Frontiers in Oncology 11 (2021): 753119, 10.3389/fonc.2021.753119. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Saenz D. T., Fiskus W., Qian Y., et al., “Novel BET Protein Proteolysis‐Targeting Chimera Exerts Superior Lethal Activity Than Bromodomain Inhibitor (BETi) Against Post‐Myeloproliferative Neoplasm Secondary (s) AML Cells,” Leukemia 31, no. 9 (2017): 1951–1961, 10.1038/leu.2016.393. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Luffman N., Ahmadinejad F., Finnegan R. M., Raymond M., Gewirtz D. A., and Harada H., “Effectiveness of PROTAC BET Degraders in Combating Cisplatin Resistance in Head and Neck Cancer Cells,” International Journal of Molecular Sciences 26, no. 13 (2025): 6185, 10.3390/ijms26136185. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Deng Y., Yu C., Chen L., et al., “ARV‐771 Acts as an Inducer of Cell Cycle Arrest and Apoptosis to Suppress Hepatocellular Carcinoma Progression,” Frontiers in Pharmacology 13 (2022): 858901, 10.3389/fphar.2022.858901. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Nathani A., Aare M., Sun L., et al., “Unlocking the Potential of Camel Milk‐Derived Exosomes as Novel Delivery Systems: Enhanced Bioavailability of ARV‐825 PROTAC for Cancer Therapy,” Pharmaceutics 16, no. 8 (2024): 1070, 10.3390/pharmaceutics16081070. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Raina K., Lu J., Qian Y., et al., “PROTAC‐Induced BET Protein Degradation as a Therapy for Castration‐Resistant Prostate Cancer,” Proceedings of the National Academy of Sciences of the United States of America 113, no. 26 (2016): 7124–7129, 10.1073/pnas.1521738113. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Whitlock J. A., Malvar J., Dalla‐Pozza L., et al., “Nelarabine, Etoposide, and Cyclophosphamide in Relapsed Pediatric T‐Acute Lymphoblastic Leukemia and T‐Lymphoblastic Lymphoma (Study T2008‐002 NECTAR),” Pediatric Blood & Cancer 69, no. 11 (2022): e29901, 10.1002/pbc.29901. [DOI] [PubMed] [Google Scholar]
39. Liu H. J., Chen W., Wu G., et al., “Glutathione‐Scavenging Nanoparticle‐Mediated PROTACs Delivery for Targeted Protein Degradation and Amplified Antitumor Effects,” Adv Sci (Weinh) 10, no. 16 (2023): e2207439, 10.1002/advs.202207439. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Whitfield J. R. and Soucek L., “MYC in Cancer: From Undruggable Target to Clinical Trials,” Nature Reviews. Drug Discovery 24, no. 6 (2025): 445–457, 10.1038/s41573-025-01143-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Passirani C., Vessières A., La Regina G., Link W., and Silvestri R., “Modulating Undruggable Targets to Overcome Cancer Therapy Resistance,” Drug Resistance Updates 60 (2022): 100788, 10.1016/j.drup.2021.100788. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials