Molecular characterization and risk factors analyses of zoonotic gastrointestinal nematodes in pet and semi-pet dogs in Haryana, India

Abstract

Background

Dogs play an important role in the transmission of zoonotic parasites to humans. Among these, gastrointestinal (GI) helminths are widely prevalent and pose a significant public health risk. This study investigated the prevalence, molecular characterization and risk factors analyses of gastrointestinal nematodes in pet and semi-pet dogs in Haryana, India, to assess their potential zoonotic relevance.

Results

A total of 310 faecal samples were collected from pet and semi-pet dogs from five randomly selected blocks of Hisar district of Haryana, India and examined for the presence of zoonotic GI nematodes. Of these, 77 samples (24.85%) were found positive for zoonotic GI nematodes. Among the positive samples, 73 (94.80%) exhibited single parasitic infection with Ancylostoma spp. and three (3.90%) with Toxocara spp., whereas mixed infection with both parasites was observed in only one (1.30%) sample. A Toxocara spp. worm was also observed in one of the Toxocara spp. positive faecal samples. Molecular characterization based on the cox1 gene identified Ancylostoma spp. as Ancylostoma caninum and Toxocara spp. as Toxocara canis. Phylogenetic analysis revealed that the A. caninum sequences of the present study formed a distinct clade compared to sequences reported from other countries. In case of T. canis, no geographical segregation of clades was observed and the sequences generated herein assorted with the sequences of China, Poland, Russia and Brazil origin. Univariate logistic regression analysis identified breed, deworming status, living conditions of the dog, type of housing, contact with stray dogs, history of allotriophagia, vaccination status and faecal score to be significantly associated (p < 0.05) with GI nematodosis in dogs. Multivariate analysis identified history of allotriophagia (p = 0.0158) as the major significant risk factor.

Conclusions

The high prevalence of zoonotic GI nematodes underscores the potential role of pet and semi-pet dogs as sources for these parasites. This highlights the probable risk of transmission of these zoonotic parasites to humans, particularly in settings with close human-dog interactions. Raising awareness among dog owners and caretakers regarding zoonotic GI nematodes and their routes of transmission could act as a key for controlling and preventing zoonotic GI nematodosis in dogs under the One-Health framework.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12917-026-05675-6.

Background

Dog (Canis lupus familiaris) was the first domesticated animal and has been considered the true and faithful companion of humans for centuries. Dogs play an important role in society as companion animals, guard dogs, therapy dogs and service dogs [1]. The popularity and demand of dogs as companion animals have increased with the rise of nuclear families in India [2]. Humans, particularly children, often develop close emotional bonds with dogs and animals residing in close association [3]. Pet dogs are fully owned by individuals or households, receiving regular food, shelter and veterinary care, with restricted or supervised movement [4]. On the other hand, semi-pet dogs receive partial care such as feeding or occasional shelter from individuals or the community, but are not considered fully owned [5].

Among the various parasites of dogs, gastrointestinal (GI) helminths are common, particularly in stray dogs and shelter dogs [6]. Helminth infections, especially in puppies and growing animals, cause a slow growth rate and clinical manifestations like abdominal pain, diarrhoea, anaemia and increased susceptibility to other infectious diseases [7]. The severity of infection depends on factors such as parasite species, its load, health status of the host and the presence of co-infections [8]. Additionally, climate change, increased human travel and global trade have contributed to the increased prevalence and emergence of zoonotic parasites [9].

India, being a tropical country, has diverse climatic conditions, making it appropriate for the perpetuation of a wide range of parasites of public health and zoonotic importance [10]. The most commonly reported zoonotic GI helminths in dogs in India are Toxocara canis, Taenia spp., Ancylostoma spp., Dipylidium caninum and Echinococcus species [11]. Among the zoonotic GI helminths reported in dogs in India, Ancylostoma spp. is considered predominant, with a reported prevalence ranging from 15 to 30% [12–18]. However, T. canis has also been reported with prevalence rates ranging from 12 to 24% in different studies [12–18]. Due to the close association between dogs and humans, contamination of food, water, or hands with infective stages of GI helminths can result in serious and life-threatening infections [19]. Zoonotic GI helminth infections in humans include cutaneous larva migrans, visceral larva migrans, ocular larva migrans, neural larva migrans and cystic echinococcosis [20, 21]. Several human cases of visceral larva migrans caused by T. canis have been reported from different parts of India [22–27]. In addition, cases of cutaneous larva migrans (CLM) caused by hookworms have also been observed in India [28–31]. Children, particularly those with a habit of allotriophagia, poor personal hygiene, or close contact with stray or pet puppies, are at higher risk of contracting the infection [32]. India serves as home to millions of stray dogs [33]. The environmental stages of endoparasites (including cysts, sporocysts, eggs, and larvae) are capable of prolonged survival outside the host, thereby constituting a continuous source of infection and posing a significant health hazard to both animals and humans [1].

Molecular assays, particularly polymerase chain reaction (PCR), offer a high degree of accuracy and precision in species identification as compared to microscopy, which is capable of identifying parasitic stages only up to the genus level. Polymerase chain reaction assays targeting the marker genes are helpful in differentiation of zoonotic and non-zoonotic species of the same genus in mixed infections [34]. Also, molecular characterization of GI parasites provides crucial insights about their zoonotic potential and transmission dynamics between human and animal populations [13].

Mitochondrial genes such as cytochrome c oxidase subunit 1 (cox1), cytochrome b (cytb), NADH dehydrogenase subunit 1 (nad1) and ribosomal RNA genes such as 12 S rRNA and 16 S rRNA and ribosomal internal transcribed spacers (ITS1 and ITS2) are frequently employed for species identification, phylogenetic analysis and taxonomic resolution [35, 36]. Mitochondrial genes serve as preferred markers for species identification and phylogenetic studies due to their maternal inheritance, intraspecific variability and relatively high mutation and evolution rates [37]. It helps in identifying lineage divergence, distinguishing closely related species and to study the species evolution [37].

Due to close human-dog interactions, especially in developing countries like India, there is an increased risk of transmission of zoonotic GI nematodes to humans. To the best of the authors’ knowledge, this is the first study in India to perform phylogenetic analysis of zoonotic GI nematodes in dogs based on the cox1 gene. Therefore, the present study was undertaken to determine the prevalence, associated risk factors and molecular characterization of zoonotic GI nematodes in pet and semi-pet dogs in Hisar, Haryana, India.

Methods

Study area

The present study was carried out in the Hisar district of Haryana. The district spans from 28° 56’ to 29° 38’ N latitude and 75° 21’ to 76° 18’ E longitude. Administratively, the district is subdivided into nine blocks, viz.: Adampur, Agroha, Barwala, Hansi-I, Hansi-II, Hisar-I, Hisar-II, Narnaund and Uklana.

Sample collection

Out of nine blocks in Hisar district, five blocks were selected randomly for sample collection, i.e., Agroha, Hansi-I, Hisar-I, Hisar-II and Uklana (Fig. 1). The faecal sample collection locations were chosen randomly and locations were documented using Google Maps. The pet dog owners or caretakers of semi-pet dogs in the Hisar district of Haryana were contacted to provide the fresh voided faecal samples of dogs. The samples were collected through door-to-door visits and a minimum distance of 100 m was maintained between two consecutive households. The samples were brought to the Department of Veterinary Public Health and Epidemiology, LUVAS, Hisar, on the same day of collection and stored at 4 ℃ till further processing. The sample size was estimated using the formula [38]:

Fig. 1.

Map of Hisar district of Haryana (India) illustrating the five randomly selected sampling blocks for this study

n = required sample size.

P_exp = expected prevalence.

d = desired absolute precision.

At an expected prevalence (P_exp) of 28% and desired absolute precision (d) of 5%, the sample size was estimated to be 310 samples. Therefore, a total of 310 faecal samples were collected from dogs from the randomly selected blocks during the study period, April 2025 to January 2026. The expected prevalence (P_exp) of 28% was considered as per the study carried out in the neighbouring state, Himachal Pradesh [39].

Since no official or reliable data on dog population was available for the study area, therefore the human population of the area was taken as a reference for subdividing the sample size in each block ensuring proportional representation of each randomly selected administrative block within the district. Of 310 faecal samples; n = 39 were collected from Agroha, n = 82 from Hansi-I, n = 78 from Hisar-I, n = 70 from Hisar-II and n = 41 from Uklana blocks of the Hisar district.

Coprological examination of the faecal samples

The faecal samples were examined macroscopically/ grossly for their gross appearance, consistency and presence of the parasitic stages. For microscopic examination, faecal samples were processed by concentration methods (flotation and sedimentation) for the detection of eggs of zoonotic GI nematodes [8]. For the flotation technique, Sheather’s sugar solution with a specific gravity of 1.25–1.27 was employed to float the nematode eggs. The slides prepared were examined under 100× and 400× magnification of the light microscope for the detection of nematode eggs. The observed eggs were identified on the basis of their morphological characteristics and micrometry. The micrometry was carried out using a digital micrometer (Olympus BX53 microscope with DP74 camera).

Polymerase chain reaction assay

The genomic DNA was extracted from microscopically positive faecal samples using a commercially available kit (QIAmp^® Fast DNA Stool Mini Kit, Qiagen, Germany) with modifications in the manufacturer’s protocol. For extraction of the genomic DNA from the parasitic worm, the commercially available kit (DNeasy^® Blood and Tissue Kit, Qiagen) was used following the manufacturer’s instructions. The purity and quantification of the extracted DNA was determined using a spectrophotometer (Biophotometer plus, Eppendorf, Germany).

The PCR assay was carried out to identify zoonotic GI nematodes in microscopically positive faecal samples targeting the mitochondrial cox1 gene with primers: Forward 5’–CCTACTATAATTGGTGGGTTTGGTAA− 3’ and Reverse 5’ –TGCCGCAGTAAAATAAGCACG− 3’ yielding 709 bp amplicons [40]. The PCR amplification of the targeted gene was carried out using a commercial PCR amplification kit (Takara Bio Inc., Japan) in a 25 µL reaction volume containing 12.5 µL master mix, 1.0 µL of 10 pmol of each forward and reverse primer, and ~ 100 ng template DNA and the final volume is adjusted with nuclease free water. The PCR conditions were standardized as initial denaturation at 94 °C for 5 min, followed by 35 amplification cycles of denaturation at 95 °C for 50 s, annealing at 50 °C for 50 s, extension at 72 °C for 1 min and final extension at 72 °C for 7 min.

Amplified PCR products were analyzed by agarose gel electrophoresis using 1.5% agarose gel stained with ethidium bromide (0.5 µg/mL) along with a 100 bp molecular weight marker (Genei Pvt. Ltd., India). Positive and negative controls were included in each run to validate the amplification process. The genomic DNA upon sequencing confirmed the positive faecal sample, which was further used as positive control in each run. The amplified PCR products were visualized using a gel documentation system (Zenith, India).

Sequencing and phylogenetic analysis

The amplified PCR products of the representative samples (n = 30 and three for Ancylostoma spp. and Toxocara spp., respectively) were purified using a gel extraction kit (Qiagen, Germany) and then custom sequenced in both directions by Sanger sequencing (Biokart India Pvt. Ltd., Bengaluru). The nucleotide sequences obtained after Sanger sequencing were trimmed to remove any gaps, overlapping sequences and primer sequences using BioEdit 7.2 [41]. The trimmed sequences obtained were then subjected to the Basic Local Alignment Search Tool (BLAST) analysis to confirm the identity of the parasite and submitted to GenBank for the designation of the accession numbers. The nucleotide sequences of the cox1 gene were aligned with GenBank-archived sequences for A. caninum and T. canis using Clustal W algorithm in MEGA 11 software [42]. The evolutionary relationship was inferred by constructing a phylogenetic tree with the bootstrap value of 1000 replicates using Maximum Likelihood method in MEGA 11 [43]. The Tamura-Nei model was adjudged as best substitutional model to infer evolutionary history. The closely related species of congeneric taxa i.e. Ancylostoma ceylanicum (NC_035142) and Ancylostoma duodenale (OR430619), and Toxocara cati (KX963446) were included in the hookworm and ascarid phylogenetic analyses, respectively, as outgroup species to root the trees. Along with T. cati, a sequence of another ascarid of canine origin, i.e., Toxascaris leonina (MN329693) was also included in the phylogenetic tree as an outgroup species.

Risk factors analyses

A questionnaire was designed for the collection of information from 261 pet owners and caretakers of semi-pet dogs regarding particulars of the dogs and associated risk factors (Appendix-I). The questionnaire included close-ended questions, structured using simple and comprehensible language to facilitate accurate responses. The risk factors associated with the occurrence of zoonotic GI nematodes in dogs such as age, sex, breed, body weight, body condition score (BCS), vaccination status, deworming status, administration of dewormer, living conditions, type of housing, type of feed, history of allotriophagia, contact with stray dogs, presence of any GI disorder and associated variable such as faecal score were recorded and analyzed. As the age of semi-pets and some pets couldn’t be accurately scored therefore, dogs were divided into three groups viz., puppies (< 6months), young (6–12 months) and adults (> 1year). The dogs were allocated to each age group on the basis of their morphological features and appearance. Breeds of dogs were sub-categorized into two categories, namely descriptive breeds constituting dogs with specific breed identification and non-descriptive breeds constituting mongrel dogs. The dogs were divided into four classes for body weight recording namely, 0–5 Kg, > 5–15 Kg, > 15–25 Kg and > 25 Kg.

Body condition scores from 1 to 9 were given on the basis of visual assessment of waist definition and abdominal tuck, appearance of rib fat coverage, following American Animal Hospital Association (AAHA) nutritional guidelines [44]. The nine-point faecal scoring was done as per the Waltham Centre for Pet Nutrition [45].

Various risk factors associated with the transmission of zoonotic GI nematodes to humans, such as whether children play with dogs or not and education status of the caretaker of dog, knowledge of parasitic zoonoses were also recorded and analyzed.

Statistical analyses

All the data collected during the study was systematically entered and coded in Microsoft Excel. All the statistical analyses were carried out in STATA™IC/15.1 (StataCorp, USA). Statistical tests used for data analysis were Logistic/ Conditional logistic regression. Detailed logistic regression was performed for variables with more than two categories that were found significant (p < 0.05) on univariate logistic regression analysis. Multivariate logistic regression analysis was performed including variables with p < 0.2 in the univariate logistic regression analysis to calculate adjusted odds ratio (AOR) and 95% confidence intervals (CI). The variables with p < 0.2 on univariate logistic regression analysis were tested for collinearity, and variance inflation factor (VIF) value above 5 was considered indicative of collinearity.

Results

Prevalence of gastrointestinal nematodes of zoonotic importance in dogs

Of 310 faecal samples of pet and semi-pet dogs examined, 77 (24.85%) were found positive for GI nematodes of zoonotic importance. The highest prevalence was observed in the Hisar-II block (31.43%) followed by Agroha (25.64%), Hansi-I (23.17%), Hisar-I (23.08%) and the lowest in Uklana block (19.51%) of Hisar district. The block-wise prevalence of zoonotic GI nematodes is presented in Fig. 2; Table 1.

Fig. 2.

Map showing positive and negative samples in selected blocks

Table 1.

Block wise prevalence of zoonotic gastrointestinal nematodes in dogs in Hisar district of Haryana

Block	No. of samples collected (n)	Positive (%)
Agroha	39	10 (25.64)
Hansi-I	82	19 (23.17)
Hisar-I	78	18 (23.08)
Hisar-II	70	22 (31.43)
Uklana	41	8 (19.51)

Out of 77 positive samples, 73 (94.80%) showed the single parasitic infection with Ancylostoma spp. and three (3.9%) with Toxocara spp., whereas mixed infection (Ancylostoma spp. and Toxocara spp.) was observed in only one (1.30%) sample (Fig. 3). An adult worm of Toxocara spp. was also observed in one of the Toxocara positive faecal samples and was identified based on its morphological characteristics (Fig. 4).

Fig. 3.

The eggs of the zoonotic gastrointestinal nematodes observed in the faecal samples: A & B: Embryonated Ancylostoma spp. eggs, C: Larvated Ancylostoma spp. egg, D: Toxocara spp. egg

Fig. 4.

Adult female worm of Toxocara spp

Polymerase chain reaction assay

All the microscopically positive faecal samples [Ancylostoma spp. (73), Toxocara spp. (three, including an adult parasite) and mixed (one)] subjected to PCR assay targeting the cox1 gene specific to nematodes were found positive yielding a 709 bp amplicon (Supplementary Figs. 1 & 2).

Sequencing and phylogenetic analysis

Albeit six amplicons of Ancylostoma spp. positive samples from each block were subjected to the bidirectional Sanger sequencing, but, the samples with appreciable forward and reverse reads/ consensus sequences (n = 2 from each block) were submitted to GenBank. The Sanger sequencing of the representative PCR products confirmed Ancylostoma spp. as Ancylostoma caninum and Toxocara spp. as Toxocara canis. The sequences obtained after Sanger sequencing were submitted to the GenBank database for assigning the accession numbers. The accession numbers assigned were LC916028 - LC916037, and LC916038 - LC916040 for A. caninum and T. canis species, respectively.

The nucleotide sequences of the cox1 gene of the present study A. caninum and T. canis were aligned and compared with GenBank-archived A. caninum and T. canis sequences, respectively, from India and other countries for the phylogenetic analysis. There were no sequences of A. caninum based on the cox1 gene available from India in the GenBank database.

Based on the cox1 gene, the A. caninum phylogenetic tree exhibited the grouping of sequences into three clades, 1–3 (Fig. 5). The present study isolates were clustered in a separate clade 2 indicating notable genetic diversity and geographical structuring. Clade 1 constitutes the sequences from Thailand, Slovakia, Australia, Mexico, Kenya and Brazil, while clade 3 comprised sequences from USA, Iraq, Iran, Japan, China, and Ecuador.

Fig. 5.

The maximum likelihood phylogenetic tree of Ancylostoma caninum based on the Tamura-Nei model. Each taxon is labelled with its accession number, species, place/country of origin, year and the host. The sequences of congeneric species Ancylostoma duodenale (OR430619) and Ancylostoma ceylanicum (NC_035142) are included as outgroup species to root the tree. Bootstrap values are depicted on the nodes. Solid red circles depict the sequences generated in the present study

The phylogenetic tree of T. canis based on the cox1 gene exhibited the grouping of sequences into four clades, 1–4 with no geographical segregation (Fig. 6). The present study sequences (LC916038 - LC916040) clustered in clade 1 along with sequences from India, China, Poland, Russia and Brazil. Clade 2 had sequences from Iran, Brazil, Germany, Portugal, Australia, Russia, Sri Lanka, Jordan and Turkey, whereas clade 3 from Denmark, China, Iran and Poland. Clade 4 consisted of sequences from China, Brazil, Japan, Costa Rica and Poland.

Fig. 6.

The maximum likelihood phylogenetic tree of Toxocara canis based on the Tamura-Nei model. Each taxon is labelled with its accession number, species, place/country of origin, year and the host. The sequences of Toxocara cati (KX963446) and Toxascaris leonina (MN329693) are included as outgroup species to root the tree. Bootstrap values are depicted on the nodes. Solid red circles depict the sequences generated in the present study

Risk factors analyses

Univariate logistic regression analysis

The results of univariate logistic regression analysis applied to decipher the association between the presence of zoonotic GI nematodes in dogs and the risk factors/ associated variable under the study are presented in Table 2. The results revealed that the presence of zoonotic GI nematodes in dogs was significantly associated with the breed of the dog (p < 0.001), deworming status (p < 0.001), living conditions of the dog (p < 0.001), type of housing (p < 0.001), contact with stray dogs (p < 0.001), history of allotriophagia (p < 0.001), vaccination status (p < 0.001) and faecal score (p = 0.016). The significant risk factors/ associated variable with multiple categories were further analyzed by detailed logistic regression (Table 3).

Table 2.

Univariate logistic regression analysis of risk factors/ variable associated with prevalence of gastrointestinal nematodes in dogs

Variable	Category	No. of samples collected (n)	Positive (%)	95% CI	Odds Ratio (95% CI)	p- value
Block	Agroha	39	10 (25.64)	13.04–42.13	1.01 (0.80–1.28)	0.927
	Hansi-I	82	19 (23.17)	14.56–33.80
	Hisar-I	78	18 (23.08)	14.29-34.00
	Hisar-II	70	22 (31.43)	20.85–43.63
	Uklana	41	8 (19.51)	8.82–34.87
Age	> 12 months	171	41 (23.98)	17.79–31.09	1.03 (0.70–1.50)	0.871
	6–12 months	85	23 (27.06)	17.99–37.78
	< 6 months	54	13 (24.07)	03.49–37.64
Sex	Female	125	26 (20.80)	14.06–28.97	1.45 (0.86–2.43)	0.161
	Male	185	51 (27.57)	21.26–34.60
Breed	Descriptive	192	32 (16.67)	11.69–22.70	3.08 (1.66–5.70)	< 0.001 *
	Non-descriptive	118	45 (38.13)	29.35–47.53
Body weight	> 25 kg	66	18 (27.27)	17.03–39.63	0.85 (0.69–1.05)	0.148
	< 5 kg	34	11 (32.35)	17.39–50.53
	15–25 kg	91	25(27.47)	18.63–37.83
	5–15 kg	119	23 (19.33)	12.66–27.58
Body Condition Score (BCS)	7–9	25	3 (12.00)	25.46–31.22	1.47 (0.90–2.40)	0.125
	4–6	230	58 (25.22)	19.74–31.34
	1–3	55	16 (29.09)	17.63–42.90
Deworming Status	Regular	166	18 (10.84)	65.57–16.59	3.06 (2.11–4.43)	< 0.001 *
	Irregular	59	14 (23.73)	13.62–36.59
	Not Done	85	45 (52.94)	41.80- 63.86
Administration of dewormer	Vet consultancy	61	10 (16.39)	8.15–28.09	0.79 (0.33–0.98)	0.593
	Self-administration	164	22 (13.41)	8.60–19.60
Living conditions	Pet	250	42 (16.80)	12.38–22.02	6.93 (3.42–14.04)	< 0.001 *
	Semi-pet	60	35 (58.33)	44.88–70.93
Type of Housing	Kennel	34	6 (17.65)	6.76–34.53	6.03 (2.48–14.67)	< 0.001 *
	Loose	242	45 (18.60)	13.90- 24.08
	Outdoor	34	26 (76.47)	58.83–89.25
In contact with stray dogs	No	198	29 (14.65)	10.03–20.35	4.37 (2.34–8.15)	< 0.001 *
	Yes	112	48 (42.86)	33.55–52.55
If non-veg diet given	No	168	36 (21.43)	15.48–28.41	0.61 (0.26–1.44)	0.262
	Yes	98	14 (14.29)	8.03–22.81
History of allotriophagia	No	182	19 (10.44)	6.40- 15.82	5.20 (2.57–10.54)	< 0.001*
	Yes	90	34 (37.78)	22.77–48.61
Knowledge of canine parasitic zoonoses	Yes	41	5 (12.19)	4.08–26.20	1.8 (0.64–5.05)	0.264
	No	230	46 (20.00)	15.03–25.76
Children play with them	No	137	28 (20.44)	14.03–28.16	0.79 (0.38–1.67)	0.542
	Yes	136	23 (16.91)	11.03–24.29
Number of pets in house	1 pet	165	31 (18.79)	13.14–25.60	0.91 (0.35–2.31)	0.843
	> 1 pet	92	16 (17.39)	1.028–26.70
Education status of caretaker	Graduation and above	114	14 (12.28)	6.88–17.74)	1.75 (1.05–2.92)	0.031 *
	Matric or senior- secondary	125	26 (20.80)	14.06–28.97
	Illiterate	24	7 (29.17)	12.61–51.09
Vaccination status	Complete	186	28 (15.05)	10.24–21.02	2.14 (1.53–2.99)	< 0.001*
	Incomplete /Rabies	28	6 (21.43)	8.29–40.95
	Not Done	96	43 (44.79)	34.63–55.28
Any GI disorder	No	279	68 (24.37)	19.45–29.85	1.27 (0.41–3.95)	0.680
	Yes	31	9 (29.03)	14.22–48.04
Faecal Score#	2.5,3	146	32 (21.92)	15.50–29.50	1.37 (1.06–1.77)	0.016 *
	1,1.5,2	69	13 (18.84)	10.43–30.06
	3.5	44	8 (18.18)	8.92–32.71
	4,4.5,5	51	24 (47.05)	32.93–61.54
Number of children in house	0	138	29 (21.01)	14.55–28.76	0.73 (0.45–1.12)	0.152
	1	68	14 (20.89)	11.74–32.12
	2/>2	70	8 (11.43)	5.06–21.28

*p-value < 0.05 was considered significant (marked boldly)

^#: variable associated with prevalence

Table 3.

Detailed logistic regression analysis of significant risk factors/ variable with multiple responses

Variable	Category	No. of samples (n)	Positive (%)	95%CI	Odds Ratio (95% CI)	p- value
Deworming Status	Regular*	166	18 (10.84)	65.57–16.59	-	-
	Irregular	59	14 (23.73)	13.62–36.59	2.56 (1.15–5.67)	0.021*
	Not Done	85	45 (52.94)	41.80- 63.86	9.25 (4.45–19.22)	< 0.001*
Type of Housing	Kennel*	34	6 (17.65)	6.76–34.53	-	-
	Loose	242	45 (18.60)	13.90- 24.08	1.06 (0.26–4.30)	0.928
	Outdoor	34	26 (76.47)	58.83–89.25	15.17 (3.09–74.53)	0.001 *
Education status of caretaker	Graduation and above*	114	14 (12.28)	6.88–17.74)	-	-
	Secondary or senior- secondary	125	26 (20.80)	14.06–28.97	1.87 (0.85–4.16)	0.121
	Illiterate	24	7 (29.17)	12.61–51.09	2.94 (0.96–8.99)	0.058
Vaccination status	Complete*	186	28 (15.05)	10.24–21.02	-	-
	Incomplete /Rabies	28	6 (21.43)	8.29–40.95	1.54 (0.49–4.78)	0.456
	Not Done	96	43 (44.79)	34.63–55.28	4.58 (2.36–8.88)	< 0.001 *
Faecal Score#	2.5,3*	146	32 (21.92)	15.50–29.50	-	-
	1,1.5,2	69	13 (18.84)	10.43–30.06	0.83 (0.37–1.86)	0.646
	3.5	44	8 (18.18)	8.92–32.71	0.79 (0.34–1.85)	0.591
	4,4.5,5	51	24 (47.05)	32.93–61.54	3.17 (1.51–6.62)	0.002 *

*p-value < 0.05 was considered significant (marked boldly)

^#: variable associated with prevalence

In the present study, male dogs (27.57%; p = 0.161) were observed to be more affected by GI nematodes as compared to female dogs (20.8%), however, the difference was statistically non-significant. There was no significant difference (p = 0.871) observed in positivity rates among different age groups [puppies (24.07%), young (27.06%) and adults (23.98%)]. The study reported a significantly (p < 0.001) higher prevalence in non-descriptive breeds (38.13%), with 3.08 times (95% CI: 1.66–5.77) higher odds of infection as compared to descriptive breeds (16.67%). Regularly dewormed dogs showed a significantly lower prevalence of GI nematodes (10.84%) as compared to irregularly dewormed (23.73%; OR = 2.56; 95% CI: 1.55–5.67; p = 0.021) and non-dewormed dogs (52.94%; OR = 9.25; 95% CI: 4.45–19.22; p < 0.001).

Semi-pet dogs (58.33%) were more likely to harbour the nematodes (OR = 6.93; 95% CI: 3.42–14.04; p < 0.001) than pet dogs (16.8%). Dogs living outdoors (76.47%) had significantly higher chances of acquiring parasitism than dogs housed in kennels (17.65%) (OR = 15.17; 95% CI: 3.09–74.53; p < 0.001) whereas dogs kept loose within the premises (18.6%) did not differ significantly from kennel dogs (p = 0.928).

Contact with stray dogs was identified as a significant risk factor as dogs having contact with stray dogs (42.86%) showed 4.37 times higher odds of GI nematodosis compared to those without such contact (14.65%) (OR = 4.37; 95% CI: 2.34–8.15; p < 0.001). Dogs with a history of allotriophagia (37.78%) had 5.20 times (95% CI: 2.57–10.54; p < 0.001) higher odds of GI nematodosis as compared to non-allotriophagic dogs (10.44%). Unvaccinated dogs (44.79%) had 4.58 times (95% CI: 2.36–8.88; p < 0.001) higher odds of GI nematodosis as compared to regularly vaccinated dogs (15.05%). A significant association was observed between higher faecal score and GI nematode positivity (p = 0.016). Dogs with faecal score ≥ 4 (47.05%) had 3.17 times (95% CI: 1.51–6.62; p = 0.002) more chances of infection compared to dogs with faecal scores of 2.5 and 3 (21.92%).

However, other factors such as body weight, body condition score, administration of dewormer, feeding of non-vegetarian food, presence of GI disorder, number of children and pets in house, education status of the caretaker, knowledge of parasitic zoonoses and whether children are in contact with dogs were found to be non-significantly (p > 0.05) associated with zoonotic GI nematodes in the present study.

Multivariate logistic regression analysis

Multivariate logistic regression analysis was performed by including variables with p < 0.2 in the univariate logistic regression analysis. Risk factors such as sex, breed, body weight, body condition score (BCS), deworming status, type of housing, contact with stray animals, education status of caretaker, vaccination status, number of children in the household and associated variable such as faecal score were found to be non-significantly associated (p > 0.05) with zoonotic GI nematodosis in dogs. Adjusted odds ratios (AOR) with 95% confidence intervals and p-values are shown in Table 4. Collinearity was tested using Variance Inflation Factor (VIF) with values ranging from 1.11 to 2.27, which is acceptable. The multivariate logistic regression analysis revealed that only allotriophagia was statistically associated (p < 0.05) with GI nematodosis in dogs. Therefore, allotriophagia in dogs might be a significant indicator of zoonotic GI nematode infection (AOR = 2.62; 95% CI: 1.21–5.67; p = 0.0158). This indicates that allotriophagic dogs have higher odds of contracting zoonotic GI nematodosis as compared to non-allotriophagic dogs. Deworming status of the dog showed borderline significance (AOR = 1.76; 95% CI: 1.00-3.10; p = 0.050).

Table 4.

Multivariate logistic regression analysis of variables with p < 0.2 in the univariate logistic regression analysis as predictors of zoonotic GI nematodosis in dogs

Variable	Adjusted Odds Ratio (95%CI)	p-value
Sex	1.03 (0.50–2.09)	0.941
Breed	1.01 (0.45–2.27)	0.988
Body weight (kg)	0.85 (0.61–1.17)	0.310
Body condition score (BCS)	1.03 (0.53–1.98)	0.934
Deworming status	1.76 (1.00-3.10)	0.050*
Type of housing	0.77 (0.20–2.89)	0.693
In contact with stray dogs	1.4 (0.60–3.27)	0.436
History of allotriophagia	2.62 (1.21–5.67)	0.0158*
Education status of caretaker	1.34 (0.76–2.35)	0.313
Vaccination status	0.89 (0.52–1.50)	0.656
Faecal score	1.32 (0.93–1.86)	0.115
Number of children in house	0.91 (0.59–1.41)	0.669

*p-value < 0.05 was considered significant (marked boldly)

Discussion

Zoonotic GI helminths are of significant public health concern in developing countries, including India, as they pose a considerable risk to human health. The present study was conducted in Hisar district of Haryana, India, where no prior data on the prevalence or epidemiology of canine zoonotic GI helminths was available. This study addressed the existing research gap by generating the baseline prevalence data and provided the scientific basis for the development of effective control strategies and public health interventions targeting these parasites. Ancylostoma spp. and T. canis are the primary species of hookworms and ascarids, respectively, infecting dogs worldwide [46]. Ancylostoma spp. was the predominant zoonotic GI nematode in the studied dog population, emphasizing its widespread distribution followed by T. canis, corroborating earlier observations from different parts of India [17, 47].The prevalence of GI nematodes observed in the present study was comparable to the reports from Nepal [13], South Africa [48], and Punjab, India [49], suggesting a relatively consistent occurrence of zoonotic GI nematodes in dog populations across different geographical regions. However, variations in the prevalence have also been reported worldwide, with comparatively higher prevalence documented in studies from Indore, India [47], Argentina [50, 51] and Palestine [52] and relatively lower prevalence in studies from Nigeria [53], Kenya [54] and Iran [55]. These variations in the prevalence may be attributed to differences in sample size, study population characteristics, geographical and climatic conditions, deworming status, management practices and diagnostic techniques employed [13, 56].

Ancylostoma caninum and T. canis recorded in the present study are the established etiological agents of cutaneous larva migrans and visceral larva migrans, respectively, in humans [20, 21]. Several cases of visceral and cutaneous larva migrans have been reported from different parts of India, including Mumbai, Kolkata, Himachal Pradesh and Pondicherry [29, 31, 57, 58]. This highlights the zoonotic importance of these parasites and their potential risk of transmission to humans.

The phylogenetic tree of A. caninum exhibited the grouping of sequences generated herein in a separate clade indicating notable genetic diversity and possible geographical structuring. This clustering may be influenced by environmental adaptation and regional transmission dynamics.

On the other hand, phylogenetic analysis of T. canis revealed high genetic similarity and possible conservation of mitochondrial genes of T. canis globally. The clustering of sequences originated from different countries in the same clade highlighted the absence of geographical segregation which could be associated with the host movement and long-term evolutionary conservation [59]. The presence of different geographical distribution from multiple countries suggests genetic diversity within the species.

The positivity rate of zoonotic GI nematodes was higher in male dogs compared to females, in accordance with previous reports [13, 16, 52, 60]. This difference may be attributed to androgen-mediated immunosuppression in males, leading to reduced lymphocyte proliferation and altered cytokine responses, thereby decreasing parasite clearance and increased susceptibility to parasitic infections [61]. However, no statistically significant difference was observed in the prevalence of GI nematodes among different age groups as reported previously [52].

High positivity rate in non-descript breeds compared to descriptive breeds was in consistence with the observations of other researchers [17, 47]. This may be due to unrestricted roaming, inadequate veterinary care and increased exposure to infective stages of the parasites present in the environment [17]. The higher prevalence of GI nematodes in irregularly dewormed and non-dewormed dogs might be due to frequent preventive anthelminthic treatments in regularly dewormed dogs [17, 62].

Semi-pet dogs showed a significantly higher positivity rate than pet dogs, which was in corroboration with the findings of previous studies [63]. This may be attributed to higher population density, lack of nutrition, adverse environmental conditions and lack or irregularity of anthelmintic therapy [64]. Type of housing was significantly associated with prevalence of GI nematodes, with dogs living outdoors showing a markedly higher positivity rate than dogs kept loose within the premises or in kennels, corroborating earlier findings [64]. The comparatively lower prevalence among kennel dogs may be attributed to improved management practices, hygienic conditions and prophylactic deworming measures adopted [14]. Pet and semi-pet dogs in contact with stray dogs tend to have significantly higher positivity rates compared to those without such contact, which may be due to the fact that stray dogs serve as important reservoirs of GI nematodes and contaminate the environment with their faeces containing infective parasitic stages [46].

Dogs with the history of allotriophagia were at higher risk of GI nematodosis than non-allotriophagic dogs, which may be due to increased exposure to contaminated soil, faeces, or infected materials during abnormal feeding behaviour [65]. Similarly, dogs with diarrhoeic faeces (faecal score ≥ 4) had higher positivity rates as diarrhoea is a major clinical manifestation of GI parasitism and is commonly associated with helminth-induced inflammation, irritation, and damage to the intestinal mucosa [66, 67]. Although faecal score showed a positive association with GI nematodosis, it may represent a consequence rather than a cause of parasitic infection and hence can be referred as an associated variable of prevalence rather than a risk factor.

Higher positivity rates were observed in non-vaccinated dogs and dogs with incomplete vaccination compared to fully vaccinated dogs, as also reported previously [17]. The low positivity rates in vaccinated dogs may be attributed to increased owner awareness, better adherence to veterinarian advice and improved preventive care practices [68].

Multivariate logistic regression analysis identified allotriophagia as a significant predictor of zoonotic GI nematode infection in dogs. On the other hand, deworming status showed borderline significance, suggesting a possible protective effect of regular deworming against GI nematode infections after adjusting for other covariates. No significant associations were observed for sex, breed, body weight, body condition score, housing type, contact with stray dogs, education status of caretaker, vaccination status, faecal score, or number of children in the household in the multivariate logistic regression analysis. However, the risk factors including breed of dog, housing type, contact with stray dogs, education status of caretakers, vaccination status and faecal score, which showed a significant association with GI nematodes in univariate analysis became non-significant in multivariate analysis after adjustment for other correlated risk factors. This may be attributed to confounding between variables, unequal distribution of observations across categories, and overlapping effects among predictors when their independent effects were assessed simultaneously in the multivariate analysis [69].

The present study targeted the dog population of different blocks of district Hisar of Haryana state in north India. The findings highlighted the presence of two zoonotic nematodes. However, a comprehensive study including a larger sampling population can provide an actual picture of different zoonotic parasites prevalent in the state. Moreover, the application of multiple mitochondrial genetic signatures could provide comprehensive details to elucidate the cladistics and phylogeograhy of parasites. Hence, a detailed study involving all the districts of the state (Haryana) along with the application of different mitochondrial signatures is warranted. Additionally, albeit a minimum distance of 100 m was maintained between sampled households during the door-to-door visits, sampling bias may still have been introduced due to availability and willingness of dog owners/caretakers to participate in the study. Therefore, future studies may employ pre-allocated sampling locations using GIS-based approaches to improve sampling representativeness. Another limitation of the present study was the generation of limited number of sequences for A. caninum due to the non-retrieval of appreciable forward ad reverse reads upon the bidirectional Sanger sequencing. Therefore, the phylogenetic analysis might not have fully represented the complete genetic diversity in A. caninum population circulating in the study area. Furthermore, the quantitative analysis along with the qualitative classical parasitology would have aided in epidemiological insights in hookworm infection in the canine population. The present study has generated the baseline data and hence, a comprehensive investigation considering all these research gaps is warranted.

Conclusions

The high prevalence of zoonotic GI nematodes observed in the present study underscores the significant role of pet and semi-pet dogs as sources for the zoonotic GI nematodes. The findings highlighted the potential risk of transmission of these zoonotic parasites to humans, particularly in settings with close human-dog interactions. The integration of dual diagnostic methods (microscopy and molecular identification) along with epidemiological data might serve as a valuable framework for regional zoonotic surveillance, enhancing owner awareness and supporting coordinated One Health interventions. This study also addressed the existing gap in epidemiological data regarding the zoonotic GI nematodes in dogs in the study area. The findings further emphasized the importance of adopting improved management practices along with regular awareness and surveillance programs for the effective prevention and control of helminth infections in dogs.

Authors’ contributions

**SR** : sample and data collection, investigation and writing of initial draft; **PM** : conceptualization, supervision, phylogenetic analysis, review and editing; **RG** : supervision and risk factors analyses; **DA** : supervision; **MK: ** sample collection; **ADM** : supervision, phylogenetic analysis, review and editing. All the authors read and approved the final version of the manuscript.

Funding

No funding received.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

The pet dog owners and caretakers of semi-pet dogs of the study area were contacted to provide fresh voided faecal samples of dogs. The participation in the study was entirely voluntary and informed consent was obtained from 261 pet owners and caretakers of semi-pet dogs prior to enrolment, including consent to use data pertaining to the dogs’ particulars and associated risk factors. The study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Advisory committee, Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar, Haryana, India. The participant details were kept anonymous and data confidentiality was strictly maintained. The study was survey based and did not involve any invasive procedures or experimental interventions on the study subjects.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.