Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2026 Aug 22;105(12):107683. doi: 10.1016/j.psj.2026.107683

Sodium butyrate protects broiler chickens against lethal Salmonella Enteritidis infection by remodelling the gut microbiota and preserving immune homeostasis

Jingyi He a,1, Chunlin Xie a,1, Jinglan Lu a, Jialiang Yu a, Lili Lai a,b, Peng Chen a, Dingming Shu a, Jian Ji a,⁎
PMCID: PMC13594445  PMID: 42736188

Abstract

Salmonella Enteritidis (SE) is a zoonotic pathogen of major public health concern, and poultry operations are a key reservoir for human infection. Although sodium butyrate (NaB) has documented immunomodulatory and anti-inflammatory properties, whether it can enhance resistance against SE infection in chickens and by what mechanisms remain unclear. Here we evaluated the effects of early dietary NaB supplementation on SE susceptibility in broiler chickens. Newly hatched chicks were randomly assigned to one of three groups—an uninfected negative control (Ctrl), an SE-challenged positive control (SE), and a group receiving 300 mg/kg dietary NaB before SE challenge (NaB+SE). Dietary NaB increased the survival rate of SE-challenged chicks from 5.26% to 52.63% (P < 0.05) and attenuated SE-induced villus damage and excessive pro-inflammatory responses. Flow cytometry showed that NaB prevented the SE-associated depletion of splenic B cells and macrophages. Cecal 16S rRNA gene sequencing revealed that NaB altered cecal microbiota structure, reducing potential pathogens and enriching beneficial bacteria, including Blautia species. These results indicate that sodium butyrate enhances resistance to SE infection through modulation of immune homeostasis and restructuring of the gut microbial community, and may represent a non-antibiotic intervention to reduce SE transmission in commercial poultry production.

Keywords: Salmonella enteritidis, Butyrate, Inflammation, Gut microbiota, Chicken

Introduction

Salmonella remains a leading global foodborne pathogen, posing a major threat to public health and imposing a substantial economic burden on the poultry industry (Gantois et al., 2009). Among more than 2,500 identified serovars, Salmonella Enteritidis (SE) is a predominant cause of human salmonellosis worldwide (Qamar et al., 2022). Recent epidemiological data underscore the persistent link between SE and the poultry supply chain: the 2024 European Union One Health Zoonoses report identified Salmonella in eggs and egg products as the agent-food pair of highest concern, with SE cases showing a notable resurgence across several regions in 2023-2025 (EFSA, 2025). Unlike other serotypes, SE can colonize the avian reproductive tract, accounting for over 90% of Salmonella-positive table eggs (Gantois et al., 2009). Strategies to control SE infection have historically depended on sub-therapeutic antibiotic administration (Deng and Wang, 2024). However, the World Health Organization recently categorised Salmonella as a high-priority pathogen owing to the rapid emergence of multidrug-resistant strains and concerns over antibiotic residues in animal-derived foods (Sati et al., 2025). There is therefore an urgent need for sustainable, non-antibiotic alternatives to enhance host resistance against SE infection in poultry.

Butyrate, a major intestinal short-chain fatty acid (SCFA), is produced primarily through microbial fermentation of indigestible carbohydrates in the distal gastrointestinal tract (Ye et al., 2024). As a key energy source for intestinal epithelial cells, butyrate maintains gastrointestinal homeostasis by enhancing mucosal barrier integrity and promoting villus development (Bedford and Gong, 2018; He and Dong, 2023). Recent studies in broilers reared under cold stress at high altitude further showed that dietary sodium butyrate, particularly in encapsulated or combined forms, improved feed conversion ratio, enhanced villus morphology and upregulated genes related to intestinal barrier function and antioxidant defence (Pat et al., 2026), while also improving carcass yields and attenuating oxidative-inflammatory and metabolic stress responses (Ahmadipour et al., 2026). Beyond its metabolic functions, butyrate has potent immunomodulatory and anti-inflammatory properties. It acts as a signalling molecule that engages G protein-coupled receptors (GPCRs) and inhibits histone deacetylases (HDACs), thereby modulating immune cell differentiation and suppressing excessive pro-inflammatory cytokine production (Kang et al., 2023; Liu et al., 2018a). In veterinary medicine, butyrate confers protection against enteric pathogens by bolstering host innate immunity and optimising gut microbial structure (Zhan et al., 2022; Zhou et al., 2017). Despite these well-documented benefits, whether dietary sodium butyrate (NaB) can effectively enhance resistance specifically against SE infection in broiler chickens, and the underlying mechanisms involving the interplay between immune cell dynamics and the gut microbiota, have not been fully elucidated.

To address this gap, we systematically evaluated the protective effects and underlying mechanisms of early dietary NaB supplementation in broiler chickens challenged with SE. Newly hatched chicks were fed a diet containing 300 mg/kg NaB and subsequently subjected to SE challenge. We assessed host-pathogen-microbiota interactions by monitoring survival, analysing intestinal histomorphology and pro-inflammatory cytokine expression, and profiling immune cell dynamics by flow cytometry. 16S rRNA sequencing of the cecal microbiota was used to examine shifts in the gut microbial community. This study provides insights into how sodium butyrate enhances host resistance to SE through microbiota-mediated immunomodulation, and offers a framework for developing antibiotic-free strategies in poultry production.

Materials and methods

Ethics statement

The animal study was performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of the Institute of Animal Science, Guangdong Academy of Agricultural Sciences (Guangzhou, China; Protocol number: 2025008).

Animals and experimental design

A total of 60 healthy, 1-day-old female Yellow-feathered broiler chickens were obtained and randomly assigned to three experimental groups (n = 20 per group): a negative control group (Ctrl), a sodium butyrate-supplemented group (NaB+SE), and a Salmonella Enteritidis-infected positive control group (SE). Each group was housed in a single cage with 20 birds per cage.

The Ctrl and SE groups were fed a basal starter mash diet, while the NaB+SE group received the basal diet supplemented with 300 mg/kg sodium butyrate. The basal diet was a commercial chick formula (Item No. TMR-531; Guangdong Guangda Bio-Nutrition Technology Co., Ltd., China) formulated to meet or exceed the nutritional requirements established by the National Standard of China (GB/T 5916-2020). The nutrient composition of the basal diet is detailed in Table 1. All chicks had ad libitum access to water and feed throughout the 7-day experimental period. On day 7, individual body weights were recorded. Sodium butyrate (C₄H₇NaO₂) contains approximately 20.9% sodium by weight; at 300 mg/kg, it therefore contributed only ≈0.006% sodium (≈2.7 mEq/kg) to the diet, a negligible increment relative to the sodium chloride content of the basal diet (0.20–0.80%). No modification of the mineral composition of the basal diet was therefore required to equalize sodium across the three experimental groups, and the corresponding increment in dietary cation–anion difference (DCAD) was only ≈2.7 mEq/kg (DCAD ≈ 205 mEq/kg for the Ctrl and SE diets and ≈ 207 mEq/kg for the NaB+SE diet; Table 1).

Table 1.

Nutrient composition of the basal diet and calculated dietary cation–anion difference (DCAD).

Nutrient Item Level (%)
Crude Protein ≥20.00
Crude Fiber ≤6.00
Crude Ash ≤8.00
Calcium 0.60-1.30
Total Phosphorus ≥0.40
Sodium Chloride (NaCl) 0.20-0.80
Lysine ≥1.00
Sodium (Na)¹, % 0.08–0.31
Chloride (Cl)¹, % 0.12–0.49
Potassium (K)², % 0.80
DCAD³, mEq/kg 205 (Ctrl, SE); 207 (NaB+SE)
Open in a new tab

¹Na and Cl were calculated from the declared sodium chloride content (0.20–0.80%) using the atomic mass fractions of Na (22.99/58.44) and Cl (35.45/58.44) in NaCl.

²K was estimated at 0.80%, a typical value for corn–soybean meal broiler diets (the guarantee sheet does not declare K). ³DCAD (mEq/kg) = (Na% × 10,000/22.99) + (K% × 10,000/39.10) − (Cl% × 10,000/35.45). Because NaCl supplies equal milliequivalents of Na⁺ and Cl⁻, the DCAD is independent of the NaCl content within the declared range and is set by K: 0.80% K = 205 mEq/kg (Ctrl and SE). At 300 mg/kg, sodium butyrate (≈20.9% Na) added ≈0.006% Na (≈2.7 mEq/kg), giving a DCAD of ≈207 mEq/kg for the NaB+SE diet.

Salmonella enteriditis culture

The Salmonella Enteritidis (SE) strain used in this study was generously provided by Associate Professor Ming Jiang of Hunan Normal University and is registered under NCBI GenBank accession number CP022450.1.

Glycerol stocks stored at −80 °C were thawed rapidly in a 37 °C water bath and immediately transferred into sterile Luria-Bertani (LB) liquid medium (HB0128, Haibo, China) at an inoculation ratio of no less than 1:10 (v/v). The culture was resuscitated at 37 °C with shaking at 180 rpm for 60 min. A 100 μL aliquot of the resuscitated bacterial suspension was streaked onto Salmonella identification agar plates (HB7007-1, Haibo, China). The plates were inverted and incubated at 37 °C for 18–24 h. Distinct purple colonies were picked and inoculated into 5 mL of LB broth, followed by incubation at 37 °C and 220 rpm for 12 h to obtain a pure culture. The purified bacterial suspension was inoculated into 300 mL of LB broth at a 1:10,000 dilution and cultured at 37 °C with shaking at 220 rpm for 10 h. The optical density at 600 nm (OD600) was monitored. A value of OD600 ​= 1.0 was established to correspond to a bacterial density of 1 × 109 CFU/mL. The bacterial cells were harvested by centrifugation, washed, and resuspended in sterile saline to achieve a final challenge concentration of 1 × 1010 CFU/mL.

Salmonella Enteritidis challenge experiment

On day 7, prior to inoculation, each chick was weighed using an electronic scale (accuracy to 0.5 g) to determine individual challenge volumes. Chicks in the SE and NaB+SE groups received an intraperitoneal injection of the SE suspension at a standardized dose of 5.00 × 107 CFU/g of body weight. Survival rates were recorded continuously at 12 h, 18 h, and 24 h post-infection (hpi). Following the same pretreatment and infection protocol, surviving chicks allocated for sampling were euthanized at 24 hpi for sample collection.

Blood samples were collected via carotid artery exsanguination into vacuum clot-activator tubes. Serum was separated by centrifugation and stored at −20 °C for ELISA validation of systemic inflammatory cytokines. Tissue samples from the liver, spleen, kidney, and heart were weighed and placed into 1.5 mL tubes containing pre-cooled sterile saline for bacterial load determination. For immune cell profiling, fresh portions of the spleen and liver were immediately placed into ice-cold phosphate-buffered saline (PBS). For histomorphological analysis, tissue segments from the duodenum, jejunum, and ileum were placed in 4% paraformaldehyde. Cecal contents were collected, snap-frozen in liquid nitrogen, and stored at −80 °C for 16S rRNA gene sequencing. Remaining portions of the liver and ileum were frozen in liquid nitrogen and stored at −80 °C for downstream molecular assays.

Tissue bacterial load determination

Liver, spleen, kidney, and heart samples were weighed using an analytical balance (accuracy to 0.001 g). Tissues were transferred to 2 mL sterile tubes containing pre-cooled sterile magnetic beads and homogenized using a cold tissue grinder at 60 Hz for 15 s per cycle for three cycles, with a 5 s interval between cycles. The tissue homogenate was diluted to obtain a gradient from 10−1 to 10−6. A 5 μL droplet of each dilution was spotted onto a partitioned Salmonella identification agar plate. After the droplets were completely absorbed, the plates were inverted and incubated at 37 °C for 18 h. Target colonies were counted, and the tissue bacterial load was calculated and expressed as colony-forming units per gram of tissue (CFU/g).

Intestinal histology

Small intestinal segments (duodenum, jejunum, and ileum) were trimmed, washed with running water for 20 min, dehydrated through a graded ethanol series, cleared in xylene, and embedded in paraffin blocks. Longitudinal sections were cut at a thickness of 4 μm using a rotary microtome, expanded in a water bath, mounted on glass slides, and dried. After deparaffinization in xylene and rehydration through a descending ethanol gradient, the sections were stained with hematoxylin for 4 min, rinsed with tap water, differentiated in 0.8% hydrochloric acid-ethanol for 2 s, and rinsed again. The slides were counterstained with eosin for 20 s, transitioned through 95% ethanol for 5 s, cleared in an eco-friendly clearing agent, and sealed with mounting medium. Histomicrographs were acquired using an optical microscope.

Enzyme-linked immunosorbent assay (ELISA)

Serum levels of pro-inflammatory cytokines, including interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α), were measured using commercial ELISA kits specific for chicken cross-reactivity according to the manufacturer’s instructions. ELISA kits for IL-1β (MM-369101, Meimian, China), TNF-α (MM-093801, Meimian, China).

RNA extraction and reverse transcription

Total RNA was extracted from approximately 0.5 g of frozen ileal tissue using RNAiso Plus reagent (9109, Takara, Japan) according to the manufacturer's protocol, and RNA concentration and purity were assessed spectrophotometrically. Complementary DNA (cDNA) was synthesized using a commercial reverse transcription kit (4374966, Thermo Fisher Scientific, USA) according to the manufacturer's instructions.

Quantitative real-time PCR

The expression levels of target genes were determined via quantitative real-time PCR (qPCR) using the synthesized cDNA as a template. The specific primer sequences designed for chicken target genes are summarized in Table 2. Real-time amplification was performed on a validated thermocycler utilizing β-actin (ACTB) as the internal reference gene. The reaction program consisted of: an initial denaturation at 95 °C for 3 min, followed by 39 cycles of denaturation at 95 °C for 10 s, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s. The relative mRNA expression levels of target genes were calculated using the comparative 2−ΔΔCt method.

Table 2.

Specific primer sequences for quantitative real-time PCR.

IL1B F: CATCACCAACCAACCCGA
R: ACGAGATGGAAACCAGCAA
IL6 F: TCTCCGCAGGAGAAATGCCT
R: CGACGTTCTGCTTTTCGCTAT
TNFA F: GTCAGCACCTGGTTATCTGT
R: AGATTGAGTGCCGCAGTCCTG
ZO1 F: TTCCAACCGATCACATGACA
R: CTGACCTCCTTGTGCATAT
CLDN1 F: TACTGGTGTCATCTTCAGC
R: AGTGAGAACTGGGGATTGT
ACTB F: CACAGATCATGTTTGAGACCTT
R: CATCACAATACCAGTGGTACG
Open in a new tab

Flow cytometry analysis

Single-cell suspensions were prepared from fresh liver and spleen samples by gently passing the tissue through a 70 μm cell strainer, followed by red blood cell lysis (R1010, Solarbio Biotech, China). Aliquots of 1 × 10⁶ cells were stained in the dark at 4°C for 30 min with the following mouse anti-chicken monoclonal antibodies: CD45–SPRD (8270-13), CD3–AF647 (8200-31), TCRγδ–PE (8230-09), CD4–AF700 (8210-27), CD8α–PACBLU (8220-26), Bu-1–AF647 (8395-31), and Monocyte/Macrophage–PE (8420-09) from Southern Biotech, and CD25–FITC (Bio-Rad, HCA173F). After washing, cells were acquired within 20 min on an Attune NxT flow cytometer (Thermo Fisher Scientific, USA) and analyzed with FlowJo software (v10). Immune populations were defined as T cell subsets (CD3⁺, CD4⁺, CD25⁺, CD8α⁺, and TCRγδ⁺), B cells (CD45⁺Bu-1⁺), and macrophages (CD45⁺M0⁺).

Cecal microbiota 16S rRNA sequencing and bioinformatics analysis

Total genomic DNA was extracted from cecal contents using a TIANamp Stool DNA Kit (DP328, TIANGEN, China) following the manufacturer's protocol. The V4 hypervariable region of the bacterial 16S rRNA gene was amplified with the barcoded primers 515F (5′-GTGCCAGCMGCCGGGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′), and the pooled library was sequenced on the Illumina NovaSeq 6000 platform. Raw reads were demultiplexed, quality-filtered (Fastp v0.23.1), assembled into tags (FLASH v1.2.11), and screened for chimeras against the Silva database (UCHIME). Amplicon sequence variants (ASVs) were resolved to compile a relative abundance table. Beta diversity was evaluated using weighted UniFrac distances and Partial Least Squares Discriminant Analysis (PLS-DA). Community functional phenotypes were predicted with BugBase, and key discriminatory taxa were identified by Random Forest analysis with cross-validation.

Data processing and statistical analysis

All statistical analyses and graphical visualizations were executed using GraphPad Prism software (version 9.0). Differences among experimental treatment groups were evaluated utilizing a one-way analysis of variance (ANOVA) followed by multiple comparison post-hoc corrections where appropriate. Quantitative data are presented as the mean ± SEM. Statistical significance limits were defined based on the calculated probability criteria: *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

Results

Sodium butyrate promotes growth performance and enhances resistance against Salmonella Enteritidis infection

In this study, we evaluated the impacts of sodium butyrate on the pathogen resistance of yellow-feathered broiler chickens by developing an infection model with Salmonella Enteritidis (Fig. 1A). At day 1, no significant differences in body weight were observed among the three groups, confirming a homogenous baseline (Fig. 1B). Following 7 days of dietary intervention, chickens in the NaB+SE group exhibited a significantly higher body weight compared to both the Ctrl and SE groups (P < 0.001, Fig. 1C), indicating a clear growth-promoting effect. To eliminate the influence of body weight variations on infection, chickens were challenged with SE at a dose of 5 × 107 CFU/g body weight. At 6 h post-infection (hpi), compared with the NaB+SE group, chickens in the SE group showed marked infection symptoms such as crouching, eye closure, and listlessness (Fig. 1D). At 24 hpi, the survival rate of the SE group dropped to 5.26%, whereas the NaB+SE group maintained a significantly higher survival rate of 52.63% (Fig. 1E).

Fig. 1.

Fig. 1

Open in a new tab

Sodium butyrate promotes growth performance and enhances resistance against Salmonella Enteritidis infection. A Schematic diagram of the experimental design. Newly hatched yellow-feathered broiler chicks were fed a basal diet (Ctrl and SE groups) or a basal diet supplemented with 300 mg/kg sodium butyrate (NaB+SE group) for 7 days, followed by intraperitoneal challenge with Salmonella Enteritidis (SE) at 5 × 10⁷ CFU per g body weight (SE and NaB+SE groups). B Baseline body weight at day 1 (before dietary intervention). C Body weight at day 7 (immediately before SE challenge). D Representative clinical appearance at 6 h post-infection (hpi). E Survival rate at 24 hpi. F–I Tissue bacterial loads (CFU per g tissue) in the liver (F), spleen (G), kidney (H) and heart (I) at 24 hpi. J,K Serum concentrations of the pro-inflammatory cytokines interleukin-1β (IL-1β; J) and tumour necrosis factor-α (TNF-α; K) measured by ELISA at 24 hpi. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA with post-hoc multiple comparison correction. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. n = 20 birds per group for survival analysis; n ≥ 5 birds per group for bacterial load and cytokine measurements. Ctrl, uninfected negative control; SE, Salmonella Enteritidis-infected positive control; NaB+SE, sodium butyrate-supplemented + SE challenge.

Tissue bacterial load analysis at 24 hpi showed that dietary NaB significantly decreased the bacterial burdens in the liver (Fig. 1F) and spleen (Fig. 1G) compared to the SE group (P < 0.05). A downward trend was also observed in the kidneys (Fig. 1H) and heart (Fig. 1I), though the differences were not statistically significant. Furthermore, ELISA results showed that SE infection significantly elevated serum concentrations of IL-1β and TNF-α (P < 0.05, Fig. 1J, K). However, sodium butyrate supplementation effectively suppressed this inflammatory response, maintaining serum cytokine levels close to those of the Ctrl group (Fig. 1J, K).

Sodium butyrate alleviates intestinal damage and inflammation induced by Salmonella Enteritidis infection

Histomorphological analysis via H&E staining revealed that SE infection induced distinct villus atrophy in the duodenum, jejunum, and ileum (Fig. 2A). Specifically, the villus height in the jejunum of the SE group was significantly lower than that of both the Ctrl and NaB+SE groups (Fig. 2B). Furthermore, SE infection significantly increased crypt depth across all three intestinal segments. However, the crypt depths in the duodenum and jejunum of the NaB+SE group were significantly lower than those of the SE group, remaining comparable to the Ctrl group (Fig. 2C). Consequently, the villus height-to-crypt depth (V/C) ratio in all three segments was significantly reduced by SE infection, whereas NaB supplementation effectively restored the V/C ratio in the ileum to levels similar to the Ctrl group (Fig. 2D).

Fig. 2.

Fig. 2

Open in a new tab

Sodium butyrate alleviates intestinal damage and inflammation induced by Salmonella Enteritidis infection. A Representative haematoxylin and eosin (H&E) staining of the duodenum, jejunum and ileum. B Villus height. C Crypt depth. D Villus height-to-crypt depth (V/C) ratio. E Relative mRNA expression levels of tight junction proteins (ZO1, CLDN1) and pro-inflammatory cytokines (IL-1β, IL-6, TNF-α) in the ileal tissue, quantified by quantitative real-time PCR. Expression levels are normalized to the reference gene ACTB (β-actin). Data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; one-way ANOVA with post-hoc test. n ≥ 5 birds per group.

To further evaluate intestinal barrier integrity, the mRNA expression of tight junction proteins in the ileum was quantified via qPCR. Compared to the Ctrl group, the expression levels of ZO1 and CLDN1 were significantly downregulated in the SE group. Dietary NaB supplementation significantly reversed this trend, markedly upregulating the expression of both genes (Fig. 2E). Additionally, qPCR analysis showed that NaB treatment significantly suppressed the SE-induced upregulation of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) in the ileal tissue, maintaining their expression at baseline levels (Fig. 2E). Together, these data demonstrate that sodium butyrate effectively mitigates SE-induced intestinal mucosal injury and localized inflammation.

Sodium butyrate modulates splenic immune cell dynamics following SE infection

To evaluate systemic immune responses, splenic immune cell populations were characterized via flow cytometry. The proportions of total leukocytes (CD45+ cells) showed no significant differences among the three experimental groups (Fig. 3A). For humoral and innate immunity markers, SE challenge alone markedly reduced the percentages of both B cells (CD45+Bu-1+) and macrophages (CD45+M0+) in the spleen (P < 0.01, Fig. 3B, C). Crucially, early dietary intervention with sodium butyrate significantly counteracted this pathogen-induced depletion, maintaining the proportions of both B cells and macrophages at levels substantially higher than those in the SE group (Fig. 3B, C).

Fig. 3.

Fig. 3

Open in a new tab

Sodium butyrate modulates splenic immune cell dynamics following Salmonella Enteritidis infection. A Proportion of total leukocytes (CD45⁺ cells). B Proportion of B cells (CD45⁺Bu-1⁺). C Proportion of macrophages (CD45⁺M0⁺). Data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001; one-way ANOVA with post-hoc test. n ≥ 5 birds per group.

For adaptive immunity markers, total T lymphocytes (CD3+ T cells), and regulatory T cells (CD25+ T cells) showed no significant differences among the three experimental groups (Fig. 4A, C). However, SE infection significantly increased the percentage of helper T cells (CD4+ T cells) while decreasing the proportions of cytotoxic T cells (CD8α+ T cells) and γδT cells (TCRγδ+ T cells) (P < 0.05, Fig. 4B, C). Compared to the SE group, NaB supplementation further decreased the proportion of CD8α+ T cells (Fig. 4B), but had no significant effect on the TCRγδ+ T cells population (Fig. 4D). These findings indicate that NaB promotes resistance to SE by stabilizing specific peripheral immune cell homeostasis.

Fig. 4.

Fig. 4

Open in a new tab

Sodium butyrate alters splenic T-cell subset composition during Salmonella Enteritidis infection. A Proportion of total T lymphocytes (CD3⁺). B Proportions of helper T cells (CD4⁺) and cytotoxic T cells (CD8a⁺). C Proportion of regulatory T cells (CD25⁺). D Proportion of γδ T cells (TCRγδ⁺). SE infection decreased γδ T cells. Data are presented as mean ± SEM. *P < 0.05, ***P < 0.001, ****P < 0.0001; one-way ANOVA with post-hoc test. n ≥ 5 birds per group.

Sodium butyrate reshapes the cecal microbiota structure following SE infection

Given that the gut microbiota plays a pivotal role in host immunity and pathogen resistance, we investigated whether NaB supplementation modulates the cecal microbial community to enhance SE resistance. Amplicon sequence variant (ASV) analysis yielded a total of 682 ASVs across all samples. Among these, 147 ASVs were shared by all three groups, while the Ctrl, SE, and NaB+SE groups possessed 77, 163, and 236 unique ASVs, respectively (Fig. 5A). Partial Least Squares Discriminant Analysis (PLS-DA) demonstrated distinct clustering and separation among the three groups (Fig. 5B). Consistently, beta diversity analysis based on weighted UniFrac distances confirmed that the microbial community structure of the NaB+SE group differed significantly from both the Ctrl and SE groups, indicating that dietary sodium butyrate significantly altered the cecal microbial landscape (Fig. 5C).

Fig. 5.

Fig. 5

Open in a new tab

Sodium butyrate reshapes the cecal microbiota structure following Salmonella Enteritidis infection. A Venn diagram of amplicon sequence variants (ASVs). B Partial Least Squares Discriminant Analysis (PLS-DA) score plot. C Beta diversity analysis based on weighted UniFrac distances. D Phylum-level taxonomic composition. E Genus-level taxonomic composition. n ≥ 5 birds per group.

Taxonomic profiling at the phylum and genus levels revealed further group-specific variations. At the phylum level (Fig. 5D), Firmicutes constituted the predominant taxon across all groups. Notably, the overall microbial composition of the NaB+SE group clustered closer to the Ctrl group, whereas SE infection led to an apparent increase in the relative abundances of Bacteroidota and Proteobacteria compared to the other two groups. At the genus level (Fig. 5E), the relative abundance of Alistipes was significantly higher in the SE group than in the Ctrl and NaB+SE groups. Conversely, SE infection caused a distinct reduction in the abundance of Faecalibacterium compared to the Ctrl group. Interestingly, early dietary supplementation with sodium butyrate significantly enriched the relative abundances of Blautia and GCA-900066575, rendering their proportions substantially higher than those observed in both the Ctrl and SE groups.

Functional phenotype prediction and random forest biomarker identification

To further understand the functional shifts in the cecal microbiota, BugBase analysis was performed to predict microbial phenotypic traits across the groups. The relative abundance of Gram-negative bacteria—a category containing numerous potential opportunistic pathogens—was significantly higher in the SE group than in both the Ctrl and NaB+SE groups. Conversely, early dietary supplementation with sodium butyrate significantly enriched the relative abundances of Gram-positive and anaerobic microbial populations (Fig. 6A, B), indicating that NaB promotes a more stable and resilient obligate anaerobic environment in the cecum.

Fig. 6.

Fig. 6

Open in a new tab

Functional phenotype prediction and Random Forest biomarker identification. A BugBase-predicted functional phenotypes of the cecal microbiota. B Kruskal-Wallis test with post-hoc pairwise comparisons for the BugBase-predicted phenotypes. C Random Forest classification model identifying the top diagnostic biomarkers driving community segregation. D Spearman correlation heatmap between the two primary biomarkers (Blautia and GCA-900066575) and host anti-infection phenotypes. *P < 0.05, **P < 0.01, ***P < 0.001. n ≥ 5 birds per group.

Subsequently, a Random Forest classification model was constructed to identify the key microbial taxa responsible for driving the community segregation among the groups. Based on the variable importance scores, the genera Blautia and GCA-900066575 were ranked as the top two primary diagnostic biomarkers (Fig. 6C). These results demonstrate that Blautia and GCA-900066575 serve as the core predictive features within the altered microbial ecosystem, underscoring their critical contribution to the NaB-mediated remodeling of the gut microbiota.

To establish a functional link between the reshaped microbiota and enhanced disease resistance, Spearman correlation analysis was performed to evaluate the relationships between the two primary biomarkers (Blautia and GCA-900066575) and host anti-infection phenotypes. The relative abundance of Blautia was significantly and negatively correlated with serum concentrations of the pro-inflammatory cytokine TNF-α, as well as the mRNA expression levels of IL-1β and IL-6 in the ileal tissue. Similarly, the abundance of GCA-900066575 displayed a pronounced negative correlation with serum IL-1β levels and the transcriptional levels of IL-1β, IL-6, and TNF-α in the ileum. Notably, both Blautia and GCA-900066575 exhibited robust positive correlations with the gene expression of intestinal barrier components, specifically ZO1 and CLDN1 (Fig. 6D).Taken together, these findings strongly imply that the enrichment of Blautia and GCA-900066575 driven by dietary sodium butyrate serves as a pivotal mechanistic bridge, effectively bolstering mucosal barrier function and dampening the local and systemic hyperinflammatory cascade during Salmonella Enteritidis infection.

Discussion

The first week post-hatch is a critical period for broiler chickens, characterised by rapid gastrointestinal development and high susceptibility to pathogens (Lowenthal et al., 1994). In the present study, dietary supplementation with 300 mg/kg NaB for 7 days significantly increased body weight (Fig. 1C), in line with the established role of butyrate as a luminal energy source and growth promoter in poultry (Chen et al., 2025). Our growth-promoting effect is further corroborated by recent studies in broilers reared under cold stress at high altitude, in which dietary sodium butyrate improved feed conversion ratio (Pat et al., 2026) and, especially in encapsulated or combined forms, increased carcass, breast and thigh yields while reducing abdominal fat (Ahmadipour et al., 2026). A recent meta-analysis of 17 experiments involving 12,204 broilers further confirmed that dietary protected sodium butyrate increased final body weight and average daily gain and improved the feed conversion ratio (Kihal et al., 2025). More importantly, this nutritional intervention conferred robust clinical protection during a subsequent lethal SE challenge: while the infected control group had only 5.26% survival, NaB pre-treatment rescued 52.63% of challenged birds (Fig. 1E). This survival rate is comparable to that reported by Fernandez-Rubio et al. (Fernandez-Rubio et al., 2009), who demonstrated that butyric acid-based feed additives significantly reduced SE colonisation and shedding in broilers, and extends those findings by showing that NaB protects against lethal infection even when delivered as a short-term pre-treatment before challenge.

The survival benefit we observed was associated with the suppression of systemic pathogen dissemination. The liver and spleen were confirmed as primary target organs for SE colonisation, consistent with studies by Lima et al. (Lima et al., 2016) and He et al. (He et al., 2010), who demonstrated that these reticuloendothelial organs harbour the highest bacterial loads after oral or intraperitoneal infection. Our finding that NaB significantly reduced bacterial burdens in the liver and spleen suggests that NaB restricts systemic spread of SE, an effect that was mirrored by the attenuation of serum IL-1β and TNF-α levels. This agrees with Matulova et al. (Matulova et al., 2012), who reported that SE infection in chickens triggers a pronounced splenic cytokine response characterised by elevated IL-17 and IL-22 expression in CD4+ T cells, and that the magnitude of this inflammatory response correlates with the degree of macrophage and heterophil infiltration.

The intestinal epithelium is the primary physical barrier against enteric pathogens (Neurath et al., 2025). A hallmark of SE pathogenesis in avian hosts is disruption of this mucosal architecture, manifested as villus atrophy and crypt hyperplasia (Liu et al., 2023). Our histomorphological data confirmed this pathology, and NaB supplementation preserved the V/C ratio, particularly in the ileum (Fig. 2). This is consistent with a previous study, which reported that buffer salt-protected sodium butyrate significantly improved intestinal morphology and upregulated tight junction proteins ZO1 and claudin-1 in broilers (Melaku et al., 2024). In line with these findings, Pat et al. (2026) reported that dietary sodium butyrate, especially in encapsulated or combined forms, increased villus height, width and surface area in the duodenum, jejunum and ileum of cold-stressed broilers at high altitude, consistent with the improved intestinal morphology observed in the present study. These structural benefits are corroborated by a recent meta-analysis showing that protected sodium butyrate increased villus height by 9% and the villus height to crypt depth ratio by 5% across broiler studies (Kihal et al., 2025), and by a study in yellow-feathered broilers—the same breed used here—in which coated sodium butyrate increased small intestinal villus height and decreased jejunal crypt depth (Hou et al., 2024). At the molecular level, the downregulation of ZO1 and CLDN1 induced by SE was largely reversed by NaB (Fig. 2E), in agreement with studies showing that Salmonella infection compromises intestinal barrier integrity by disrupting tight junction protein expression (Ferris et al., 2025; Melaku et al., 2024). The coordinated suppression of ileal IL-1β, IL-6 and TNF-α expression by NaB suggests that the barrier-protective effect of NaB is closely linked to its local anti-inflammatory activity.

Splenic immune dynamics provide a window into the systemic response to SE infection. We observed a significant shift in T-cell subsets after SE challenge, with expansion of CD4+ helper T cells and decreases in CD8α+ cytotoxic T cells and γδ T cells (Fig. 4). It has been reported that SE infection reduced splenic CD8+ T cells and γδ T cells in chickens, with the Th17/Th1 balance in CD4+ T cells determining the outcome of infection (Matulova et al., 2012). Our observation that NaB altered this T-cell trajectory suggests that the immunomodulatory effects of butyrate extend beyond the intestinal mucosa to systemic lymphoid organs.

More notably, SE challenge severely depleted splenic B cells and macrophages, a depletion that was significantly reversed by NaB supplementation (Fig. 3B, C). Pathogen-driven immune cell depletion in peripheral lymphoid organs can result from exhaustive activation or virulence factor-induced apoptosis. Kogut and Arsenault (Kogut and Arsenault, 2017) proposed an immunometabolic model of Salmonella persistence in chickens in which the host shifts from a pro-inflammatory disease-resistance state to an anti-inflammatory disease-tolerance state, characterised by IL-10 and TGF-β upregulation. By preserving the pool of functional B cells and macrophages, NaB may help maintain innate phagocytic capacity and humoral antibody responses, potentially countering the systemic immunosuppression that facilitates chronic Salmonella carriage in poultry. These observations are also consistent with recent evidence that dietary sodium butyrate reduced oxidative stress markers (malondialdehyde) and the heterophil-to-lymphocyte ratio while improving lipid profiles and hepatic enzyme activities in stressed broilers (Ahmadipour et al., 2026), supporting a broader systemic anti-inflammatory action of butyrate beyond the intestinal mucosa. Consistent with a broader systemic antioxidant and immunomodulatory action of butyrate, coated sodium butyrate increased serum superoxide dismutase, catalase and total antioxidant capacity in yellow-feathered broilers (Hou et al., 2024), and in ovo sodium butyrate administration upregulated the anti-inflammatory cytokine IL-10 and intestinal barrier-related genes in a dose- and hatch-weight-dependent manner in broilers (Akram et al., 2024).

The gut microbiota functions as a metabolic and immunological organ that exerts colonisation resistance against foodborne pathogens (Beresford-Jones et al., 2025; Kempf et al., 2025). Our 16S rRNA sequencing revealed that SE infection disrupted the cecal microbial ecosystem, expanding Bacteroidota and Proteobacteria while reducing beneficial taxa such as Faecalibacterium. Liu et al. (Liu et al., 2018b) similarly reported that SE inoculation in chickens significantly altered cecal microbiota composition, with Proteobacteria becoming more dominant during early infection. PLS-DA and beta diversity analysis confirmed that NaB fundamentally reshaped the microbial community, shifting its structure closer to that of uninfected controls (Fig. 5). This is consistent with Montoro-Dasi et al. (Montoro-Dasi et al., 2026), who found that interventions that stabilise the gut microbiota promote beneficial genera such as Lactobacillus and Blautia and enhance resistance to Salmonella colonisation in poultry. Consistent with these observations, dietary coated sodium butyrate reduced the relative abundance of Proteobacteria while enriching Bacteroidetes and Bacteroides in the cecal microbiota of yellow-feathered broilers (Hou et al., 2024), in line with the pathogen-suppressing microbial shift induced by NaB in the present study.

BugBase phenotypic predictions and Random Forest modelling showed that NaB suppressed Gram-negative, pathogen-associated phenotypes and expanded anaerobic, Gram-positive populations (Fig. 6A, B). Random Forest analysis identified Blautia and the uncharacterised taxon GCA-900066575 as the top two diagnostic biomarkers driving this microbial shift. Blautia is a beneficial anaerobic genus within the Lachnospiraceae family that produces SCFAs, including acetate and butyrate, and supports mucosal homeostasis through cross-feeding interactions (Holmberg et al., 2024; Niu et al., 2024). Notably, it has been recently demonstrated that Blautia is enriched in chickens with high feed efficiency and that Blautia coccoides administration activates B cells to produce IgA (Xie et al., 2025), directly linking this genus to humoral immunity.

Our Spearman correlation analysis validated this biological link: the abundances of both Blautia and GCA-900066575 were inversely correlated with pro-inflammatory cytokine expression (IL-1β, IL-6 and TNF-α) and positively correlated with barrier integrity genes (ZO1, CLDN1) (Fig. 6D). These findings suggest that NaB does not act solely through direct contact with host tissues but may also operate through a microbial relay: early NaB administration enriches obligate anaerobes such as Blautia, which stabilise the gut ecosystem, reinforce tight junctions and mitigate the inflammatory signalling cascades required for SE colonisation. This model is consistent with the known capacity of SCFA-producing bacteria to strengthen intestinal barrier function through the production of butyrate, which serves as both a metabolic fuel for colonocytes and a signalling molecule that modulates immune cell function (El-Saadony et al., 2022).

Several limitations of this study should be acknowledged. First, the experimental period was limited to 7 days of NaB pre-treatment followed by a 24 h infection window; longer-term studies are needed to determine whether the protective effects are sustained during a full production cycle. Second, the intraperitoneal route of SE challenge, while providing a controlled lethal model, bypasses the natural oral route of infection and may not fully capture the role of the gut microbiota in colonisation resistance. Third, the specific contribution of GCA-900066575 to host protection remains unclear because this taxon is currently uncharacterised.

Conclusion

This study demonstrates that early dietary supplementation with sodium butyrate protects broiler chickens against lethal Salmonella Enteritidis infection through a dual mechanism: preserving intestinal barrier integrity and attenuating excessive inflammatory responses, while simultaneously remodelling the cecal microbiota toward a more stable, SCFA-producing microbial community enriched in Blautia. The strong correlations between Blautia abundance, reduced pro-inflammatory cytokine expression and enhanced tight junction gene expression point to a microbiota-mediated pathway through which NaB exerts its protective effects. These findings position sodium butyrate as a promising non-antibiotic intervention strategy for controlling SE infection in commercial poultry production, and highlight Blautia as a potential probiotic candidate for further development.

CRediT authorship contribution statement

Jingyi He: Writing – original draft, Data curation. Chunlin Xie: Writing – review & editing, Data curation, Formal analysis, Visualization, Funding acquisition. Jinglan Lu: Investigation, Data curation. Jialiang Yu: Investigation. Lili Lai: Investigation. Peng Chen: Resources. Dingming Shu: Resources, Conceptualization. Jian Ji: Writing – review & editing, Project administration, Funding acquisition, Conceptualization.

Funding

This work was partially supported by the National Natural Science Foundation of China (32302755), the Guangdong S&T Program (2025B0202080003), the Natural Science Foundation of Guangdong Province (2025A1515011549), the Talent Introduction project of Guangdong Academy of Agricultural Sciences (R2022YJ‐YB3013), the Special Funding for the Construction of the High-Level Academy of Agricultural Sciences (NYQS202631), and the Project of State Key Laboratory of Swine and Poultry Breeding Industry (2025ZQQZ-G08), the earmarked fund for CARS-40, the Guangdong Provincial Association for Science and Technology Young Scientific and Technological Talents Cultivation Program (SKXRC2025485).

Disclosures

The authors declare that they have no competing interests.

Data availability The 16S rRNA gene sequencing data generated in this study have been deposited in the NCBI Sequence Read Archive under BioProject accession number PRJNA1476845.

References

  1. Ahmadipour B., Pat S., Khajali F., Hassanpour H. Effects of sodium butyrate forms on carcass performance, pulmonary hypertension, metabolic health and oxidative-inflammatory responses in broiler chickens under cold stress at high altitude. Vet. Med. Sci. 2026;12 doi: 10.1002/vms3.70720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akram M.Z., Everaert N., Dunisławska A. In ovo sodium butyrate administration differentially impacts growth performance, intestinal barrier function, immune response, and gut microbiota characteristics in low and high hatch-weight broilers. J. Anim. Sci. Biotechnol. 2024;15:165. doi: 10.1186/s40104-024-01122-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bedford A., Gong J. Implications of butyrate and its derivatives for gut health and animal production. Anim. Nutr. 2018;4:151–159. doi: 10.1016/j.aninu.2017.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Beresford-Jones B.S., Suyama S., Clare S., Soderholm A., Xia W., Sardar P., Lee J., Harcourt K., Lawley T.D., Pedicord V.A. Enterocloster clostridioformis protects against Salmonella pathogenesis and modulates epithelial and mucosal immune function. Microbiome. 2025;13:61. doi: 10.1186/s40168-025-02050-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen W., Ma Q., Li Y., Wei L., Zhang Z., Khan A., Khan M.Z., Wang C. Butyrate supplementation improves intestinal health and growth performance in livestock: a review. Biomolecules. 2025;15:85. doi: 10.3390/biom15010085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Deng L., Wang S. Colonization resistance: the role of gut microbiota in preventing Salmonella invasion and infection. Gut. Microbes. 2024;16 doi: 10.1080/19490976.2024.2424914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. El-Saadony M.T., Yaqoob M.U., Hassan F.-U., Alagawany M., Arif M., Taha A.E., Elnesr S.S., El-Tarabily K.A., Abd El-Hack M.E. Applications of butyric acid in poultry production: the dynamics of gut health, performance, nutrient utilization, egg quality, and osteoporosis. Anim. Health Res. Rev. 2022;23:136–146. doi: 10.1017/s1466252321000220. [DOI] [PubMed] [Google Scholar]
  8. European Food Safety Authority (EFSA) European Centre for Disease Prevention and Control (ECDC) The European Union one health 2024 zoonoses report. EFSa J. 2025;23 doi: 10.2903/j.efsa.2025.9759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Fernandez-Rubio C., Ordonez C., Abad-Gonzalez J., Garcia-Gallego A., Honrubia M.P., Mallo J.J., Balana-Fouce R. Butyric acid-based feed additives help protect broiler chickens from Salmonella Enteritidis infection. Poult. Sci. 2009;88:943–948. doi: 10.3382/ps.2008-00484. [DOI] [PubMed] [Google Scholar]
  10. Ferris M.M., Antonio L.S., Al-Sadi R. Probiotics and the intestinal tight junction barrier function. Front. Cell Dev. Biol. 2025;13 doi: 10.3389/fcell.2025.1671152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gantois I., Ducatelle R., Pasmans F., Haesebrouck F., Gast R., Humphrey T.J., Van Immerseel F. Mechanisms of egg contamination by Salmonella Enteritidis. FEMS Microbiol. Rev. 2009;33:718–738. doi: 10.1111/j.1574-6976.2008.00161.x. [DOI] [PubMed] [Google Scholar]
  12. He G., Tian W., Qin L., Meng D., Wang J., Yin Y., Zhang J. Quantitative studies of the distribution pattern for Salmonella Enteritidis in the internal organs of chicken after oral challenge by a real-time PCR. Vet. Res. Commun. 2010;34:669–676. doi: 10.1007/s11259-010-9438-6. [DOI] [PubMed] [Google Scholar]
  13. He Z., Dong H. The roles of short-chain fatty acids derived from colonic bacteria fermentation of non-digestible carbohydrates and exogenous forms in ameliorating intestinal mucosal immunity of young ruminants. Front. Immunol. 2023;14 doi: 10.3389/fimmu.2023.1291846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Holmberg S.M., Feeney R.H., Prasoodanan P.K.V., Puertolas-Balint F., Singh D.K., Wongkuna S., Zandbergen L., Hauner H., Brandl B., Nieminen A.I., Skurk T., Schroeder B.O. The gut commensal blautia maintains colonic mucus function under low-fiber consumption through secretion of short-chain fatty acids. Nat. Commun. 2024;15:3502. doi: 10.1038/s41467-024-47594-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hou J., Lu L., Lian L., Tian Y., Zeng T., Ma Y., Li S., Chen L., Xu W., Gu T., Li G., Liu X. Effects of coated sodium butyrate on the growth performance, serum biochemistry, antioxidant capacity, intestinal morphology, and intestinal microbiota of broiler chickens. Front. Microbiol. 2024;15 doi: 10.3389/fmicb.2024.1368736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kang X., Li C., Liu S., Baldwin R.L.T., Liu G.E., Li C.J. Genome-wide acetylation modification of H3K27ac in bovine rumen cell following butyrate exposure. Biomolecules. 2023;13:1137. doi: 10.3390/biom13071137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kempf F., Drumo R., Chausse A.M., Menanteau P., Kubasova T., Roche S., Lalmanach A.C., Guabiraba R., Chaumeil T., Lariviere-Gauthier G., Caballero-Posadas I., Laroche B., Rychlik I., Virlogeux-Payant I., Velge P. The immune response modulated by inoculation of commensal bacteria at birth impacts the gut microbiota and prevents Salmonella colonization. Gut. Microbes. 2025;17 doi: 10.1080/19490976.2025.2474151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kihal A., Puyalto M., Mallo J.J. Effect of feeding protected sodium butyrate on production performance and intestinal morphology of broilers: a meta-analysis. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kogut M.H., Arsenault R.J. Immunometabolic phenotype alterations associated with the induction of disease tolerance and persistent asymptomatic infection of Salmonella in the chicken intestine. Front. Immunol. 2017;8:372. doi: 10.3389/fimmu.2017.00372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lima D.A., Furian T.Q., Pillati R.M., Silva G.L., Morgam R.B., Borges K.A., Fortes F.B.B., Moraes H.L.S., Brito B.G., Brito K.C.T., Salle C.T.P. Establishment of a pathogenicity index in Salmonella Enteritidis and Salmonella Typhimurium strains inoculated in one-day-old broiler chicks. Arq. Bras. Med. Vet. Zootec. 2016;68:257–264. doi: 10.1590/1678-4162-8259. [DOI] [Google Scholar]
  21. Liu H., Wang J., He T., Becker S., Zhang G., Li D., Ma X. Butyrate: a double-edged sword for health? Adv. Nutr. 2018;9:21–29. doi: 10.1093/advances/nmx009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Liu L., Lin L., Zheng L., Tang H., Fan X., Xue N., Li M., Liu M., Li X. Cecal microbiome profile altered by Salmonella enterica, serovar Enteritidis inoculation in chicken. Gut. Pathog. 2018;10:34. doi: 10.1186/s13099-018-0261-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu Y., Li Z., Li H., Wan S., Tang S. Bacillus pumilus TS1 alleviates Salmonella Enteritidis-induced intestinal injury in broilers. BMC. Vet. Res. 2023;19:41. doi: 10.1186/s12917-023-03598-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lowenthal J.W., Connick T.E., McWaters P.G., York J.J. Development of T cell immune responsiveness in the chicken. Immunol. Cell Biol. 1994;72:115–122. doi: 10.1038/icb.1994.18. [DOI] [PubMed] [Google Scholar]
  25. Matulova M., Stepanova H., Sisak F., Havlickova H., Faldynova M., Kyrova K., Volf J., Rychlik I. Cytokine signaling in splenic leukocytes from vaccinated and non-vaccinated chickens after intravenous infection with Salmonella Enteritidis. PLoS. One. 2012;7 doi: 10.1371/journal.pone.0032346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Melaku M., Su D., Zhao H., Zhong R., Ma T., Yi B., Chen L., Zhang H. The new buffer salt-protected sodium butyrate promotes growth performance by improving intestinal histomorphology, barrier function, antioxidative capacity, and microbiota community of broilers. Biology. 2024;13:317. doi: 10.3390/biology13050317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Montoro-Dasi L., Lorenzo-Rebenaque L., Marco-Fuertes A., Sisquella L., Gomez M., Soler P., Marco-Jimenez F., Marin C. Dual Salmonella vaccination attenuates microbiota dysbiosis and enhances microbiota functionality in poultry challenged with S. Typhimurium. Poult. Sci. 2026;105 doi: 10.1016/j.psj.2025.106140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Neurath M.F., Artis D., Becker C. The intestinal barrier: a pivotal role in health, inflammation, and cancer. Lancet Gastroenterol. Hepatol. 2025;10:573–592. doi: 10.1016/s2468-1253(24)00390-x. [DOI] [PubMed] [Google Scholar]
  29. Niu Y., Hu X., Song Y., Wang C., Luo P., Ni S., Jiao F., Qiu J., Jiang W., Yang S., Chen J., Huang R., Jiang H., Chen S., Zhai Q., Xiao J., Guo F. Blautia Coccoides is a newly identified bacterium increased by leucine deprivation and has a novel function in improving metabolic disorders. Adv. Sci. 2024;11 doi: 10.1002/advs.202309255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pat S., Ahmadipour B., Khajali F., Hassanpour H. Differential impact of sodium butyrate forms on intestinal morphology, gene expression, and growth performance in broiler chickens under cold stress at high altitude. Vet. Anim. Sci. 2026;31 doi: 10.1016/j.vas.2025.100565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Qamar F.N., Hussain W., Qureshi S. Salmonellosis including enteric fever. Pediatr. Clin. North Am. 2022;69:65–77. doi: 10.1016/j.pcl.2021.09.007. [DOI] [PubMed] [Google Scholar]
  32. Sati H., Carrara E., Savoldi A., Hansen P., Garlasco J., Campagnaro E., Boccia S., Castillo-Polo J.A., Magrini E., Garcia-Vello P., Wool E., Gigante V., Duffy E., Cassini A., Huttner B., Pardo P.R., Naghavi M., Mirzayev F., Zignol M., Cameron A., Tacconelli E., W. H. O. B. P. P. L. A. Group The WHO bacterial priority pathogens list 2024: a prioritisation study to guide research, development, and public health strategies against antimicrobial resistance. Lancet Infect. Dis. 2025;25:1033–1043. doi: 10.1016/S1473-3099(25)00118-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Xie C., Cheng J., Chen P., Yan X., Luo C., Qu H., Shu D., Ji J. Integrating gut and IgA-coated microbiota to identify Blautia as a probiotic for enhancing feed efficiency in chickens. Imeta. 2025;4 doi: 10.1002/imt2.264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ye K., Zhao Y., Huang W., Zhu Y. Sodium butyrate improves renal injury in diabetic nephropathy through AMPK/SIRT1/PGC-1α signaling pathway. Sci. Rep. 2024;14 doi: 10.1038/s41598-024-68227-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zhan Z., Tang H., Zhang Y., Huang X., Xu M. Potential of gut-derived short-chain fatty acids to control enteric pathogens. Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.976406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zhou D., Pan Q., Xin F.Z., Zhang R.N., He C.X., Chen G.Y., Liu C., Chen Y.W., Fan J.G. Sodium butyrate attenuates high-fat diet-induced steatohepatitis in mice by improving gut microbiota and gastrointestinal barrier. World J. Gastroenterol. 2017;23:60. doi: 10.3748/wjg.v23.i1.60. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data availability The 16S rRNA gene sequencing data generated in this study have been deposited in the NCBI Sequence Read Archive under BioProject accession number PRJNA1476845.

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES