Co-occurrence of triple ESBL-associated genes (bla_CTX−M, bla_TEM and bla_SHV) in Gram-negative bacteria from clinical specimens at a provincial hospital in Far-Western Nepal

Abstract

Background

Antimicrobial resistance (AMR) among Gram-negative bacteria, particularly those producing extended-spectrum β-lactamase (ESBLs), represents a significant global healthcare challenge. CTX-M enzymes have achieved global dominance, often disseminated through plasmid-mediated horizontal gene transfer, complicating treatment in resource-limited settings. This study aimed to determine prevalence, antimicrobial resistance patterns and ESBL-associated gene profiles in clinical Gram-negative isolates.

Methods

A hospital-based cross-sectional study was conducted at Mahakali Provincial Hospital from November 2024 to February 2026. Using a consecutive sampling technique, 1485 clinical specimens (including urine, pus, blood, wound swabs, throat swabs and tissues) were processed for bacterial culture, identification, antimicrobial susceptibility testing and ESBL detection following CLSI 2024 guidelines. ESBL-associated genes (bla_CTX−M, bla_TEM and bla_SHV) were detected by PCR.

Results

Of 1485 specimens, 478 (32.3%) were culture-positive, yielding 411 (86.0%) Gram-negative bacteria. Urine samples accounted for 88.3% of isolates. E. coli (71.8%) and K. pneumoniae (15.6%) were the most common pathogens. Overall, 54.7% of isolates were multidrug-resistant (MDR). Among ESBL-screened Enterobacterales (n = 385), 108 (28.1%) were confirmed ESBL producers. Molecular analysis of 108 ESBL- producing MDR isolates revealed bla_CTX−M (56.5%) as the most prevalent gene followed by bla_TEM (44.4%) and bla_SHV (32.4%). Co-occurrence of multiple genes was observed in 56 (51.9%) isolates, with 6 (5.6%) harboring all three genes.

Conclusions

To the best of our knowledge, this is the first report from Far-Western Nepal documenting the co-carriage of triple ESBL-associated genes in clinical Enterobacterales. These findings highlight a high regional burden of community-level resistance and emphasize the urgent need for continuous molecular surveillance, targeted antimicrobial stewardship and region-specific treatment guidelines.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12879-026-13883-6.

Background

Antimicrobial resistance (AMR) is a critical global health threat, undermining the effectiveness of essential antibiotics and contributing substantially to morbidity and mortality worldwide. In 2019, an estimated 4.95 million deaths were associated with bacterial AMR of which 1.27 million were directly attributable to drug-resistant infections, highlighting the scale of this crisis, particularly, in low and middle income countries where surveillance systems are often limited [1]. Gram-negative bacteria including Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, are of particular concern due to their frequent multidrug resistance and their association with both healthcare-associated and community-acquired infections [2].

The production of β-lactamases is a key mechanism by which Gram- negative bacteria resist β-lactam antibiotics [3]. While carbapenemases and metallo- β-lactamases (MBLs) represent a significant threat to last–resort treatments, extended-spectrum β-lactamases (ESBLs) remain a more prevalent challenge in clinical settings. ESBL producers hydrolyze third- and fourth-generation cephalosporins and monobactams, leaving few effective therapeutic options. Notably, CTX-M enzymes have achieved global dominance among ESBL types, often facilitated by plasmid-mediated gene transfer, which allows for the rapid dissemination of resistance genes across human, animal and environmental reservoirs [4–6].

Several Nepalese studies underscore the depth of the AMR challenge. For example, recent work at the National Public Health Laboratory in Kathmandu reported alarmingly high levels of MDR E. coli. Nationally, the co-harboring of bla_CTX−M, bla_SHV and bla_TEM have been previously documented [7]. Furthermore, investigations have reinforced the critical need for localized AMR data regarding the co-existence of various β-lactamases within the country [8–11].

Despite these evidences, most AMR research in Nepal has been concentrated in well-resourced urban and central regions such as Kathmandu. Peripheral and geographically challenging areas, including the Far-Western region, remain underrepresented in the AMR surveillance data. These regions face distinct healthcare infrastructure challenges and patterns of antibiotic use that may influence resistance epidemiology differently than urban centers. Addressing this gap is essential for guiding empirical therapy, antimicrobial stewardship interventions and national AMR policy. This study, therefore, aims to determine the prevalence, antimicrobial resistance patterns and ESBL-associated gene profiles among Gram-negative bacteria isolated in a tertiary care provincial hospital in Far-Western Nepal.

Methods

Study design and setting

A hospital laboratory-based cross-sectional study was conducted from November 2024 to February 2026 at Mahakali Provincial Hospital, Mahendranagar, Kanchanpur district, Sudurpaschim Province, Nepal. The facility is a 150-bed healthcare center providing services to approximately 200 patients daily, primarily representing outpatient department (OPD) visits and emergency consultations for surrounding districts of Far-Western Nepal, including populations residing near the Nepal-India border.

Sampling approach

A consecutive sampling technique was employed for all clinical specimens during the study period. To ensure methodological transparency, Only the first isolate per patient was considered and repeat isolates from the same patient were excluded to prevent overrepresentation of specific colones, and samples showing mixed growth or contamination were also excluded. Of the 1485 clinical specimens processed for culture, 411 non-duplicate Gram-negative bacterial isolates were included. As per CLSI guidelines, 385 Enterobacterales isolates were screened for ESBL production while 26 non-fermenters (P. aeruginosa and A. baumannii) were excluded from ESBL screening. Molecular detection of ESBL-associated genes was performed on the 108 isolates that were phenotypically confirmed as ESBL producers.

Specimen collection and transportation

Clinical specimens, including urine, pus, blood, wound swabs, throat swabs and tissues were collected from patients attending outpatient, emergency and inpatient departments following standard aseptic procedures [12]. Stool cultures were specifically indicated for patients presenting with clinical symptoms of gastrointestinal infection to screen Vibrio, Salmonella and Shigella. Blood samples were inoculated immediately into Brain Heart Infusion (BHI) broth at a blood-to-broth ratio of 1:10 for adults and older children and 1:5 for infants. Midstream urine samples were collected after proper genital cleansing. Pus, wound swabs, tissue, stool and body fluid specimens were collected by trained personnel. All specimens were transported to the microbiology laboratory within 1–2 h of collection under appropriate conditions.

Isolation and identification of bacteria

Blood culture bottles were incubated aerobically at 35 ± 2 °C for upto 7 days and inspected daily for signs of growth. Broths were sub-cultured into 5% sheep Blood agar (BA), MacConkey agar (MA) and Chocolate agar (CA). Urine specimens were cultured on Cystine Lactose Electrolyte Deficient (CLED) agar and MA using a calibrated 0.001mL inoculating loop. Pus, tissue, body fluids and throat swabs were subjected to Gram staining and cultured on BA, MA and CA. Stool specimens were enriched in Selenite F broth for Salmonella and Shigella and Alkaline Peptone Water for Vibrio species, followed by sub-culture into XLD and TCBS respectively. All plates were incubated aerobically at 35 ± 2 °C for 24–48 h while CA plates were incubated in a 5–10% CO2 enriched atmosphere. Significant bacteriuria was defined as growth of ≥ 10⁵ CFU/mL.

Isolates were identified based on colony morphology, Gram staining and biochemical tests that included catalase, oxidase, oxidative/ fermentative, H₂S production, indole, motility, methyl red, Voges Proskauer, citrate utilization, urease and triple sugar iron (TSI) tests. Salmonella Typhi and Salmonella Paratyphi A were confirmed through serotyping using specific antisera. The details on biochemical identification scheme has been provided as Supplementary File 2.

Antibiotic susceptibility testing

Antibiotic susceptibility testing was performed using the modified Kirby-Bauer disk diffusion method on Mueller-Hinton Agar and results were interpreted according to Clinical and Laboratory Standards Institute (CLSI) supplement M100 2024 guidelines [13]. The bacterial suspensions were prepared so that the turbidity was equivalent to that of the 0.5 McFarland standard and uniformly inoculated onto MHA plates and incubated at 35 ± 2 °C for 16–18 h. The antibiotics were selected so that they included those commonly used for Gram-negative infections of different classes and included ampicillin (10 µg), ceftriaxone (30 µg), ceftazidime (30 µg), meropenem (10 µg), imipenem (10 µg), piperacillin/tazobactam (100/10 µg), gentamicin (10 µg), tobramycin (10 µg), levofloxacin (5 µg), ciprofloxacin (5 µg), amikacin (30 µg), nitrofurantoin (300 µg), cefotaxime (30 µg), amoxicillin-calvulanic acid (20/10 µg), cefepime (30 µg), chloramphenicol (30 µg), ofloxacin (5 µg), tetracycline (30 µg), doxycycline (30 µg), and trimethoprim-sulfamethoxazole (1.25/23.75 µg). The diameter of zone of inhibitions was measured in millimeters and was interpreted as susceptible, intermediate or resistant. Quality control was ensured using E.coli ATCC 25,922, P. aeruginosa ATCC 27853 and S. aureus 25923. This study adhered to the MICRO reporting guidelines for antimicrobial resistance surveillance.

Definition of multidrug resistance

Multidrug resistance (MDR) was defined as acquired non-susceptibility to at least one agent in three or more distinct antimicrobial categories. For the purposes of antimicrobial resistance categorization, isolates were considered non-susceptible if they were classified as either resistant or intermediate for a given agent [14].

Screening and confirmation of ESBL producers

Initial ESBL screening was performed using ceftazidime (30 µg) and cefotaxime (30 µg) discs. Isolates showing inhibition zones of ≤ 22 mm for ceftazidime and/or ≤ 27 mm for cefotaxime were considered potential ESBL producers. Confirmation was done using the combined disc method with ceftazidime (30 µg) and cefotaxime (30 µg) discs alone and in combination with clavulanic acid (30/10 µg). An increase in inhibition zone diameter of ≥ 5 mm in the presence of clavulanic acid confirmed ESBL production as per CLSI recommendations [13].

Detection of ESBL-associated genes (bla_CTX−M, bla_SHV and bla_TEM)

DNA was extracted from 108 phenotypically confirmed ESBL- producing isolates by boiling method [15]. Each extracted DNA was subjected to conventional PCR for the detection of bla_CTX−M, bla_SHV and bla_TEM genes using the primers and PCR conditions as described previously [16]. The thermal cycling conditions consisted of an initial denaturation at 95 °C for 10 min, followed by 10 cycles of denaturation at 95 °C for 30 s, annealing starting at 63 °C for 1 min (decreasing by 0.8 °C per cycle) and extension for 90 s. This was followed by 25 cycles of 95 °C for 30 s, 55 °C for 1 min and 72 °C for 90 s, with a final extension at 72 °C for 10 min. The specific primer sequences, melting temperatures and expected amplicon sizes used for this assay are detailed in Table 1.

Table 1.

PCR Primers used for the amplification of ESBL-associated genes

Primer	Direction	Sequence	Amplicon size (bp)	Reference
bla SHV	Forward	5’AGGATTGACTGCCTTTTTG3’	392	[17]
	Reverse	5’ATTTGCTGATTTCGCTCG3’
bla TEM	Forward	5’GAGACAATAACCCTGGTAAAT3’	459	[18]
	Reverse	5’AGAAGTAAGTTGGCAGCAGTG3’
bla CTX-M	Forward	5’TTTGCGATGTGCAGTACCAGTAA3’	544	[19]
	Reverse	5’CGAATCGTTGGTGGTGCCATA3’

Following amplification, the PCR products were visualized via gel electrophoresis on a 2% agarose gel stained with ethidium bromide at 70 V for 45 min. A 100 bp DNA ladder was used to determine the molecular weight of the amplicons (Fig. 1).

Fig. 1.

Bands visualized after UV fluorescence following agarose gel electrophoresis of PCR products (Lane 1- Marker 100 bp DNA, NC= Negative control, PC= Positive control, S1 = blaCTX−M and blaSHV positive, S2 = blaTEM and blaCTX−M positive, S3- blaTEM and blaCTX−M positive, S4 and S5- blaSHV, blaTEM and blaCTX−M positive)

Statistical analysis

Data were analyzed using SPSS version 24.0. Descriptive statistics were expressed as frequencies and percentages. As the expected cell counts were small, Fisher’s exact test was used to assess the association between MDR and ESBL production with a p-value < 0.05 considered statistically significant.

Storage and disposal procedures of biological/hazardous materials

All laboratory procedures were conducted in accordance with hospital biosafety guidelines. Biohazardous materials were disposed of following standard biomedical waste management protocols.

Results

Culture positivity and organism distribution

Out of 1485 clinical specimens processed, 478 (32.25%) were culture-positive. Among these, 411 (86.0%) were Gram-negative bacteria included in the analysis while 67 (13.9%) were Gram-positive which were excluded from the analysis. The majority of Gram-negative bacteria were isolated from urine (n = 363, 88.3%) followed by pus (n = 38, 9.3%), blood (n = 3, 0.7%) and wound swabs (n = 3, 0.7%) (Table 2).

Table 2.

Distribution of gram-negative bacterial isolates by specimen type (n = 411)

Organism	Blood n (%)	Pus n (%)	Wound swab n (%)	Throat swab n (%)	Tissue n (%)	Urine n (%)	Total n (%)
Escherichia coli	0	10 (2.4)	0	0	0	285 (69.3)	295 (71.8)
Klebsiella pneumoniae	0	7 (1.7)	1 (0.2)	1 (0.2)	0	55 (13.4)	64 (15.6)
Pseudomonas aeruginosa	0	7 (1.7)	0	1 (0.2)	0	9 (2.2)	17 (4.1)
Proteus mirabilis	0	7 (1.7)	1 (0.2)	0	1 (0.2)	1 (0.2)	10 (2.4)
Acinetobacter baumannii complex	0	5 (1.2)	0	0	0	4 (1.0)	9 (2.2)
Morganella spp.	0	1 (0.2)	0	0	1 (0.2)	3 (0.7)	5 (1.2)
Serratia spp.	1 (0.2)	0	0	0	0	2 (0.5)	3 (0.7)
Citrobacter spp.	0	1 (0.2)	1 (0.2)	0	0	1 (0.2)	3 (0.7)
Klebsiella oxytoca	0	0	0	0	0	2 (0.5)	2 (0.5)
Salmonella Paratyphi A	1 (0.2)	0	0	0	0	1 (0.2)	2 (0.5)
Salmonella Typhi	1 (0.2)	0	0	0	0	0	1 (0.2)
Total	3 (0.7)	38 (9.3)	3 (0.7)	3 (0.7)	2 (0.5)	363 (88.3)	411 (100.0)

Escherichia coli was the predominant bacteria, accounting for 295(71.8%) of the Gram- negative bacteria. Other significant pathogens included Klebsiella pneumoniae followed by Pseudomonas aeruginosa and Proteus mirabilis. Stratification by specimen type revealed that E. coli and K. pneumoniae were primarily isolated from urine, while non-fermenters were more frequent in pus and wound samples (Table 2).

Antimicrobial susceptibility patterns

Among Enterobacterales, Escherichia coli isolates demonstrated high susceptibility to meropenem (95.3%) and piperacillin/tazobactam (89.8%). Conversely, reduced susceptibility was observed for third-generation cephalosporins, including ceftriaxone (46.8%) and ceftazidime (39.7%). About 89.1% of the Klebsiella pneumoniae isolates were susceptible to meropenem and 92.1% to gentamicin but lower susceptibility to fluoroquinolones including levofloxacin (48.4%). Among non-fermenters, P. aeruginosa showed high susceptibility to antipseudomonal agents (meropenem 88.2%) while A. baumannii exhibited a concerning resistance profile with only 44.4% susceptibility to meropenem.

Proteus mirabilis and Citrobacter spp. showed good susceptibility to aminoglycosides and carbapenems. Salmonella isolates were highly susceptible to first line agents including ceftriaxone, ciprofloxacin and trimethoprim-sulfamethoxazole (Supplementary Table 1).

Multidrug resistance and ESBL production

Of the 411 isolates, 225 (54.7%) were multidrug- resistant (MDR). MDR was observed in 54.9% (162/295) of E. coli and 53.1% (34/64) of K. pneumoniae isolates.

Among 411 Gram-negative isolates, 385 were screened for ESBL production while P. aeruginosa (17) and A. baumannii (9) were not screened for ESBL production as recommended by CLSI guidelines. Among ESBL-screened Enterobacterales (n = 385), 108 (28.1%) were confirmed ESBL producers (Table 3).

Table 3.

Distribution of MDR and ESBL Among Gram-negative Isolates (n = 411)

Organism	Total n	MDR n (%)	ESBL screening positive n (%)	ESBL confirmed n (%)
Escherichia coli	295	162 (54.9)	146 (49.5)	87 (29.5)
Klebsiella pneumoniae	64	34 (53.1)	29 (45.3)	16 (25.0)
Pseudomonas aeruginosa	17	8 (47.1)	Not screened	Not screened
Proteus mirabilis	10	7 (70.0)	4 (40.0)	2 (20.0)
Acinetobacter baumannii complex	9	4 (44.4)	Not screened	Not screened
Morganella spp.	5	1 (20.0)	1 (20.0)	0
Serratia spp.	3	3 (100.0)	1 (33.3)	1 (33.3)
Citrobacter spp.	3	2 (66.7)	2 (66.7)	1 (33.3)
Klebsiella oxytoca	2	2 (100.0)	1 (50.0)	1 (50.0)
Salmonella Paratyphi A	2	2 (100.0)	1 (50.0)	0
Salmonella Typhi	1	0	0	0
Total	411	225 (54.7)	185 (48.1)	108 (28.1)

All 108 ESBL producers were MDR and ESBL production was significantly associated with MDR status (p < 0.001) (Table 4).

Table 4.

Association of ESBL Production with MDR Status

MDR Status	ESBL positive n (%)	ESBL negative n (%)	Total n	p-value*
MDR	108 (50.7)	105 (49.3)	213	< 0.0001
Non-MDR	0	172 (100.0)	172
Total	108 (28.1)	277 (71.9)	385

*Fisher’s exact test was used for statistical analysis

Prevalence of ESBL-associated genes in MDR enterobacterales

Molecular analysis was performed on phenotypically confirmed ESBL-producing MDR Enterobacterales (n = 108), excluding P. aeruginosa and A. baumannii complex in accordance with CLSI guidelines.

The bla_CTX-M was the most prevalent gene detected in 56.5% (61/108) of isolates followed by bla_TEM in 44.4% (48/108)and bla_SHV in 32.4% (35 /108) isolates. Co-occurrence of multiple ESBL-associated genes was identified in 51.9% (56/108) of the confirmed producers. Among the specific combinations, the dual carriage of bla_TEM + bla_CTX-M was the most frequent, appearing in 18.52% (n = 20), followed by bla_SHV + bla_CTX-M in 15.7% (n = 17) and bla_SHV + bla_TEM in 12.0% (n = 13) isolates. The presence of all three genes (bla_CTX-M+ bla_SHV + bla_TEM) was identified in 5.6% (n = 6) of the isolates. Organism-wise analysis revealed that E. coli and K. pneumoniae were the predominant carriers of both single and multiple ESBL-associated genes, while other isolates including P. mirabilis and K. oxytoca also contributed to the reservoir of multiple resistance determinants (Table 5).

Table 5.

Distribution of ESBL-associated genes among phenotypically confirmed ESBL producing MDR Enterobacterales (n = 108)

Organism N	blaCTX−M only n (%)	blaSHV only n (%)	blaTEM only n (%)	blaSHV + blaTEM n (%)	blaSHV + blaCTX−M n (%)	blaTEM + blaCTX−M n (%)	blaSHV + blaTEM + blaCTX−M n (%)	Total (%)
Escherichia coli (87)	20 (23.0)	7 (8.0)	16 (18.4)	12 (13.8)	11 (12.6)	16 (18.4)	5 (5.7)	87 (80.6)
Klebsiella pneumoniae (16)	3 (18.8)	1 (6.3)	3 (18.8)	1 (6.3)	5 (31.3)	2 (12.5)	1 (6.3)	16 (14.8)
Proteus mirabilis (2)	0	0	0	0	1 (50.0)	1 (50.0)	0	2 (1.9)
Klebsiella oxytoca (1)	0	0	0	0	0	1 (100.0)	0	1 (0.9)
Citrobacter spp. (1)	0	1 (100.0)	0	0	0	0	0	1 (0.9)
Serratia spp. (1)	1 (100.0)	0	0	0	0	0	0	1 (0.9)
Total n (%)	24 (22.2)	9 (8.3)	19 (17.6)	13 (12.0)	17 (15.7)	20 (18.5)	6 (5.6)	108 (100.0)

Discussion

Antimicrobial resistance among Gram-negative bacteria is an escalating public health concern in Nepal and globally [2]. In this study, the culture positivity rate was 32.2% with urinary specimens predominating (88.3%). This reflects a high burden of urinary tract infections, particularly due to E. coli and K. pneumoniae. These findings are consistent with previous reports from Nepal, highlighting the widespread presence of Enterobacterales in clinical settings [10, 20]. Our findings showed that carbapenems (imipenem and meropenem) and piperacillin/tazobactam remain the most effective therapeutic options for the isolates studied. Mechanistically, ESBLs hydrolyze third- and fourth-generation cephalosporins and monobactams, while carbapenems generally resist hydrolysis by these specific enzymes, preserving their clinical utility in this setting. However, the reduced activity of fluoroquinolones and aminoglycosides is concerning. Non-fermenters like P. aeruginosa and A. baumannii also displayed concerning resistance, highlighting their clinical importance in hospital-acquired infections.

Multidrug resistance was observed in 54.7% of isolates, with E. coli and K. pneumoniae accounting for the majority of MDR isolates. We observed a significant association between ESBL production and MDR, with 100% of ESBL producers exhibiting the MDR phenotype. These results align with prior Nepalese studies emphasizing the role of plasmid-mediated co-resistance, where plasmids harboring ESBL genes frequently carry additional determinants for resistance to other antibiotic classes such as aminoglycosides and fluoroquinolones [21, 22].

Molecular analysis identified bla_CTX−M as the most prevalent ESBL- associated gene followed by bla_TEM and bla_SHV. The global dominance of CTX-M enzymes is well-documented and is largely facilitated by plasmid-mediated horizontal gene transfer, allowing for rapid dissemination within both hospital and community environments. A critical limitation of our study is that PCR alone cannot definitively distinguish between narrow-spectrum β-lactamase variants e.g. TEM-1, SHV-1 and true ESBL variants without sequencing. Consequently, these are reported as ESBL-associated genes to avoid overestimating true ESBL prevalence. E. coli and K. pneumoniae were the primary carriers, whereas less frequent organisms such as Citrobacter spp., Serratia spp. and Morganella spp. also harbored ESBL genes, suggesting their potential role as reservoirs of AMR. These findings are consistent with other researchers from Nepal [20].

Notably, we detected the co-occurrence of all three ESBL-associated genes (bla_TEM+ bla_CTX−M + bla_SHV). While triple-gene carriage has been reported in urban centers like Kathmandu and in countries such as India, Bangladesh and Romania, our findings represent among the first reports specifically from the geographically underserved Far-Western region of Nepal [7, 23]. Mahakali Provincial Hospital serves a peripheral population near the Nepal-India border, where resistance patterns may be influenced by distinct healthcare infrastructure challenges and cross-border antibiotic use. The high prevalence of ESBL- producing Enterobacterales among outpatients (primarily in urine samples) suggests a significant community-level burden of resistance. These findings emphasize the urgent need for enhanced diagnostic capacity and region-specific antimicrobial stewardship interventions to prevent the local spread of highly resistant pathogens.

The study has several limitations that should be considered. First, as a single-center study with relatively short geographic scope, the findings may not be generalizable to other provinces. Second, the lack of sequencing prevented the identification of specific gene subtypes. Finally, the absence of patient level clinical data such as prior antibiotic exposure or hospitalization history limits our ability to fully differentiate between community- and hospital-acquired infections.

Conclusions

Gram-negative bacterial isolates from a provincial hospital in Far-Western Nepal exhibit a high prevalence of MDR and ESBL-associated genes, including the concerning co-carriage of triple resistance determinants. These findings underscore the urgent need for continuous molecular surveillance and the implementation of targeted antimicrobial stewardship programs in peripheral regions to mitigate the escalating threat of AMR.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

S.S. and D.R.B.: conceptualization; M.S.B.: laboratory analysis and manuscript draft; S.S. and D.R.B. supervision and reviewed the manuscript; all authors approved the final version of manuscript.

Funding

The authors didn’t receive any funds for the study.

Data availability

All data generated or analysed during this study are included in this published article.

Declarations

Ethics approval and consent to participate

Ethical approval of this study was obtained from Nepal Health Research Council (NHRC) (Reference No. 826/2024; approved on 24 October 2024). Specimens were collected as part of routine clinical care and patient identifiers were anonymized prior to analysis so as to maintain the confidentiality of the patient information. Informed consent was obtained from each participant before their samples were processed for this research. All procedures were conducted in accordance with the ethical standards of the institutional and national research guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.