Neuropeptide Y promotes myocardial fibrosis post myocardial infarction reperfusion through Neuropeptide Y receptor type 1

Abstract

Although the treatment of ischemic heart disease is becoming increasingly mature, the role of neuropeptide Y (NPY) in the pathophysiology after reperfusion still remains remains unanswered. In our study, we used a mouse model of myocardial ischemia/reperfusion (I/R) injury and demonstrated significant upregulation of NPY and its receptor NPYR1 after reperfusion. Over-expression of NPYR1exacerbates cardiac remodeling, manifested as worsening myocardial fibrosis (p < 0.01) and impaired left ventricular ejection fraction. On the contrary, NPYR1 knockdown weakened fibrosis response and improved cardiac function recovery. These findings were confirmed in HL-1 cell line subjected to hypoxia/reoxygenation model, where fibrotic markers of cardiomyocyte were similarly influenced by NPYR1 modulation. Our research findings indicate that NPY/NPYR1 signaling plays a pivotal role in maladaptive cardiac remodeling post I/R injury and is a promising therapeutic target for alleviating excessive fibrosis.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s10238-026-02253-w.

Introduction

Cardiovascular diseases (CVD) is one of the leading causes of death worldwide, despite significant geographical differences [1]. The age standardized incidence rate of the European population is 293.3 per 100,000 person-years, while low- and middle-income countries experience 233.1 CVD-related deaths annually per 100,000 individuals [2]. In China, epidemiological surveillance revealed that CVD accounted for 48.0% of total mortality in rural areas and 45.9% in urban regions during 2020 [3], imposing huge social and economic burden because of medical costs and labor force reduction. Among CVD pathologies, acute myocardial infarction (MI) represents a critical medical emergency characterized by elevated incidence (global prevalence: 1.5-2.0%), high 30-day mortality (8–10%), and frequent post-event disability. Although widespread adoption of reperfusion therapies (PCI utilization: >85% in developed nations) has improved acute-phase survival rates, pathological myocardial fibrosis persists as the principal determinant of long-term mortality, with current clinical strategies lacking targeted antifibrotic interventions.

Neuropeptide Y (NPY) was discovered initially in 1982, having been extracted from the hypothalamus of pigs. It is a highly conserved peptide of 36 amino acids, mainly synthesized by sympathetic neurons [4]. NPY, as the most plentiful neuropeptide in mammalian nervous systems, exhibits exceptional excellent biological stability with a plasma half-life of over 30 min, much longer than most regulatory peptides. Its pleiotropic functions cover numerous essential physiological processes, containing metabolic homeostasis, immunomodulation, gastrointestinal motility, and neuroendocrine regulation [5–9]. Cardiac pathophysiology uncovers a contradictory duality of NPY. Following MI, sustained sympathetic activation promotes the sustained release of NPY throughout the entire cardiac remodeling process. While facilitating tissue repair through angiogenicand neurotrophic mechanisms [10, 11], NPY’s potent vasoconstrictive properties may concurrently impair microvascular perfusion [12–15]. Clinical longitudinal data demonstrate this dichotomy: elevated plasma NPY levels at 6-month post-MI correlate with impaired ventricular function, suggesting maladaptive NPY signaling may dominate chronic phases [13].

The role of NPY suggests that NPY itself may not be the key factor affecting myocardial remodeling after myocardial infarction. NPY exerts its biological effects through its receptors, and there are five confirmed receptors in mammals (Y1R, Y2R, Y4R, Y5R, Y6R). The Y3R, which was previously named, was later proven to be the chemokine CXC chemokine receptor type 4. The receptors mainly distributed on the endocardium, myocardial cells, and vascular structures are Y1R, Y2R, and Y5R5,16 [5, 16]. Among them, Y1R is the main receptor for NPY. This study hypothesizes that partially inhibiting of the NPY function during early reperfusion after MI can reduce myocardial fibrosis.

Materials and methods

Experimental animals

Male C57BL/6 mice, aged 8 to 12 weeks (8 to 25 g), purchased from the Animal Experiment Center of Chongqing Medical University (Chongqing, China). In a specific pathogen free room, mice can freely access standard food and water under a 12 h light/dark cycle. The experiment complies with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health and has approved by the Ethics Committee of Laboratory Animal Use of Chongqing Medical University.

Ischemia/Reperfusion (I/R) model

Mice were randomized to four groups via the random number table, with each group consisting of 10 mice. The animals were weighed and then anesthetized with pentobarbital sodium at a dosage of 3 to 5 mg per 100 g of body weight. After tracheal intubation, connect to a ventilator (with respiratory rate 90 breaths per minute, tidal volume 1 ml per cycle). Then remove hair, make a midline incision in the second intercostal space on the left side of the chest to expose mouse heart. An 8 − 0 suture needle was used to ligate the left anterior descending coronary artery (LAD), with the suture needle located 3 mm away from the left atrial appendage. Remove the suture 30 min after ligation to induce I/R injury. Then, suture the muscles and skin layer by layer to close the chest cavity. For the sham surgery group, the surgical procedure was the same as the I/R procedure, except that the left anterior descending artery was not ligated. After ligation, electrocardiogram measurement was performed to confirm successful induction of I/R, characterized by ST segment elevation, with a success rate of approximately 80%. After the experiment was completed, mice were euthanized by intraperitoneal injection of barbiturates, and heart tissue samples were collected for subsequent experimental analysis.

Cell culture

The HL-1 cell line is a mouse atrial cardiomyocyte line that can be serially passaged while retaining contractility and cardiac-specific gene expression, making it a widely accepted in vitro model for cardiac research. It has been extensively used to study paracrine signaling in myocardial fibrosis. HL-1 cells provide a physiologically relevant and experimentally tractable system to investigate the paracrine contributions of cardiomyocytes to fibrotic remodeling following I/R injury. The HL-1 mouse myocardial cell line was purchased from a commercial supplier. Supplement penicillin, streptomycin, and 10% fetal bovine serum (FBS) with minimal essential medium (MEM) containing non essential amino acids (NEAA) for cultivation. In the experiment, stable HL-1 cell cultures were digested with trypsin and next cultured in six well plates ( the density is 1* 10^{^5} cells every well). Then place the plate overnight in a normoxic incubator to permit the cells to attach and grow. The plates were incubated overnight in a normoxic incubator (21% O₂, 5% CO₂, 95% relative humidity) to allow for cell adhesion and spreading. On the following day, cells in the treatment group were transferred to a hypoxic chamber maintained at 1% O₂ for 8 h. Subsequently, cells were returned to normoxic conditions for an additional 18 h to induce reoxygenation, thus establishing an in vitro model of ischemia-reperfusion injury as previously described.

Lentiviral transfection

Following the manufacturer’s instructions provided by GenePharma (China), a pre-experiment was conducted to determine the optimal multiplicity of infection (MOI), which was found to be 10. HL-1 cells were pre-cultured in 6-well plates ( the density is 1* 10^{^5} cells every well). Subsequently, 50 µl of a negative control virus, NPYR1 interfering RNA lentivirus, and NPYR1 overexpression lentivirus (each with a titer of 1 × 10^{^8} TU/ml) were introduced to the cells, respectively. Cell status was monitored a few hours post-infection. The culture medium was renewed with fresh medium within 24 h of the primary infection. 72 h after infection, the cell state and infection efficiency was observed using a fluorescence microscope, with a focus on the expression of GFP (green fluorescent protein). In addition, a heart specific NPYR1 knockdown (KD) or over-expression (OE) model was generated by injecting NPYR1 interfering RNA lentivirus or overexpression lentivirus into the hearts of MI mice. The injection was performed using a five point matrix method, each mouse was given approximately 50 µl of lentivirus solution with a titer of 1 × 10 ^ 9TU/ml.

Echocardiography

Place mice from different groups in the left lateral position for echocardiography evaluation. Collect echocardiographic images at the mitral valve level using both parasternal long and short axis views. Measure left ventricular ejection fraction (EF), fractional shortening (FS), left ventricular end diastolic diameter (LVDd), and left ventricular end systolic diameter (LVM) manipulating an M-type echocardiography system (Vinno6LAB, China) equipped with compatible ultrasound probes. Total assessments are taken from no less than three successive cardiac cycles to ensure accuracy and reproducibility.

Masson staining

Mouse heart samples were fixed overnight at 4℃ using 4% paraformaldehyde PBS solution and subsequently processed for paraffin sectioning. Following the standard protocol, paraffin-embedded sections were undergone Masson’s trichrome staining (G1340-7, Solarbio) to analyse the size of fibrotic scars. In the end, all images were collected to analyze the scar size post MI by Image J software (Wayne Rasband, NIH). For Masson’s trichrome staining, 5‑µm transverse sections were taken from the mid‑ventricular level (at the papillary muscle) of each heart, with three non‑adjacent sections per animal. The entire left ventricular cross‑section excluding cavities, epicardial fat, and papillary muscles was imaged at ×200 magnification, and fibrosis was quantified as the percentage of blue‑stained (collagen) area over total myocardial area using ImageJ with Otsu auto‑thresholding; manual threshold adjustment was performed if deviation from visual inspection exceeded 5% and was recorded. All analyses were performed blind to group allocation by two independent investigators, and the mean of the three sections was used for each animal.

Western blot assay

Extraction of total proteins was performed on cultured HL-1 cells or shredded heart tissue with lysis buffer RIPA. Then the enhanced BCA Protein Assay Kit (Beyotime, China) was applied to ascertain the concentration of protein in each group and adjusted to same concentration. Protein preparations were separated by SDS-PAGE with polyacrylamide gel, then relocated it into the polyvinylidene fluoride (PVDF) membranes (Millipore, USA). After occluded with 1 x Tris buffered saline Tween (TBST) comprising 5% skim milk powder for 2 h at room temperature, the membrane was incubated overnight with first antibody at 4 ℃, susequently incubated with second antibody for 2 h. GAPDH is considered an internal reference protein. Finally, all protein bands were displayed using the BIO-RAD chemiluminescence imaging system. Antibodies used contained anti-NPY (Novus, NBP1-46535SS), anti-NPYR1(A3116), anti-HIF-1(abcam, ab51608), anti-Col1(A1352), anti-αSMA(A177910), anti-MMP9 (A2095), anti-GAPDH (proteintech, 60004-1-Ig).

RT-qPCR

Total RNAs of HL-1 cell or mouse heart were isolated using Trizol solution. By means of reverse transcriptase reagent kit (Takara, Japan), the transcription of the total RNAs was reversed into cDNAs. Quantitative real-time PCRs of α-SMA, Collagen1, Collagen3, NPY, MMP9 were conducted utilizing reverse transcription assay kit (Takara, Japan). Lastly, we analyzed these results and melting curves by Bio-Rad software and used the 2^−ΔΔCt method to normalize the relative expression levels of genes to β-actin. The primer sequences applied at the study are all listed on Table 1.

Table 1.

Primer sequences of genes

NPY	Forward primer	TACTACTCCGCTCTGCGACA
	Reverse primer	GGGCGTTTTCTGTGCTTTCC
NPYR1	Forward primer	GAAAATCATTCAGTCCACTC
	Reverse primer	GGATGTTGGTAACATTTCTC
Col1a1	Forward primer	GCTCCTCTTAGGGGCCACT
	Reverse primer	CCACGTCTCACCATTGGGG
Col3a1	Forward primer	ACGTAGATGAATTGGGATGCAG
	Reverse primer	GGGTTGGGGCAGTCTAGTG
MMP9	Forward primer	GGGTCTAGGCCCAGAGGTAA
	Reverse primer	TAACGCCCAGTAGAGAGCCT
Hif-1α	Forward primer	TCACCAGACAGAGCAGGAAA
	Reverse primer	GCGAAGCTATTGTCTTTGGG
α-SMA	Forward primer	GAAGTATCCGATAGAACACG
	Reverse primer	CTCAAACATAATATGGGTCA
β-actin	Forward primer	GATCTGGCACCACACCTTCT
	Reverse primer	GGGGTGTTGAAGGTCTCAAA

Data analysis and statistics

Quantitative data are presented as MEAN ± SEM. Data were compared between 2 experimental groups with the 2-tailed Student t test. Data were compared between control and experimental groups with one-way ANOVA followed by Dunnett multiple comparison test. P value of < 0.05 was considered statistically significant.

Results

The expression of NPY and NPYR1 was elevated in MI/R hearts and in H/R-injured HL-1 cells

To evaluate how myocardial I/R injury affects the expression of NPY and its receptor NPYR1, we induced an I/R model in wild-type adult male C57 mice and collected heart tissues for further analysis. Immunofluorescence analysis revealed that compared with the sham group, the levels of NPY and NPYR1 proteins in the hearts of I/R mice were markedly increased (Fig. 1 A-D). RT-qPCR and Western blot analysis confirmed the increased expression of NPY, which displayed notable upregulation of NPY in the hearts of I/R mice (Fig. 1 E-G). In addition, HL-1 cells were subjected to 8 h of hypoxia/18 hours of normoxic recovery to simulate H/R injury. Western blot analysis of cell lysate demonstrated an obvious increase in NPY and NPYR1 protein expression in H/R treated cells (Fig. 1 I-J), and qRT PCR manifested a corresponding increase in NPY mRNA levels compared to control group (Fig. 1 H). Therefore, these findings indicate that both in vivo and in vitro I/R models exhibit elevated expression levels of NPY and NPYR1.

Fig. 1.

Expression of NPY in mouse myocardial cell lines and heart tissue after myocardial infarction reperfusion. A. Expression of NPY in heart tissue after MI/ R; B. Expression of NPYR1 in heart tissue after MI/ R; C-D. Statistical analysis of the number of positive cells expressing NPY and NPYR1; E. The relative mRNA expression of NPY in heart tissue after MI/ R; F. Western blot detecting the expression of proteins containing NPY and NPYR1 in heart tissue after MI/ R; G. Relative quantitative statistical analysis of NPY and NPYR1protein in heart tissue after MI/ R. H. The relative mRNA expression of NPY in mouse myocardial cell lines; cell lines. I. Western blot detecting the expression of proteins containing NPY and NPYR1in mouse myocardial. J. Relative quantitative statistical analysis of NPY and NPYR1protein in HL-1 cell. (N = 3, ** represents P<0.01). Original blots/gels are presented in Supplementary material

Knockdown of NPYR1 attenuates myocardial fibrosis following ischemia/ reperfusion in mice

To explore deeper into the effect of NPY and its receptors NPYR1 under I/R damage condition, an I/R model was constructed using wild-type adult male C57 mice. Then lentiviruses carrying NPYR1-specific interfering RNA or overexpression RNA were then injected into multiple sites to observe their effects on cardiac fibrosis. Immunofluorescence assays revealed a notable decrease in NPYR1 expression following the injection of interfering lentivirus and a corresponding increase with over-expressing lentivirus, confirming the successful transfection of NPYR1 knockdown and over-expression lentivirus in mice (Fig. 2A). To evaluate the extent of myocardial fibrosis, we measured the expression of Collagen type I (Col1) and type III (Col3), the principal constituents of the cardiac extracellular matrix that are known to accumulate under pathological conditions such as I/R injury. HIF-1α, as a key transcription factor stabilized under hypoxia, regulates multiple pro-fibrotic genes (e.g., TGF-β and collagens), linking hypoxic stress to fibrotic responses. Matrix metalloproteinase 9 (MMP9), a matrix metalloproteinase involved in extracellular matrix degradation and remodeling, plays a dual role in fibrotic homeostasis. Thus, these markers serve as reliable indicators of fibrotic response, and their alterations reflect the regulatory effect of NPYR1 on fibrosis.Western blot analysis indicated that compared with the MI/R group, treatment with NPYR1-interfering RNA lentivirus reduced the expression of Col1 and MMP9 in the heart, while over-expression of NPYR1 increased their expression (Fig. 2B-C). Moreover, mRNA levels of NPY, Hifα-1, Col1, Col3, and MMP9 were significantly decreased in hearts with NPYR1 knockdown versus the I/R group, the mRNA levels of NPY, Hifα‑1, Col1, Col3, and MMP9 were significantly decreased in NPYR1‑knockdown hearts, whereas NPYR1 over-expression promoted the elevation of these markers (Fig. 2D-H). Concurrently, Meanwhile, Masson’s trichrome staining revealed evidence of cardiac fibrosis in the infarct region of I/R mice compared with sham‑operated controls; however, this area was distinctly reduced in I/R mice with NPYR1 knockdown, while the fibrotic area was significantly increased in NPYR1 over-expressing cardiac tissues (Fig. 2I-J). Collectively, these findings suggest that down-regulating NPYR1 can inhibit myocardial cell fibrosis following I/R injury, whereas over-expression of NPYR1 exacerbates myocardial fibrosis.

Fig. 2.

Knockdown of NPYR1 modulates myocardial fibrosis myocardial fibrosis after I/R injury. A. Expression of NPY and NPYR1 in heart tissue after I/ R while injection of NPYR1 RNA interference lentivirus and overexpression lentivirus; B. Western blot were used to detect the expression of NPYR1, HIF1-α and fibrotic factor α-SMA, Col1, Col3 in the sham group, MI/ R group, I/ R+NPYR1 KD group, I/ R+NPYR1 OE respectively; Original blots/gels are presented in Supplementary material. C. Relative quantitative statistical analysis of proteins in B. D-H. RT-PCR detecting relative mRNA expression of NPY, HIF-1α and fibrotic factor α-SMA, Col1, Col3; I-J. Masson staining of cardiac paraffin sections after I/R in four groups. K. Statistical analysis of the fibrosis areas. (N = 3, ** represents P<0.01, * represents P<0.05)

Knockdown of NPYR1 can inhibit HL-1 cell fibrosis after H/R injury

Following the transfection of HL-1 cells with NPYR1 interfering RNA lentivirus and over-expression lentivirus, strong green fluorescence indicative of GFP expression was observed under fluorescence microscopy, confirming successful lentiviral transduction (Fig. 3A). Western blotting analysis results unfolded that the protein expression of Hif-1α, Col1 and MMP9 were depressed in the NPYR1 KD group, while they were prominently elevated in the NPYR1 OE group relative to H/R group (Fig. 3B-C). Moreover, the mRNA levels of NPY, Hif-1α, Col1, Col3, and MMP9 were declined in NPYR1 KD HL-1cells compared with the H/R group (Fig. 3D-F). Furthermore, we performed scratch assays to assess cell migration. Statistical analysis of the cell gap closure at 6, 12 h post-scratching revealed that under hypoxic conditions, there was no significant change in cell migration rate in the NPYR1 KD group in comparison with control group. Oppositely, the migration rate was markedly promoted in NPYR1 OE group (Fig. 3G). These findings collectively suggest that NPYR1 promotes myocardial cell fibrosis in vitro and that inhibiting NPYR1 can mitigate this effect.

Fig. 3.

The fibrosis of HL-1 cell was ameliorated under hypoxic condition while knocking down NPYR1. A. NPYR1 gene shRNA lentivirus and overexpression lentivirus were successfully transfected into HL-1; B. Western blot was used to detect the expression of NPYR1, HIF-α and fibrotic factor α-SMA, Col1, Col3 in control group, H/R group, H/R+ NPYR1 KD group, H/R+ NPYR1 OE group; Original blots/gels are presented in Supplementary material. C. Relative quantitative statistical analysis of proteins. D-F. RT-PCR detecting relative mRNA expression of NPY, HIF-α and fibrotic factor α-SMA, Col1, Col3 in control group, H/R group, H/R+ NPYR1 KD group, H/R+ NPYR1 OE group; G. Scratch test of (Control) H/R group, H/R+ NPYR1 KD group, H/R+ NPYR1 OE group. (N = 3, *** represents P<0.001, ** represents P<0.01, * represents P<0.05)

Knockdown of NPYR1 significantly restores cardiac function after I/R injury

Cardiac function was evaluated by echocardiography at 4 weeks after MI/R surgery (Fig. 4A). LVEF was significantly reduced in the MI/R group compared with the sham group. However, mice treated with NPYR1‑knockdown lentivirus showed a marked increase in LVEF, whereas NPYR1 overexpression further decreased LVEF relative to the MI/R group (Fig. 4B). Left ventricular fractional shortening (LVFS), a measure of left ventricular systolic function, was also assessed alongside LVEF to determine the systolic function of the left ventricle. The results indicated an increase in LVFS in mice treated with NPYR1 interfering RNA lentivirus and a decrease in LVFS in mice treated with NPYR1 overexpressing lentivirus (Fig. 4C). Additionally, the left ventricular end-systolic diameter (LVIDs) (Fig. 4D) and left ventricular end-diastolic diameter (LVIDd) (Fig. 4E), which serve as indicators of left ventricular systolic function in cardiac evaluations, displayed similar trends in the statistical outcomes. Taken together, these findings indicate that downregulation of NPYR1 improves cardiac function post MI/R injury, whereas its over-expression exacerbates cardiac dysfunction.

Fig. 4.

The cardiac function post MI/R 4weeks while knocking down NPYR1. A. Cardiac color Doppler ultrasound images of mice in sham group, MI/ R group, MI/ R+NPYR1 KD group, MI/ R+NPYR1 OE group; B Left ventricular ejection fraction (LVEF) of sham group, MI/ R group, MI/ R+NPYR1 KD group, MI/ R+NPYR1 OE group; C Left ventricular short axis shortening rate (LVFS) ofsham group, MI/ R group, MI/ R+NPYR1 KD group, MI/ R+NPYR1 OE group; D. Left ventricular end systolic diameter (LVIDs) of sham group, MI/ R group, MI/ R+NPYR1 KD group, MI/ R+NPYR1 OE group; E. Left ventricular end diastolic diameter (LVIDd) sham group, MI/ R group, MI/ R+NPYR1 KD group, MI/ R+NPYR1 OE group. (N = 3, **** represents P<0.0001, *** represents P<0.001, ** represents P<0.01, * represents P<0.05)

Discussion

NPY is the most abundant neuropeptide in the body and exerts a wide range of biological effects: it is involved in the maintenance of homeostasis in the nervous system, respiratory system, digestive system, circulatory system, and endocrine system, as well as in the occurrence of diseases, and is related to skin diseases, tumors, and mental disorders [17–27]. Within the cardiovascular system, accumulating evidence has linked NPY to primary hypertension, coronary atherosclerotic heart disease, and arrhythmias; it is also associated with a decline in cardiac function 6 months after myocardial infarction [9, 13, 15, 28, 29].

NPY exhibits a complex dual role in myocardial ischemic events. From one perspective, NPY has a strong vasoconstrictive effect, and its levels sharply increase in the early stages of stress after myocardial infarction, which may further exacerbate ischemia and increase the risk of heart failure and death [30]; From another perspective, NPY is also a type of angiogenic factor that can promote the formation of new blood vessels in ischemic areas and improve local blood supply [31]. This functional duality suggests that simply blocking or knocking out NPY systemically may not be an ideal treatment strategy in itself. In fact, gene knockout studies have revealed the potential risks of completely eliminating NPY signaling: Raniki et al. reported increased norepinephrine secretion, increased heart rate, and metabolic disorders in NPY knockout mice [32]; Wee et al. found that NPY deficiency severely affects bone metabolism and energy metabolism; In addition, there are significant differences in the function of different subtypes of NPY receptors Y1 receptor deficiency affects catecholamine synthesis, while Y2 receptor deficiency reduces neovascularization [33, 34]. These pieces of evidence collectively suggest that the ideal intervention strategy should suppress the pathological effects of NPY while preserving its beneficial physiological functions as much as possible.

Based on the above considerations, our study chose to specifically intervene in the Y1 receptor of NPY (NPYR1) instead of directly targeting NPY ligands, in order to explore the causal relationship between NPY/NPYR1 signaling and fibrosis regulation in the context of myocardial reperfusion injury. Unlike most previous studies that used a simple myocardial infarction model, we adopted the myocardial I/R model, which is more closely related to the widely used reperfusion treatment scenario in current clinical practice. To our knowledge, this study is the first to systematically elucidate the direct regulatory effect of myocardial cell NPYR1 on fibrosis process in an I/R model. Although previous literature has reported the role of NPY in MI and observed that increased peripheral NPY levels after reperfusion are associated with poor prognosis [9], these studies have mostly focused on NPY ligands and their overall effects, and have not yet clearly answered the following question: Does the NPYR1 receptor itself, especially in myocardial cells, directly regulate the expression of fibrosis related genes through myocardial autonomous pathways? This study provides direct evidence for this issue for the first time through experiments on functional acquisition and loss at both cellular and animal levels.

Huang et al. observed that NPY deficiency alleviated early deterioration of cardiac function after MI [35], which are consistent with our main findings. In the real world, an increasing number of patients undergo reperfusion therapy after myocardial infarction. In the re-perfused area, the development of new blood vessels is more conducive to the recovery of cardiac function. The majority of current studies on the role of NPY in myocardial infarction do not consider the more common model of post MI/R. Thus MI/R model in our research is more valuable in clinical situation. Clinical studies have also shown that elevated NPY levels after reperfusion in AMI patients are associated with an increased risk of heart failure, and that NPY induces coronary microvascular constriction through the Y1 receptor, correlating with reduced ejection fraction following STEMI. However, the distinct contribution of our study lies in shifting the analytical focus from the ligand NPY to the receptor NPYR1 and from neurogenic or immune‑derived NPY to the cardiomyocyte‑autonomous pathway. Public transcriptomic datasets support the expression of Npy1r in rodent hearts and suggest its regulation following ischemia‑reperfusion injury. Furthermore, single‑cell RNA sequencing studies have identified NPY‑positive neuronal subpopulations that innervate the heart and participate in cardiac remodeling, and NPY expression has also been detected in cardiac fibroblasts under mechanical stimulation. These independent datasets provide complementary evidence for the relevance of NPY/NPYR1 signaling in myocardial pathophysiology.

In summary, our study provides the first direct evidence, through both cellular and animal loss‑of‑function and gain‑of‑function experiments, that cardiomyocyte NPYR1 directly regulates fibrotic progression in the setting of myocardial ischemia/reperfusion. By selectively intervening at the Y1 receptor, we partially suppressed the detrimental vasoconstrictive effects of NPY while potentially preserving beneficial functions mediated through other receptor subtypes. These findings offer new experimental evidence and a theoretical framework for optimizing anti‑fibrotic strategies in the context of reperfusion injury. At the same time, we explicitly recognize that NPYR1 should be viewed as a regulatory modulator rather than a determinative factor in fibrosis, and we emphasize that elucidation of its downstream mechanisms remains a central task for future research.

The potential limitations of this article may lie in the fact that the secretion levels of NPY vary at different stages of myocardial infarction, with high secretion levels during the acute stage and lower levels at subacute and chronic phases. Its role in promoting angiogenesis may be more pronounced in the subacute and chronic phases. Suppressing or promoting the function of NPY at different stages after myocardial infarction, rather than continuously inhibiting NPY function, may have further effects on improving myocardial fibrosis. Additionally, there is genetic polymorphism in NPY1R among the population, with up to 7–12% of people having heterozygous or homozygous gene mutations, and the effects in this part of the population may be overestimated. Since our experiments were mainly performed in cardiomyocytes and whole heart tissues, we cannot rule out additional contributions from cardiac fibroblasts—the primary collagen‑producing cells. Therefore, future studies using primary fibroblasts or fibroblast cell lines will be necessary to fully define the cell‑autonomous role of NPYR1 in myocardial fibrosis and to validate the generality of our conclusions across different cardiac cell types. Another limitation of this study is the absence of bioinformatics analyses, such as single‑cell sequencing, which would have allowed deeper exploration of the regulatory mechanisms. Accordingly, we intend to pursue this direction in future studies. These are all directions worthy of further research.

Conclusion

In conclusion, using a mouse model of myocardial I/R and HL-1 cell line of H/R injury, our study indicates that NPY exerts pro‑fibrotic effects via NPY1R, and that interference with NPYR1 may attenuate early‑stage myocardial fibrosis. While these observations point to NPY1R as a candidate for therapeutic intervention, the translational relevance of our findings remains to be determined, and future studies, particularly those employing conditional knockout or pharmacological inhibitors, are required to confirm the functional significance of this pathway.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

WG proposed this project; DW, CC and BW conducted the experiments; WG and DW analyzed the data and wrote the manuscript. DW, YX and WG reviewed and revised the manuscript.

Funding

This study was supported by the Natural Science Foundation of Yongchuan District, Chongqing City. Grant number: Ycstc,2020nb0252.

Data availability

Data available on request from the authors.

Declarations

Ethics approval and consent to participate

The study was conducted in accordance with the ethical principles of the Declaration of Helsinki, and the protocol was approved by the institutional review board of Ethics Committee of Yongchuan Hospital Affiliated to Chongqing Medical University, Review No. 020 of 2023.

Competing interests

The authors declare no competing interests.

Institutional Review Board Statement

This animal study protocol was approved by the Chongqing medical University. And the study is reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).