Skip to main content
NCBI home page
IBRO Neuroscience Reports logoLink to IBRO Neuroscience Reports
. 2025 Nov 10;21:790–800. doi: 10.1016/j.ibneur.2025.11.010

FNDC5-overexpressed BMSCs attenuated brachial plexus root avulsion by enhancing BMSCs survival and inhibiting motoneurons apoptosis

Bohan Li a,b,1, Yunong Ao a,1, Jingming He a, Yuexing Zhang a, Shenyou Feng b, Zixiang Long a, Jin Zhang a,⁎, Zhongyang Li a,⁎
PMCID: PMC13587740  PMID: 42761559

Abstract

Background

Brachial plexus root avulsion (BPRA) causes severe motor function impairment. Inhibition of spinal motoneuron (MN) apoptosis is crucial for BPRA treatment. This study explores the mechanisms by which Fibronectin Type III Domain Containing 5 (FNDC5)-modified bone marrow mesenchymal stem cells (FNDC5/BMSCs) attenuate BPRA.

Methods

BMSCs were transduced with FNDC5, and their anti-apoptotic effects under hypoxia were evaluated. Exosomes (hereinafter referred to as exos) were extracted and characterized. The biological functions of NSC34 cells were assessed using CCK-8 and flow cytometry. FNDC5-overexpressed BMSCs were transplanted into BPRA mice to evaluate therapeutic effects.

Results

FNDC5 overexpression significantly enhanced BMSC viability and reduced hypoxia-induced apoptosis. FNDC5/BMSCs exhibited decreased levels of cleaved caspase-3 and Bax, while Bcl-2 expression increased. FNDC5 was efficiently transferred into exosomes, which attenuated NSC34 cell apoptosis and regulated BDNF expression. In vivo, FNDC5/BMSCs improved forelimb motor function, reduced MN apoptosis, and increased MN axon numbers.

Conclusion

FNDC5-engineered BMSCs promote BPRA recovery by enhancing BMSC survival and inhibiting MN apoptosis, suggesting a potential therapeutic strategy for BPRA.

Keywords: Brachial plexus root avulsion, Apoptosis, Bone marrow mesenchymal stem cells, FNDC5, Exosomes

1. Introduction

Brachial plexus root avulsion (BPRA) represents a severe injury resulting from the traction of the spinal cord root. Given its high incidence among young adults, BPRA imposes a substantial psychological and economic burden on patients and their families (Huang et al., 2024). This injury not only affects the corresponding spinal cord segment, leading to the loss of sensory and motor functions in the innervated area, but approximately 70 % of BPRA cases also impact the surrounding spinal cord segments, causing longitudinal spinal cord lesions (Wade et al., 2019). Current treatment methods for BPRA, such as nerve transfer or functional muscle transplantation and reconstruction, are plagued by issues like challenging treatment procedures, suboptimal curative effects, and an enlarged damage range (Kittithamvongs et al., 2025). BPRA can lead to a significant number of motor neuron (MNs) deaths in the anterior horn of the injured spinal cord, yet the underlying mechanism remains unclear (Li et al., 2021). Recent research has demonstrated that apoptosis is the primary mode of cell death during the secondary injury stage following nerve injury (S. Chen et al., 2019; Lu et al., 2022). Apoptosis, a cell-death process initiated by apoptosis-related genes, is influenced by various physiological and pathological factors. Besides apoptosis-related genes, numerous inflammatory mediators, cytokines, calcium ions, and reactive oxygen species also play roles in regulating apoptosis (Ma et al., 2024). Therefore, devising strategies to reduce or inhibit cell apoptosis is crucial for minimizing neuronal death and promoting spinal cord function recovery after BPRA.

Bone marrow mesenchymal stem cells (BMSCs) possess robust self-replication capabilities and multi-directional differentiation potential (Baker et al., 2015). As multipotent stem cells, they can differentiate into osteoblasts, vascular cells, skeletal muscle cells, and nerve cells under the influence of different inducing factors (Chu et al., 2020). BMSCs have been increasingly explored for the treatment of nerve injury (Cofano et al., 2019, Ha et al., 2020). Moreover, studies have revealed that the exosome (exos)-mediated paracrine function of BMSCs contributes significantly to their therapeutic effects (Harrell et al., 2019). The exosomes secreted by MSCs increase the growth of neurites in vitro and promote the regeneration of neurites in mice with sciatic nerve injury (Bucan et al., 2019). Dong et al. suggested that MSC-exos inhibit neuronal cell apoptosis, thereby facilitating the repair of sciatic nerve injury, although the underlying mechanism remains uncertain (Dong et al., 2019).

FNDC5, a type I transmembrane protein, is involved in regulating numerous metabolic-related biological processes (Askari et al., 2018). Currently, its anti-inflammatory, anti-apoptotic, and anti-oxidant properties have attracted extensive attention. FNDC5 deficiency can cause oxidative damage and increase apoptosis in H9C2 cells. Conversely, FNDC5 overexpression reduces DOX-induced cardiomyocyte apoptosis both in vivo and in vitro by activating the AKT/mTOR signaling pathway (Zhang et al., 2020). Additionally, FNDC5 has been reported to contribute to neuroprotective effects. Studies have shown that FNDC5 is down-regulated in mice with nerve damage, and its administration can improve rat spinal cord injury and motor dysfunction. Moreover, FNDC5 treatment inhibits the reduction in cell viability and neurite length induced by LPS in PC12 cells (Farzad et al., 2018). However, the role of FNDC5 in improving nerve damage following BPRA remains elusive.

In this study, we transduced FNDC5 into BMSCs to establish FNDC5-overexpressing BMSCs, which were then injected into BPRA mice. We aimed to investigate their effects on inhibiting MNs apoptosis and the underlying mechanisms, with the hope of providing novel insights and potential therapeutic strategies for BPRA treatment.

2. Material and methods

2.1. Overexpression of FNDC5 in BMSCs

Primary mice BMSCs were isolated and cultured as follows: After extracting the bone marrow, a suspension was prepared in DMEM (Gibco, USA) medium containing 10 % newborn calf serum (Gibco, Thermo Fisher, USA) and 50 % MTEC1-SN (the culture supernatant of murine thymic epithelial cell line). MTEC1-SN (MTEC1-conditioned medium) was prepared as described previously (Chen et al., 1992): MTEC1 cells were grown to 80–90 % confluence, washed, and incubated in serum-free DMEM for 48 h; the supernatant was then centrifuged (2 000 × g, 10 min), sterile-filtered (0.22 µm), aliquoted and stored at −80 °C. The cells were then cultured at 37 °C in a 5 % CO₂ incubator. After 10 days, non-adherent suspension marrow cells were removed by changing the culture medium, leaving adherent mesenchymal cells to grow stably. The obtained BMSCs were further cultured in DMEM medium with 10 % newborn calf serum.

BMSCs at a density of 1 × 10⁴ cells/well were transduced with lentivirus expressing FNDC5 and GFP (Weizhen, China) following the manufacturer's instructions. After 24 h of transduction, the transduction efficiency was evaluated by immunofluorescence. Once the FNDC5-overexpressing BMSCs were successfully established, the cells were cultured for an additional 3–5 days in fresh cell culture medium for subsequent experiments.

After 24 h of transduction, the transduction efficiency was evaluated by immunofluorescence. Briefly, BMSCs were fixed with 4 % paraformaldehyde for 15 min and then permeabilized with 0.1 % Triton X-100. After blocking with 5 % BSA in PBS for 1 h, the cells were incubated with an anti-FNDC5 antibody (Cat No. 23995–1-AP, Proteintech, Wuhan, China) overnight at 4°C. The next day, the cells were washed with PBS and incubated with a secondary antibody conjugated to Alexa Fluor 488 (A11008, Invitrogen) for 1 h at room temperature. The cells were then stained with DAPI (Beyotime, China) to label the nuclei. Fluorescent images were acquired using a fluorescence microscope (Leica TCS SP5, Germany).

For FNDC5 overexpression, a lentiviral vector was constructed on a pLV backbone with the CMV promoter driving FNDC5 expression. GFP was co-expressed through a P2A linker, allowing independent translation of FNDC5 and GFP from the same transcript. The vector was constructed with the full-length coding sequence of mouse FNDC5 under the control of the cytomegalovirus (CMV) promoter. The green fluorescent protein (GFP) reporter gene was linked to the C-terminus of FNDC5 via a T2A self-cleaving peptide, allowing co-expression of separate FNDC5 and GFP proteins. The viral particles were titrated to 1 × 10^8 TU/mL. BMSCs at a density of 1 × 10⁴ cells/well were transduced with this lentivirus at a multiplicity of infection (MOI) of 50, following the manufacturer's instructions. A control group was transduced with an empty vector lentivirus containing only GFP (Vector group). After 24 h of transduction, the transduction efficiency was evaluated by observing GFP fluorescence and immunofluorescence. Once the FNDC5-overexpressing BMSCs were successfully established, the cells were cultured for an additional 3–5 days in fresh cell culture medium for subsequent experiments.

2.2. Immunofluorescence

Tissue sections were fixed with 4 % paraformaldehyde (Beyotime, China) and permeabilized using 0.05 % TritonX-100. After blocking with a suitable blocking buffer (5 % bovine serum albumin in PBS), the cells were incubated overnight at 4°C with a primary antibody against NF200 and anti-choline acetyltransferase (ChAT). The next day, the cells were washed three times with PBS, and then incubated with a secondary antibody (goat anti-rabbit IgG conjugated with Alexa Fluor 488) at room temperature for 1 h. Subsequently, the cells were stained with diamidino-phenyl-indole (DAPI) to label the nuclei. Finally, and images were captured using a fluorescence microscope (Leica TCS SP5, Germany) at 20 × magnification.

2.3. Cell apoptosis analysis

Cell apoptosis was detected using the FITC Annexin V apoptosis detection kit (KeyGen, China). Cells (1 ×10⁶ cells/500 μL) were incubated with Annexin V-FITC and propidium iodide (PI) on ice for 15 min. After washing with precooled PBS, the cells were further stained with FITC Annexin V in the dark for 15 min. The cells were then washed twice with cold PBS, and the apoptosis rate was analyzed by flow cytometry.

2.4. Real-time quantitative reverse transcriptase (qRT-PCR)

Total RNA was extracted from BMSCs and mouse tissues using TRIzol reagent. Subsequently, 1 μg of RNA was reverse-transcribed into cDNA using a reverse transcription kit (Seyotin, Guangzhou, China). Finally, the cDNA was used as a template for amplification with qPCR mix (Seyotin, Guangzhou, China). The quantitative levels of genes were normalized to β-actin. All primers used in the experiment are listed in Table 1.

Table 1.

Primer sequences used for qRT-PCR.

Genes Primer Sequences (5’→3’)
FNDC5 F: TGGAGGAGGATACGGAGTACA
GCCCCAGTGTTCAGACTACC
GCCCCAGTGTTCAGACTACC
R: CCACATGAACAGGACCACGA
Bcl2 F: GGTGGGGTCATGTGTGTGG
R: CGGTTCAGGTACTCAGTCATCC
Bax F: CCCGAGAGGTCTTTTTCCGAG
R: CCAGCCCATGATGGTTCTGAT
BDNF F: TCATACTTCGGTTGCATGAAGG
R: ACACCTGGGTAGGCCAAGTT
IL−1β F: CTGTGGCAGCTACCTGTGTC
R: CGTCACACACCAGCAGGTTA
IL−6 F: AACAACGATGATGCACTTGCAG
R: GGTACTCCAGAAGACCAGAGGA
TNF-α F: CCAAATGGCCTCCCTCTCAT
R: TGGCACCACTAGTTGGTTG
GAPDH F: CGTAAAGACCTCTATGCCAACA
R: CGGACTCATCGTACTCCTGCT
Open in a new tab

2.5. Western blot analysis

Total proteins from cells and tissues were extracted using RIPA lysate (Beyotime, China). The protein concentration was determined by the BCA kit. After SDS-Page gel electrophoresis, the proteins were transferred to a PVDF membrane. The membrane was blocked with 5 % BSA at room temperature for 1 h. Then, it was incubated overnight at 4°C with primary antibodies. For detecting cleaved caspase-3, Bax, Bcl-2, BDNF and FNDC5 (rabbit anti-cleaved caspase-3 antibody from Cell Signaling Technology; mouse anti-Bax antibody from Santa Cruz Biotechnology; rabbit anti-Bcl-2 antibody, rabbit polyclonal anti- BDNF and rabbit anti-FNDC5 antibody from Abcam). The next day, the membrane was washed three times with TBS-T, and then incubated with secondary antibodies (anti-rabbit IgG-HRP and goat anti-mouse IgG-HRP) at room temperature for 1 h. The protein bands were visualized by ECL quantification detection (Seyotin, Guangzhou, China), and high-quality images were captured for analysis.

2.6. Exos isolation and identification from transduced BMSCs

Exosomes were isolated from BMSC supernatants by ultracentrifugation. Exosome morphology was confirmed by transmission electron microscopy (TEM), and markers (CD9, TSG-101) were detected by Western blot. Nanoparticle tracking analysis (NTA) was employed to measure the particle size of exosomes.

2.7. Exos labeling and internalization

Exosomes were labeled with PKH67 fluorescent dye (Sigma, USA) according to the manufacturer's protocol. Briefly, exosomes were incubated with PKH67 dye at room temperature for 30 min. After washing to remove unbound dye, the labeled exosomes were co-cultured with NSC34 cells for 2 h. Then, the cells were fixed with 4 % paraformaldehyde for 15 min, washed with PBS, cells were fixed, stained with DAPI, and imaged using a confocal microscope (Zeiss LSM 780, Germany) at 40 × magnification.

2.8. Cell viability assay

5 × 10 ³ NSC34 cells were seeded in a 96-well plate and incubated for 24 h. Then, cell viability was measured using the cell counting kit 8 (Seyotin, Guangzhou, China). The optical density (OD) value at 450 nm was measured using a versatile microplate reader.

2.9. Animal experiments

Male C57BL/6 mice (6 weeks old, n = 40), obtained from and raised in Guangzhou Ruige Biological Technology Co., LTD, were used in this study. All mice were housed under a 12-hour light/dark cycle and had free access to food and water. The mice were randomly divided into four groups: PBS control group, BMSCs group, BMSCs/Vector group, and BMSCs/FNDC5 group.

A brachial plexus root avulsion (BPRA) mouse model was established as follows: Mice were anesthetized with 2–3 % isoflurane volatilized by oxygen flow, and anesthesia was maintained with 1.5–2 % isoflurane. The mice were then fixed in a prone position on a surgical table. After performing a right hemilaminectomy at the C4-C6 level and opening the dura mater, the right C5–7 proximal stump dorsal root and ventral root were excised for 2–5 mm. Buprenorphine (0.1 mg/kg, subcutaneously) was administered immediately post-surgery, followed by an injection of penicillin-streptomycin (10,000 U/mL; Thermo Fisher Scientific, Waltham, MA, USA) for the first 3 days after the procedure. The mice were subsequently placed on a heating pad for 1–2 h to facilitate recovery before being returned to their respective cages. The next day, the successful establishment of the model was confirmed by observing that the mice were unable to raise their right forelimbs due to instability in performing shoulder abduction and elbow flexion.

After confirming the model, BMSCs were injected into the site of brachial plexus root avulsion every two weeks. The BMSCs were resuspended in PBS at a concentration of 1 × 10⁶ cells per mouse, with an injection volume of 100 μL. At 1, 2, 3, 4, 5, 6, 7, and 8 weeks after injection, the Terzis Grooming Test (TGT) was performed to evaluate the recovery of motor function. At specific time points (1, 3, and 7 day), fluorescence images were captured using an in vivo imaging system to assess the biodistribution of FNDC5/BMSCs. Eight weeks after injection, the mice were placed in a dedicated carbon dioxide euthanasia chamber. Carbon dioxide gas was introduced into the chamber at a rate of 10–30 % of the chamber volume per minute until the mice stopped breathing. After observing the cessation of breathing, the carbon dioxide gas was continuously introduced for 1 min to ensure the death of the mice. The mice were euthanized in this way for further histological analysis. All animal procedures were approved by the Guide of Animal Care and Use Committee of Guizhou Provincial People's Hospital (GZPH2023035).

2.10. Terzis grooming test (TGT)

The recovery of motor function was measured every week using the TGT. Purified water was sprayed on the snout of mice, and the movements of the forepaw were videotaped for > 5 min. The scoring criteria are as follows: 0, no movement; 1, elbow flexion but unable to touch the snout; 2, elbow flexion and able to touch the snout; 3, elbow flexion and able to reach below the eye; 4, elbow flexion and able to reach the eye; and 5, elbow flexion and able to reach the ear or back of the ear (Bertelli & Mira, 1993).

2.11. Nissle staining

The sections of spinal cord were fixed by 4 % paraformaldehyde for 1 h. After washing with PBS twice for 5 min, sections were stained by 1 % toluidine blue for 20–30 min at room temperature. Then, color separation was performed using 70 %, 80 %, 95 %, 100 % alcohol under a microscopy. After drying at 37 ℃, sections were transparent with xylene and finally sealed with neutral gum.

2.12. TUNNEL staining

The sections of spinal cord were fixed by 4 % paraformaldehyde for 30–60 min. After washing with PBS twice for 10 min, sections were permeabilized using 0.05 % TritonX-100 (Servicebio) for 5 min. TUNEL detection fluid was configured with TdT enzyme and fluorescent marker fluid at a ratio of 1: 9. Then, sections were incubated with TUNEL detection fluid at 37 ℃ for 60 min in dark. After washing with PBS for 3 times, the tablets were sealed with anti-fluorescence quenching sealing solution. Finally, sections were observed under fluorescence microscope with the 450–500 nm excitation wavelength and the 515–565 nm emission wavelength.

2.13. Statistical analysis

Data were represented as means ± standard deviation (SD) and analyzed for the significant difference using GraphPad Prism version 9.5. Differences between two groups were detected by the t test and between multiple groups by the ANOVA test. The difference was considered as statistically significant when P < 0.05.

3. Results

3.1. Establishment of FNDC5-overexpressed BMSCs

To establish the FNDC5-overexpressed BMSCs, FNDC5-loaded lentivirus was transduced into BMSCs. After 24 h, immunofluorescence was performed for the measurement of transduction efficiency, which was showed in Fig. 1A. Additionally, these results from RT-qPCR analysis and Western blotting further determined that compared with the Vector transduction group, the expression of FNDC5 increased significantly in the FNDC5 transduction group (Fig. 1B and C). All the above results suggested the successful establishment of the FNDC5-overexpressed BMSCs.

Fig. 1.

Fig. 1

Open in a new tab

Establishment of BMSCs overexpressing FNDC5. (A) 48 h after transduction, the efficiency was identified using immunofluorescence. (B) The mRNA expression level of FNDC5. (C) The protein expression level of FNDC5. Data are shown as the means ± SD, n = 3. *P < 0.05, ** P < 0.01.

3.2. FNDC5 inhibit hypoxia-induced apoptosis

Exposure to hypoxia increases cell apoptosis. Annexin V analysis was conducted to explore the inhibition of FNDC5 on hypoxia-induced decreased cell viability. As shown in Fig. 2A, compared with normal condition, the apoptosis rate of BMSCs exposed to hypoxia was greatly increased. However, FNDC5 overexpression in BMSCs significantly improved cell viability reduced by hypoxia. FNDC5 overexpression also reduced the mRNA level of Bax and elevated Bcl-2 level (Fig. 2B). In addition, western blotting showed that the expressions of cleaved caspase-3 and Bax (pro-apoptotic) in FNDC5/BMSCs group were lower than those in Vector/BMSCs group, and the expression of Bcl-2 (anti-apoptotic) in FNDC5/BMSCs group was higher than that in Vector/BMSCs group (Fig. 2C).

Fig. 2.

Fig. 2

Open in a new tab

FNDC5 inhibits the apoptosis of BMSCs under hypoxia for 48 h. BMSCs with or without the transduction of FNDC5 under normoxia, hypoxia for 48 h (A) Flow cytometry analyses for cell viability. (B) mRNA levels of Bax and Bcl2. (C) Protein expression of cleaved caspase-3, Bax and Bcl2. Data are shown as the means ± SD, n = 3. *P < 0.05, ** P < 0.01.

3.3. The expression of FNDC5 in BMSCs exosomes

Next, we investigated the potential mechanism by which FNDC5 prevents hypoxia from reducing cell viability. Studies have reported that exos secreted by BMSCs have the same function as the source cells. Consequently, we next detected whether FNDC5 inhibits hypoxia-induced apoptosis through exos. We first extracted exos from each of the three groups of BMSCs, which had a typical cup shape, and the size of exosomes was about 102 ± 7 nm by NTA (Fig. 3 A-B). Besides, exos markers (CD9 and TSG-101) were expressed in all three groups (Fig. 3C). Western blotting was performed for the measurement of FNDC5 expression, and showed that compared with the other two groups, the FNDC5 level was higher in exos derived from FNDC5 - overexpressed BMSCs (Fig. 3D). These results suggested that BMSCs efficiently transferred FNDC5 into the secreted exos. Then, exos containing FNDC5 were labeled with PKH67 dye and taken up by NSC34 cells (Fig. 3E).

Fig. 3.

Fig. 3

Open in a new tab

Exos derived from FNDC5-overexpressing BMSCs. (A) Transmission electron photomicrograph of EXs. (B)Exosome size distribution determined by nanoparticle tracking analysis. (C) Protein expression of CD9. (D) Protein expression of FNDC5. (E) Confocal images of PKH67-labeled Exos taken up by NSC34 cells. Data are shown as the means ± SD, n = 3. *P < 0.05, ** P < 0.01.

3.4. Exosomes containing FNDC5 attenuate apoptosis in NSC34 cells

Next, we explored the effect of exos containing FNDC5 on the inhibition of apoptosis. After the co-culture of exos for 24 h, 48 h and 72 h, the cell viability was detected by CCK-8 kits. Fig. 4A showed that the apoptosis rate of NSC34 cells with FNDC5-loaded exos was markedly lower than that of the other two groups (P < 0.05), which was similar to the results of Annexin V analysis (Fig. 4B). Moreover, FNDC5-loaded exos remarkably reduced the mRNA and protein levels of Bax and cleaved caspase-3, and increased Bcl-2 level of NSC34 cells (Fig. 4C and D, all P < 0.05). Collectively, FNDC5-loaded Exos improved apoptosis of NSC34 cells. BDNF is a major mediator of certain beneficial effects on the brain. Next, we determined whether FNDC5 could regulate the expression of BDNF gene. As shown in Fig. 5A-B, FNDC5-loaded Exos notably elevated BDNF gene expression, as well as the protein expression.

Fig. 4.

Fig. 4

Open in a new tab

FNDC5-loaded Exos Attenuate Apoptosis in NSC34 cells. NSC34 cells were co-cultured with BMSCs-exos, Vector/BMSCs-exos and FNDC5/BMSCs-Exos for 72 h. (A) CCK-8 assay for cell viability. (B) Results of the flow cytometry analyses for apoptosis. (C) mRNA levels of Bax and Bcl2. (D) Protein expression of cleaved caspase-3, Bax and Bcl2. Data are shown as the means ± SD, n = 3. *P < 0.05, ** P < 0.01.

Fig. 5.

Fig. 5

Open in a new tab

FNDC5 regulates BDNF gene expression in NSC34 cells. (A) mRNA levels of BDNF. (B) Protein expression of BDNF. Data are shown as the means ± SD, n = 3. *P < 0.05, ** P < 0.01.

3.5. FNDC5-overexpressed BMSCs promoted the recovery of forelimb motor function and increased the number of MN after BPRA

To confirm the findings acquired above, we transplanted FNDC5-overexpressed BMSCs into BPRA mice and then determined whether FNDC5-overexpressed BMSCs improves functional recovery following BPRA. TGT results showed that compared the three other group, mice in the FNDC5-overexpressed BMSCs group had higher mean TGT scores at 8 weeks after transplantation (Fig. 6A and B). Fig. 7A and Fig. S1D showed that BMSC overexpression of FNDC5 can enhance the recovery of motor neurons by Nissl staining and ChAT fluorescence. In addition, the number of NF200-labeled axons in the FNDC5-overexpressed BMSCs group were higher than that of BMSCs group (Fig. 7B). Moreover, we also observed that FNDC5-overexpressed BMSCs treatment significantly inhibited apoptosis in mice (Fig. 7C). These results demonstrated that FNDC5-overexpressed BMSCs promoted the recovery of forelimb motor function and increased the number of MN following BPRA. To evaluate the targeting delivery capacity of FNDC5/BMSCs at the injury site, DiD-labeled FNDC5/BMSCs were administered, and in vivo fluorescence imaging was performed at 1, 3, and 7 day post-injury (Fig. S1A). Western blot analysis showed a significant increase in BDNF protein expression in the FNDC5/BMSCs group compared to the Vector/BMSCs group (Figure S1B). qPCR results indicated a significant reduction in the relative mRNA levels of IL-1β, IL-6, and TNF-α in the FNDC5/BMSCs group (Figure S1C).

Fig. 6.

Fig. 6

Open in a new tab

FNDC5 promotes functional motor recovery after BPRA in mice. FNDC5-overexpression BMSCs were injected into mice after BPRA (A) Positions of forelimbs and corresponding scores in grooming tests: 0, no movement; 1, elbow flexion but unable to touch the snout; 2, elbow flexion and able to touch the snout; 3, elbow flexion and able to reach below the eye; 4, elbow flexion and able to reach the eye; and 5, elbow flexion and able to reach the ear or back of the ear. (B) Average Terzis grooming test score. Data are shown as the means ± SD, n = 10. *P < 0.05, ** P < 0.01.

Fig. 7.

Fig. 7

Open in a new tab

FNDC5 increases the number of MNs after BPRA in mice. (A) Representative images of Nissl-positive neurons. (B) Numbers of NF2000-positive MN axons. (C) Tunel test for apoptosis. Data are shown as the means ± SD, n = 10. *P < 0.05, ** P < 0.01.

4. Discussion

In the present study, our data indicated that FNDC5 overexpression inhibited hypoxic stress-induced apoptosis in BMSCs. Interestingly, FNDC5-loaded exos secreted by BMSCs also exert notable anti-apoptotic effect in NSC34 cells and promotes NSC34 growth by regulating BNDF expression. Furthermore, FNDC5-overexpressed BMSCs transplantation decreased the apoptosis of MNs, and finally improved motor function. Collectively, our findings demonstrated that FNDC5 might be a proposed optimized strategy of BMSCs therapy for BPRA（Fig. 8).

Fig. 8.

Fig. 8

Open in a new tab

Mechanism diagram.

Apoptosis is considered to be the main way of cell death in secondary injury stage after nerve injury. Brown et al. speculated that MNs lost the maintenance of nerve growth factor from target tissue or myelin Schwann cells, which started the cell death program, and then induced apoptosis through a series of continuous start - up of genes and signal transduction (Kuta et al., 2020). Therefore, inhibition of apoptosis is of great significance to reduce neuronal death and promote the rehabilitation of spinal cord function. Xu et al. reported that BMSCs protected against liver injury via suppressing hepatocyte apoptosis and activating TGF-β1/Bax singling pathway (Xu et al., 2017). BMSC-derived exosomal miR-29b-3p ameliorated ischemic brain injury by promoting angiogenesis and suppressing neuronal apoptosis while BMSCs-miR-146a-5p-Exos administration significantly improved neurological function and reduced apoptosis, which associated with the inhibition of microglial M1 polarization by downregulating the expression of IRAK1 and NFAT5 (Duan et al., 2020). These findings were consistent with our conclusions in the present study. We found that after injection of BMSCs, the apoptosis in BPRA mice was significantly reduced, thus increasing the number of MNs axons.

In recent years, increasing studies confirmed that the paracrine function of BMSCs accounted for its therapeutic effect (Fu et al., 2019; He et al., 2018) EXs are an important paracrine effector component, which belongs to one of the extracellular vesicles. It is produced by endosome pathway in almost all cells (Wortzel et al., 2019). EXs (diameter 30–100 nm) are composed of phospholipid bilayers and bioinformatics materials such as lipids, proteins and nucleic acids, which play an important role in intercellular information transmission (He et al. 2018). Studies have confirmed that BMSCs-EXs could exert effective efficiency in the repair of myocardial infarction, acute kidney injury and nerve injury in animal models (Sahoo and Losordo, 2014, Shiue et al., 2019, Thongboonkerd, 2019). Latest research indicated that BMSCs-EXs promoted the regeneration of MNS nerve bundle based on its characteristic of anti-inflammatory and growth promoting effects, but the related mechanism remains to be further studied (Liu et al., 2020). In this study, we found that BMSCs-EXs repaired the nerve injury caused by BPRA via blocking MNs apoptosis, which is basically consistent with the reported conclusion.

The protein structure of FNDC5 consists of an N-terminal signal sequence, an irisin region, a short transmembrane region and a C-terminal domain (Zhang et al., 2020). The physiological functions of FNDC5 include mediating the interaction among muscle, adipose tissue and bone, developing and maintaining the skeletal system, and regulating fat metabolism (de Macêdo et al., 2017). Some attention has also been paid to its anti-apoptotic property. In the animal model of Alzheimer's disease, overexpression of FNDC5 in n2a cells counteracted the effect of Aβ1–42 oligomer on neuronal apoptosis (Xia et al., 2017). Our study indicated that the number of apoptotic cells in each BMSCs injection group was much lower than that in the Control group, and the lowest number of apoptotic cells was found in the FNDC5 overexpression BMSCs group. Therefore, according to the in vivo and in vitro findings, we drew a conclusion that the overexpression of FNDC5 inhibited apoptosis and thus repaired nerve injury following BPRA, which might be through the regulation of BDNF. BDNF is expressed in many tissues, including nerve, musculoskeletal and heart(Antolasic et al., 2024). This protein regulates neuronal development and function, such as survival and differentiation of different neuronal populations, synaptic transmission and plasticity, and neuronal repair after injury (Erickson et al., 2012). BDNF is reported to be mediated by cAMP responsive element binding (CREB) and mTOR-involved signaling pathways (Cardoso et al., 2018). Studies have shown that the sensory neurons of coordination, balance and hearing in mice would be lost after BDNF knockout (Deng and Chen, 2024). BDNF is also an important modulator of inflammation, autophagy and oxidative stress, which contributes to improve mitochondria performance and attenuate neuronal metabolic defects after injury (Lima Giacobbo et al., 2019). Therefore, FNDC5 may play a neuroprotective role by up-regulating the BDNF level, which may be a novel idea for the BPRA treatment. However, the specific mechanism requires further investigations. BPRA is a common clinical disease, which may progress to spinal cord dysfunction.

5. Conclusions

This study found that FNDC5-engineered BMSCs notably promoted the recovery of BPRA by enhancing the survival of BMSCs and inhibiting the apoptosis of motoneurons. This approach may be used as a potential treatment strategy for BPRA.

Abbreviations

BPRA: Brachial plexus root avulsion; MNs: motor neurons; FNDC5/BMSCs: bone marrow mesenchymal stem cells modified with FNDC5; exos: exosomes.

Author contributions

Study Design: BH Li; Data Collection: YN Ao. Statistical Analysis: JM He, ZX Long. Data Interpretation: YX Zhang, SY Feng. Manuscript Preparation: BH Li, J Zhang, ZY Li. Literature Search: SY Feng. Funds Collection: BH Li

CRediT authorship contribution statement

Bohan Li: Writing – original draft, Methodology, Data curation. Jingming He: Validation, Software. Yunong Ao: Validation, Software. Shenyou Feng: Validation, Software. Yuexing Zhang: Validation, Software. Jin Zhang: Validation, Project administration, Methodology. Zixiang Long: Validation, Software. Zhongyang Li: Writing – review & editing, Project administration, Funding acquisition.

Patient consent for publication

Not Applicable

Ethics approval and consent to participate

All animal procedures were conducted with the approval of the Guide of Animal Care and Use Committee of Guizhou Provincial People's Hospital (GZPH2023035).

Funding

This work was financially supported by Guizhou Provincial People’s Hospital Talent Fund under the Grant Hospital Talent Project.

Declaration of Competing Interest

There exists no competing interest among the author.

Acknowledgements

No

Footnotes

Appendix A

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.ibneur.2025.11.010.

Contributor Information

Jin Zhang, Email: 271179914@qq.com.

Zhongyang Li, Email: clinic_lizhongyang@126.com.

Appendix A. Supplementary material

Figure S1

(A) Representative in vivo imaging of DiD-labeled FNDC5/BMSCs group at 1, 3, and 7 day. (B) Protein expression of BDNF. (C) mRNA levels of IL-1β, IL-6 and TNF-α. (D) ChAT antibody immunofluorescence staining. Data are shown as the means ± SD, n = 3. *P < 0.05, ** P < 0.01, *** P < 0.001

mmc1.jpg (3.1MB, jpg)

References

  1. Antolasic E.J., Jaehne E.J., van den Buuse M. Interaction of brain-derived neurotrophic factor, exercise, and fear extinction: implications for post-traumatic stress disorder. Curr. Neuropharmacol. 2024;22(4):543–556. doi: 10.2174/1570159x21666230724101321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Askari H., Rajani S.F., Poorebrahim M., Haghi-Aminjan H., Raeis-Abdollahi E., Abdollahi M. A glance at the therapeutic potential of irisin against diseases involving inflammation, oxidative stress, and apoptosis: an introductory review. Pharm. Res. 2018;129:44–55. doi: 10.1016/j.phrs.2018.01.012. [DOI] [PubMed] [Google Scholar]
  3. Baker N., Boyette L.B., Tuan R.S. Characterization of bone marrow-derived mesenchymal stem cells in aging. Bone. 2015;70:37–47. doi: 10.1016/j.bone.2014.10.014. [DOI] [PubMed] [Google Scholar]
  4. Bertelli J.A., Mira J.C. Behavioral evaluating methods in the objective clinical assessment of motor function after experimental brachial plexus reconstruction in the rat. J. Neurosci. Methods. 1993;46(3):203–208. doi: 10.1016/0165-0270(93)90068-3. [DOI] [PubMed] [Google Scholar]
  5. Bucan V., Vaslaitis D., Peck C.T., Strauß S., Vogt P.M., Radtke C. Effect of exosomes from rat adipose-derived mesenchymal stem cells on neurite outgrowth and sciatic nerve regeneration after crush injury. Mol. Neurobiol. 2019;56(3):1812–1824. doi: 10.1007/s12035-018-1172-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cardoso A.L., Fernandes A., Aguilar-Pimentel J.A., de Angelis M.H., Guedes J.R., Brito M.A., Trendelenburg A.U. Towards frailty biomarkers: Candidates from genes and pathways regulated in aging and age-related diseases. Ageing Res Rev. 2018;47:214–277. doi: 10.1016/j.arr.2018.07.004. [DOI] [PubMed] [Google Scholar]
  7. Chen S., Hou Y., Zhao Z., Luo Y., Lv S., Wang Q., Wu W. Neuregulin-1 accelerates functional motor recovery by improving motoneuron survival after brachial Plexus root avulsion in mice. Neuroscience. 2019;404:510–518. doi: 10.1016/j.neuroscience.2019.01.054. [DOI] [PubMed] [Google Scholar]
  8. Chen W., Sun Q., Tao J. Selective support of a mouse thymus epithelial cell line (MTEC1) to the viability and proliferation of CD4+ CD8−, CD4− CD8−, and CD4+CD8+ thymocytes in vitro. Cell Res. 1992;2(2):183–193. doi: 10.1038/cr.1992.17. [DOI] [Google Scholar]
  9. Chu D.T., Phuong T.N.T., Tien N.L.B., Tran D.K., Thanh V.V., Quang T.L., Kushekhar K. An update on the progress of isolation, culture, storage, and clinical application of human bone marrow mesenchymal stem/stromal cells. Int J. Mol. Sci. 2020;21(3) doi: 10.3390/ijms21030708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cofano F., Boido M., Monticelli M., Zenga F., Ducati A., Vercelli A., Garbossa D. Mesenchymal stem cells for spinal cord injury: current options, limitations, and future of cell therapy. Int J. Mol. Sci. 2019;20(11) doi: 10.3390/ijms20112698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. de Macêdo S.M., Lelis D.F., Mendes K.L., Fraga C.A.C., Brandi I.V., Feltenberger J.D., Santos S.H.S. Effects of dietary macronutrient composition on FNDC5 and Irisin in mice skeletal muscle. Metab. Syndr. Relat. Disord. 2017;15(4):161–169. doi: 10.1089/met.2016.0109. [DOI] [PubMed] [Google Scholar]
  12. Deng C., Chen H. Brain-derived neurotrophic factor/tropomyosin receptor kinase B signaling in spinal muscular atrophy and amyotrophic lateral sclerosis. Neurobiol. Dis. 2024;190 doi: 10.1016/j.nbd.2023.106377. [DOI] [PubMed] [Google Scholar]
  13. Dong R., Liu Y., Yang Y., Wang H., Xu Y., Zhang Z. MSC-derived exosomes-based therapy for peripheral nerve injury: a novel therapeutic strategy. Biomed. Res Int. 2019;2019 doi: 10.1155/2019/6458237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Duan S., Wang F., Cao J., Wang C. Exosomes derived from MicroRNA-146a-5p-enriched bone marrow mesenchymal stem cells alleviate intracerebral hemorrhage by inhibiting neuronal apoptosis and microglial M1 polarization. Drug Des. Devel Ther. 2020;14:3143–3158. doi: 10.2147/dddt.S255828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Erickson K.I., Miller D.L., Roecklein K.A. The aging hippocampus: interactions between exercise, depression, and BDNF. The Neuroscientist. 2012;18:82–97. doi: 10.1177/1073858410397054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Farzad B., Rajabi H., Gharakhanlou R., Allison D.J., Hayat P., Jameie S.B. Swimming training attenuates allodynia and hyperalgesia induced by peripheral nerve injury in an adult male rat neuropathic model: effects on Irisin and GAD65. Pain. Med. 2018;19(11):2236–2245. doi: 10.1093/pm/pnx294. [DOI] [PubMed] [Google Scholar]
  17. Fu X., Liu G., Halim A., Ju Y., Luo Q., Song A.G. Mesenchymal stem cell migration and tissue repair. Cells. 2019;8(8) doi: 10.3390/cells8080784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ha X.Q., Yang B., Hou H.J., Cai X.L., Xiong W.Y., Wei X.P. Protective effect of rhodioloside and bone marrow mesenchymal stem cells infected with HIF-1-expressing adenovirus on acute spinal cord injury. Neural Regen. Res. 2020;15(4):690–696. doi: 10.4103/1673-5374.266920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Harrell C.R., Jovicic N., Djonov V., Arsenijevic N., Volarevic V. Mesenchymal stem cell-derived exosomes and other extracellular vesicles as new remedies in the therapy of inflammatory diseases. Cells. 2019;8(12) doi: 10.3390/cells8121605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. He C., Zheng S., Luo Y., Wang B. Exosome theranostics: biology and translational medicine. Theranostics. 2018;8(1):237–255. doi: 10.7150/thno.21945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. He Y., Chen D., Yang L., Hou Q., Ma H., Xu X. The therapeutic potential of bone marrow mesenchymal stem cells in premature ovarian failure. Stem Cell Res. Ther. 2018;9(1):263. doi: 10.1186/s13287-018-1008-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Huang Y., Mai Y., Ye W., Lv S., Zhou Y., Wu P., Zhong K. Brachial Plexus root avulsion injury-induced endothelin-converting enzyme-like 1 overexpression is associated with injured motor neurons survival. Mol. Neurobiol. 2024;61(8):5194–5205. doi: 10.1007/s12035-023-03887-7. [DOI] [PubMed] [Google Scholar]
  23. Kittithamvongs P., Anantasinkul P., Siripoonyothai S., Anantavorasakul N., Malungpaishrope K., Uerpairojkit C., Leechavengvongs S. Does cannabis-based medicine improve pain and sleep quality in patients with traumatic brachial plexus injuries? a triple-blind, crossover, randomized controlled trial. Clin. Orthop. Relat. Res. 2025;483(2):228–234. doi: 10.1097/corr.0000000000003221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kuta R., Larochelle N., Fernandez M., Pal A., Minotti S., Tibshirani M., Durham H.D. Depending on the stress, histone deacetylase inhibitors act as heat shock protein co-inducers in motor neurons and potentiate arimoclomol, exerting neuroprotection through multiple mechanisms in ALS models. Cell Stress Chaperon. 2020;25(1):173–191. doi: 10.1007/s12192-019-01064-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li B., Li P., Weng R., Wu Z., Qin B., Fang J., Gu L. Trehalose protects motorneuron after brachial plexus root avulsion by activating autophagy and inhibiting apoptosis mediated by the AMPK signaling pathway. Gene. 2021;768 doi: 10.1016/j.gene.2020.145307. [DOI] [PubMed] [Google Scholar]
  26. Lima Giacobbo B., Doorduin J., Klein H.C., Dierckx R., Bromberg E., de Vries E.F.J. Brain-derived neurotrophic factor in brain disorders: focus on neuroinflammation. Mol. Neurobiol. 2019;56(5):3295–3312. doi: 10.1007/s12035-018-1283-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu C.Y., Yin G., Sun Y.D., Lin Y.F., Xie Z., English A.W., Lin H.D. Effect of exosomes from adipose-derived stem cells on the apoptosis of Schwann cells in peripheral nerve injury. CNS Neurosci. Ther. 2020;26(2):189–196. doi: 10.1111/cns.13187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lu F., Zhang G., Zhu Y., Liu Z. Epigallocatechin gallate attenuates spinal motoneuron death induced by brachial plexus root avulsion in rats. Curr. Med. Chem. 2022;29(30):5139–5154. doi: 10.2174/0929867329666220509204151. [DOI] [PubMed] [Google Scholar]
  29. Ma Q., Wu J., Li H., Ma X., Yin R., Bai L., Liu N. The role of TRPV4 in programmed cell deaths. Mol. Biol. Rep. 2024;51(1):248. doi: 10.1007/s11033-023-09199-2. [DOI] [PubMed] [Google Scholar]
  30. Sahoo S., Losordo D.W. Exosomes and cardiac repair after myocardial infarction. Circ. Res. 2014;114(2):333–344. doi: 10.1161/circresaha.114.300639. [DOI] [PubMed] [Google Scholar]
  31. Shiue S.J., Rau R.H., Shiue H.S., Hung Y.W., Li Z.X., Yang K.D., Cheng J.K. Mesenchymal stem cell exosomes as a cell-free therapy for nerve injury-induced pain in rats. Pain. 2019;160(1):210–223. doi: 10.1097/j.pain.0000000000001395. [DOI] [PubMed] [Google Scholar]
  32. Thongboonkerd V. Roles for Exosome in Various Kidney Diseases and Disorders. Front Pharm. 2019;10:1655. doi: 10.3389/fphar.2019.01655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wade R.G., Takwoingi Y., Wormald J.C.R., Ridgway J.P., Tanner S., Rankine J.J., Bourke G. MRI for Detecting Root Avulsions in Traumatic Adult Brachial Plexus Injuries: A Systematic Review and Meta-Analysis of Diagnostic Accuracy. Radiology. 2019;293(1):125–133. doi: 10.1148/radiol.2019190218. [DOI] [PubMed] [Google Scholar]
  34. Wortzel I., Dror S., Kenific C.M., Lyden D. Exosome-Mediated Metastasis: Communication from a Distance. Dev. Cell. 2019;49(3):347–360. doi: 10.1016/j.devcel.2019.04.011. [DOI] [PubMed] [Google Scholar]
  35. Xia D.Y., Huang X., Bi C.F., Mao L.L., Peng L.J., Qian H.R. PGC-1α or FNDC5 is involved in modulating the effects of Aβ(1-42) oligomers on suppressing the expression of BDNF, a beneficial factor for inhibiting neuronal apoptosis, Aβ deposition and cognitive decline of APP/PS1 Tg mice. Front Aging Neurosci. 2017;9:65. doi: 10.3389/fnagi.2017.00065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Xu T.B., Li L., Luo X.D., Lin H. BMSCs protect against liver injury via suppressing hepatocyte apoptosis and activating TGF-β1/Bax singling pathway. Biomed. Pharm. 2017;96:1395–1402. doi: 10.1016/j.biopha.2017.11.023. [DOI] [PubMed] [Google Scholar]
  37. Zhang X., Hu C., Kong C.Y., Song P., Wu H.M., Xu S.C., Tang Q.Z. FNDC5 alleviates oxidative stress and cardiomyocyte apoptosis in doxorubicin-induced cardiotoxicity via activating AKT. Cell Death Differ. 2020;27(2):540–555. doi: 10.1038/s41418-019-0372-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

(A) Representative in vivo imaging of DiD-labeled FNDC5/BMSCs group at 1, 3, and 7 day. (B) Protein expression of BDNF. (C) mRNA levels of IL-1β, IL-6 and TNF-α. (D) ChAT antibody immunofluorescence staining. Data are shown as the means ± SD, n = 3. *P < 0.05, ** P < 0.01, *** P < 0.001

mmc1.jpg (3.1MB, jpg)

Articles from IBRO Neuroscience Reports are provided here courtesy of Elsevier

RESOURCES