Skip to main content
NCBI home page
Plants logoLink to Plants
. 2026 Sep 17;15(18):2843. doi: 10.3390/plants15182843

Genome-Wide Identification and Expression Pattern Analysis of the DXS Gene Family in Eucommia ulmoides

Panfeng Liu 1,†, Xiujie Xue 1,2,†, Hongyan Du 1, Jiajia Zhang 1, Kunhao Xie 1, Gengxin Lv 3, Mengke Lian 1, Qingxin Du 1,*
Editor: Emidio Albertini
PMCID: PMC13610960  PMID: 42796873

Abstract

1-deoxy-D-xylulose-5-phosphate synthase (DXS) is the first key enzyme in the methylerythritol phosphate (MEP) pathway of plant terpenoid biosynthesis, and it plays a vital role in Eucommia ulmoides terpenoid biosynthesis. In this study, bioinformatics methods were used to comprehensively identify and analyze the expression pattern of the EuDXS gene family, aiming to provide a basis for further functional study of EuDXS genes. A total of four EuDXS gene family members were identified and named EuDXS1 to EuDXS4. The encoded proteins contained 625 to 713 amino acid residues, with molecular weight ranging from 67.98 kDa to 76.61 kDa. The theoretical isoelectric points varied from 6.79 to 8.69, aliphatic index was between 85.29 and 91.29. In silico subcellular localization prediction revealed that all EuDXS proteins were localized in chloroplasts. EuDXS gene members were categorized into three subfamilies, which were unevenly distributed on three chromosomes. The promoters of EuDXS genes contained various cis-acting elements related to stress response, phytohormone signaling, light response and growth regulation. Expression pattern analysis showed that EuDXS genes exhibited tissue-specific expression: EuDXS1 was highly expressed in stem, leaf and fruit, EuDXS2 was predominantly expressed in fruit. EuDXS1 and EuDXS2 exhibited high expression levels at the early developmental stage of fruits and leaves. In addition, EuDXS genes responded to salt and drought stress in varying degrees. Transient expression in tobacco revealed that EuDXS1 and EuDXS2 could increase carotenoid and total chlorophyll content. This study will provide important genetic resources for further exploration of EuDXS gene function and germplasm innovation in E. ulmoides.

Keywords: Eucommia ulmoides, DXS gene family, genome-wide identification, expression pattern, transient expression

1. Introduction

Terpenoids are among the most diverse and functionally extensive secondary metabolites in plants, playing a significant role in plant growth and development, stress defense, and pigment biosynthesis [1]. Eucommia ulmoides Oliver is a unique precious tree species endemic to China, whose fruit, bark and leaf can synthesize and accumulate abundant terpenoid secondary metabolites with great application value in pharmaceutical, industrial and other fields. Hence, investigations into the biosynthetic pathways and molecular regulatory mechanisms underlying terpenoid biosynthesis in E. ulmoides have attracted increasing research attention [2,3]. As an important high-molecular-weight polyterpenoid, the biosynthesis of E. ulmoides rubber mainly relies on the mevalonic acid (MVA) pathway and the methylerythritol phosphate (MEP) pathway [4]. 1-deoxy-D-xylulose-5-phosphate synthase (DXS) is the first rate-limiting enzyme in the MEP pathway. DXS catalyzes the reaction between pyruvate and glyceraldehyde-3-phosphate (G3P) to form 1-deoxyxylulose-5-phosphate (DXP). This process is the first step and acts as a crucial regulatory node in the MEP pathway [5].

DXS was first isolated from Escherichia coli [6], and subsequently identified in various plant species, including Arabidopsis thaliana [7], Eriobotrya japonica [8], Solanum lycopersicum [9] and Lycium barbarum [10]. It plays a crucial regulatory role in the biosynthesis of terpenoid and responses to abiotic stress. In loquat fruits, analysis of the DXS gene expression among different varieties during the color-change stage revealed that the content of carotenoids and cryptoxanthin was positively correlated with the expression level of DXS genes [8]. Overexpression of the GmDXS1 gene in Nicotiana tabacum significantly increased the content of terpenoids (chlorophyll and carotenoids) [11]. Furthermore, overexpression of DfDXS1 and DfDXS2 derived from Dryopteris fragrans in tobacco significantly enhanced the drought and salt tolerance of transgenic plants [12]. The transcriptome sequencing of the fruits, leaves and barks revealed that the expression level of EuDXS1 generally increased with the growth and development of E. ulmoides [13]. By constructing small RNA libraries from the leaves and fruits of E. ulmoides, it was predicted that DXS was the target of miR91 and the expression pattern of DXS is opposite to that of miR91. Therefore, the synthesis of E. ulmoides rubber could be promoted by utilizing the DXS gene through down-regulating the expression of miR91 in subsequent studies [14].

The plant DXS genes are encoded by multiple genes with distinct tissue-specific expression patterns and functional specificity [15]. To date, three types of DXS genes have been reported in plants: type I genes are housekeeping genes, with AtDXS1 (CLA1) as a typical representative. Type II genes are mainly involved in plant secondary metabolism. For instance, OsDXS3 has been confirmed to regulate plant defense responses and secondary metabolic pathways. Type III genes predominantly participate in the biosynthesis of low-abundance essential isoprenoids, such as plant hormones [16,17]. Although DXS genes have been characterized in various species, systematic research on the number, gene structure and functional regulation of the EuDXS gene family in E. ulmoides remains limited. Based on the genome of E. ulmoides, we comprehensively identified the members of the EuDXS gene family and conducted an extensive bioinformatics analysis of their physicochemical property, phylogenetic relationship, gene structures, conserved motifs, chromosome locations and promoter cis-acting elements. Combined with transcriptome data and qRT-PCR, the expression pattern of EuDXS family members in different tissues (stem, leaf, fruit and bark), under salt and drought stress treatment and at different developmental stages of fruits and leaves were analyzed. Furthermore, transient expression in tobacco was performed to investigate the regulatory roles of EuDXS1 and EuDXS2 involved in terpenoid biosynthesis. This study aims to provide a theoretical foundation for further exploration of the function of EuDXS genes.

2. Results

2.1. Identification and Physicochemical Property of EuDXS Genes

Four EuDXS genes were identified based on the E. ulmoides genome using HMMER and BLASTp, named EuDXS1 to EuDXS4 (Table 1). The physicochemical property analysis of EuDXS members revealed that EuDXS2 contained the largest number of amino acids (713), while EuDXS3 and EuDXS4 had the fewest amino acids (625). The molecular weight ranged from 67.98 kDa to 76.61 kDa, and the theoretical isoelectric point varied between 6.79 and 8.69. EuDXS2 was classified as an acidic protein with an isoelectric point below 7, whereas the others were alkaline proteins. The instability index ranged from 35.43 to 40.80. The aliphatic index was between 85.29 to 91.29, with EuDXS2 showing the lowest value. The average hydrophobic index was below zero, indicating that EuDXS members are hydrophilic proteins. In silico subcellular localization prediction demonstrated that all EuDXS proteins were distributed in chloroplasts.

Table 1.

Detailed physicochemical property of EuDXS proteins.

Gene Name Gene ID Number of
Amino Acid		 Molecular
Weight/kDa		 Theoretical
pI		 Instability
Index		 Aliphatic
Index		 GRAVY In Silico Subcellular
Localization
EuDXS1 Eu0120438.1 692 75.37 8.69 40.80 85.29 −0.196 chlo
EuDXS2 Eu0127987.1 713 76.61 6.79 37.34 91.29 −0.052 chlo
EuDXS3 Eu0108829.1 625 68.01 7.96 35.43 86.16 −0.067 chlo
EuDXS4 Eu0108841.1 625 67.98 7.03 35.53 86.78 −0.057 chlo
Open in a new tab

The alpha-helix plays a crucial role in DNA-binding motifs, while random coil tends to form active and functional sites due to susceptibility to side-chain interactions. The secondary structure of EuDXS proteins consist of alpha-helices, extended strands and random coils (Table 2). The alpha-helix accounted for 36.96–40.03% with 231–277 amino acids. Random coil contained 304–353 amino acids, occupying 46.97–50.08%. The proportion order of secondary structures of EuDXS proteins was random coil, alpha-helix, extended strand.

Table 2.

Secondary structure analysis of EuDXS gene family.

Gene Name Alpha Helix Extended Strand Random Coil
Quantity Proportion Quantity Proportion Quantity Proportion
EuDXS1 277 40.03% 90 13.01% 325 46.97%
EuDXS2 270 37.87% 90 12.62% 353 49.51%
EuDXS3 232 37.12% 89 14.24% 304 48.64%
EuDXS4 231 36.96% 81 12.96% 313 50.08%
Open in a new tab

2.2. Phylogenetic Relationship and Chromosomal Distribution of EuDXS Genes

To explore the phylogenetic relationship of EuDXS gene family members, a phylogenetic tree of DXS genes among four species was constructed, E. ulmoides (four genes for each), Arabidopsis thaliana (three genes for each), Solanum lycopersicum (three genes for each) and ‘84K’ poplar (six genes for each) (Figure 1). Sixteen DXS proteins were divided into three groups. Group I contained six members: EuDXS1, SolycDXS1, AtDXS1, AtDXS2, PopDXS1a and PopDXS2. Group II included four members: EuDXS2, SolycDXS2, PopDXS1b and PopDXS1c. Group III consisted of six members: EuDXS3, EuDXS4, SolycDXS3, AtDXS3, PopDXS3a and PopDXS3b. In addition, DXS proteins from four species were distributed in both Group I and Group III, indicating that the DXS genes in these two groups share high homology and close evolutionary relationships.

Figure 1.

Figure 1

Open in a new tab

Phylogenetic tree of EuDXS Genes. Note: green circle represents E. ulmoides, yellow square represents Solanum lycopersicum, purple pentagram represents Arabidopsis thaliana, and red triangle represents ‘84K’ poplar.

Chromosomal localization analysis revealed that EuDXS genes were unevenly distributed across three chromosomes, namely Chr05, Chr11 and Chr16 (Figure 2). EuDXS1 and EuDXS2 were located on Chr11 and Chr16, respectively. EuDXS3 and EuDXS4 were adjacently located on Chr05.

Figure 2.

Figure 2

Open in a new tab

Chromosomal distribution of EuDXS genes.

2.3. Conserved Motifs and Gene Structure of EuDXS Genes

The motifs of EuDXS gene family members were analyzed by MEME-Suite (v5.5.1), and 10 distinct motifs were identified (Figure 3A). EuDXS1 and EuDXS2 contained nine motifs without motif10, exhibiting high similarity, while EuDXS3 and EuDXS4 contained all 10 motifs. Further analysis of domain structure of EuDXS genes revealed that both EuDXS1 and EuDXS2 contained the PLN02582 superfamily, while EuDXS3 and EuDXS4 possessed the PLN02225 superfamily, indicating that high structural similarity between EuDXS1 and EuDXS2, as well as between EuDXS3 and EuDXS4 (Figure 3B). Variation in exon and intron numbers were observed among EuDXS family members (Figure 3C). EuDXS1 had 13 exons and 12 introns, whereas the other three members all contained 10 exons and nine introns.

Figure 3.

Figure 3

Open in a new tab

Motif composition and gene structure of EuDXS Genes. (A) Conserved motifs. (B) Protein domains. (C) Gene structure.

2.4. Cis-Acting Elements in Promoters of EuDXS Genes

Cis-acting elements of promoter serve as binding sites for transcription factors and regulate gene expression. PlantCARE was used to predict the cis-acting elements of EuDXS genes by extracting the 2000-bp upstream promoter regions of EuDXS genes (Figure 4A). The cis-acting elements were classified into four categories: 37 elements related to abiotic and biotic stress, 67 elements related to phytohormone regulation, 50 elements associated with light responsiveness and 69 elements related to growth and development processes (Figure 4B).

Figure 4.

Figure 4

Open in a new tab

Cis-acting elements in EuDXS promoters. (A) Map of the location of cis-acting elements. (B) Heatmap illustrating the number of promoter elements.

In abiotic and biotic stress elements, ARE had the largest quantity of 12, followed by STRE (10), suggesting that EuDXS genes may participate in anaerobic regulation. For phytohormone regulation elements, 25 abscisic acid (ABA) responsive elements including ABRE, ABRE3a and ABRE4 were detected, among which ABRE was the most numerous and existed in four genes. A total of 16 methyl jasmonate responsive elements (TGACG-motif, CGTCA-motif) were identified; fourteen ethylene-responsive elements existed in all members. It could be inferred that EuDXS genes were involved in multiple phytohormones response. G-box was the most abundant light responsive element (20), followed by Box4 (12), indicating that EuDXS gene expression may be modulated by photoperiod. MYC element ranked first (29) among growth and development process.

2.5. Expression Pattern of EuDXS Genes

To elucidate the function of EuDXS genes, expression profiles of EuDXSs were further analyzed in different tissues, under salt and drought stress treatment and at different developmental stages of fruits and leaves. The results showed that the expression of EuDXS genes were varied among the stem, leaf, fruit and bark of E. ulmoides (Figure 5A). EuDXS1 exhibited the highest expression in stem, followed by fruit and leaf. EuDXS2 was primarily expressed in fruit, with expression levels significantly higher than that in other tissues. In contrast, EuDXS3 and EuDXS4 exhibited low expression levels in different tissues. As shown in Figure 5B, there were no significant differences in the expression levels of EuDXS3 and EuDXS4 across the six developmental stages of E. ulmoides fruits, and their expression levels were significantly lower than those of EuDXS1 and EuDXS2. Except for the third stage, the expression level of EuDXS2 was higher than that of other three genes across different developmental stages. Similar to the expression patterns in fruits, EuDXS3 and EuDXS4 also exhibited low expression levels at different developmental stages of leaves. EuDXS1 was highly expressed at the first two developmental stages, while EuDXS2 reached its peak expression at the second stage (Figure 5C). Moreover, both EuDXS1 and EuDXS2 exhibited high expression levels during the early developmental stages of fruits and leaves, which is a critical period for E. ulmoides rubber synthesis. It is speculated that EuDXS1 and EuDXS2 may play important roles in the biosynthesis of E. ulmoides rubber. The qRT-PCR analysis revealed that EuDXS genes responded differently to salt and drought stress (Figure 6). The expression levels of EuDXS1, EuDXS2 and EuDXS4 exhibited a trend of first increasing and then decreasing, EuDXS1 and EuDXS4 expression levels rose rapidly 2 h after the salt stress treatment (Figure 6A). Under drought stress, the expression levels of EuDXS1 and EuDXS3 both exhibited a trend of ‘decrease-rise-decrease’. EuDXS2 remained consistently upregulated, while EuDXS4 showed an expression pattern of initial upregulation followed by downregulation (Figure 6B).

Figure 5.

Figure 5

Open in a new tab

Expression pattern of EuDXS genes in different tissues (A) and developmental stages of fruits (B) and leaves (C). Note: F1 to F6 represents six developmental stages of fruits; L1 to L5 represents five developmental stages of leaves. -1/-2/-3 represents three biological replicates. Color scale indicates gene expression levels, red represents high expression and blue represents low expression.

Figure 6.

Figure 6

Open in a new tab

Expression pattern of EuDXS genes under salt (A) and drought (B) stress conditions. Note: The horizontal axis represents the treatment time. Different letters represent the significant of differences (p < 0.05).

2.6. Transient Expression in Tobacco

Considering that EuDXS1 and EuDXS2 exhibited substantially higher transcript levels compared with EuDXS3 and EuDXS4, and both showed high expression in tissues and early-developmental stages closely associated with E. ulmoides rubber biosynthesis. Therefore, EuDXS1 and EuDXS2 were prioritized for further transient expression in tobacco. The results showed that overexpressed EuDXS1 and EuDXS2 had a deeper color than the control group (Figure 7). The expression analysis results showed that both EuDXS1 and EuDXS2 were significantly expressed in transiently transformed tobacco leaves (Figure 8). We further determined the content of carotenoid and total chlorophyll, in EuDXS1 transiently transformed leaves, the carotenoid and total chlorophyll contents were significantly increased compared with CK, whereas no significant difference in these two compounds was observed between EuDXS2 and CK (Figure 9).

Figure 7.

Figure 7

Open in a new tab

Phenotypes following transient expression of EuDXS1 and EuDXS2 genes in tobacco leaves. (A) CK. (B) OE1. (C) OE2. Note: CK represents empty pCAMBIA1301-RUBY vector. OE1 and OE2 represent overexpression of EuDXS1 and EuDXS2, respectively. The same as below.

Figure 8.

Figure 8

Open in a new tab

Relative expression levels of EuDXS1 (A) and EuDXS2 (B) between CK and transiently transformed tobacco. Different letters represent the significant of differences (p < 0.05).

Figure 9.

Figure 9

Open in a new tab

Determination of carotenoid (A) and chlorophyll (B) content in CK and transiently transformed tobacco leaves. Different letters represent the significant of differences (p < 0.05).

3. Discussion

E. ulmoides rubber is a typical polyterpene compound formed by condensation of isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). The synthesis of IPP relies on the MEP and MVA pathways. As the initial key enzyme in the MEP pathway, DXS is a vital regulatory gene that modulates the supply of terpenoid precursors and promotes the efficient biosynthesis of E. ulmoides rubber [18,19]. Studies have shown that most plants contain more than one DXS gene. Specifically, 7 DXS genes have been identified in Lycium barbarum [10], 22 DXS genes in Lavandula angustifolia [20], and 5 DXS genes in Glycyrrhiza uralensis [21], indicating that the number of DXS gene family members varies significantly among different species. In this study, a total of four EuDXS genes were identified through genome-wide analysis, all of which were found to contain conserved domains and functional modules, laying a foundation for the functional diversification of the EuDXS family in E. ulmoides. The proteins encoded by EuDXS genes were hydrophilic and localized to the chloroplasts. Similarly, four AaDXS proteins of Artemisia annua and three PgDXS proteins of Platycodon grandiflorum are also localized to the chloroplast [22,23], which is consistent with the plastidial localization of the MEP pathway, confirming that the DXS proteins are synthesized in the cytoplasm and participate in the biosynthesis of terpenoids. Phylogenetic analysis among E. ulmoides, Arabidopsis thaliana, Solanum lycopersicum and ‘84K’ poplar revealed that EuDXS family members exhibited distinct branches and were classified into three subfamilies, which is consistent with those determined in most plants, such as Glycyrrhiza uralensis [21] and tea plant [24]. EuDXS1 and EuDXS2 belonged to Group I and Group II, respectively, while EuDXS3 and EuDXS4 clustered into Group III, indicating that EuDXS genes possessed diverse functions. Genes located on adjacent chromosomes generally exhibit high homology. Both EuDXS3 and EuDXS4 genes were located on chromosome 5, suggesting that they shared a high degree of homology and similar biological functions, which is in accordance with the findings of DXS gene family members in Lycium barbarum [10] and Glycyrrhiza uralensis [21].

The promoter is a specific DNA sequence located approximately 2000 bp upstream of the start codon, containing various cis-acting elements that assist plants in responding to exogenous hormones and environmental stress [25,26]. In this study, the promoters of most EuDXS genes exhibited a variety of cis-acting elements, such as stress-responsive elements, hormone-responsive elements, light-responsive elements, growth and development-responsive elements. Among the hormone-responsive elements, ABA- and ethylene-related elements were detected in all four members. Relevant studies have shown that ABA-related elements could influence terpenoid synthesis by regulating DXS gene expression [27]. In rubber trees, ethylene regulates latex-related gene expression in a dose-dependent manner by modulating ERF, thereby increasing rubber yield [28]. We hypothesize that DXS genes may be involved in responding to exogenous hormones, thereby promoting the biosynthesis of rubber-related substances. As a crucial environmental factor, light not only provides energy for photosynthesis, but also acts as a key signal regulating the entire plant life cycle and secondary metabolic pathways [29]. G-Box was the most abundant in the light-responsive element, indicating that EuDXS genes are involved in photoperiod response. Previous studies have shown that shading treatment significantly suppressed DXS expression and disrupted downstream terpenoid synthesis in fruits of peach and tomato [30,31]. Furthermore, qRT-PCR analysis indicated that EuDXS genes responded significantly to salt and drought stress. Studies revealed that transgenic tobacco with DXS overexpression exhibited markedly enhanced tolerance to drought and salt stress [12]. These results indicate that the expression of EuDXS genes in E. ulmoides is induced by multiple factors, thereby regulating terpenoid biosynthesis and responding to environmental stress.

Like most gene families, EuDXS genes exhibited differential expression patterns across various tissues and developmental stages in E. ulmoides. Previous studies have indicated that Eucommia rubber is mainly synthesized in pericarp, with its content remarkably higher than that in other tissues [32]. To investigate the EuDXS genes involved in the biosynthesis of E. ulmoides rubber, this study analyzed the expression pattern of EuDXS genes in fruits and leaves at different developmental stages, as well as in various tissues based on transcriptome data. Among different tissues, EuDXS3 and EuDXS4 showed relatively low expression levels, while EuDXS1 was predominantly expressed in leaf, stem and fruit, EuDXS2 was mainly expressed in fruit. Further analysis of EuDXS gene expression levels at different developmental stages of fruits and leaves demonstrated that EuDXS1 and EuDXS2 were highly expressed at the early stage compared to other periods and family members. Previous studies have shown that the early developmental stages of fruits and leaves are critical for the rapid synthesis of E. ulmoides rubber [33]. However, EuDXS3 and EuDXS4 exhibited relatively low transcript abundance across most tested tissues and developmental stages. Low constitutive expression of these two genes may indicate that they are not the main contributors to the basal terpenoid supply under normal growth conditions, they may function under very specific conditions, such as particular stress treatments. The qRT-PCR analysis revealed that within the first eight hours of salt and drought stress treatments in E. ulmoides seedlings, EuDXS3 exhibited a trend of first decreasing and then increasing, whereas EuDXS4 showed a pattern of first increasing and then decreasing under both stress conditions. In the present study, a transient expression system in Nicotiana benthamiana was adopted for functional characterization of EuDXS1 and EuDXS2. qRT-PCR verified that the transcript levels of target genes were markedly higher in EuDXS1 and EuDXS2 transient expression leaves than that in CK, confirming the reliability of this transient transformation system for preliminary gene-function assay. In addition, overexpression of EuDXS1 significantly increased total chlorophyll and carotenoid contents, while overexpression of EuDXS2 showed no obvious effect on photosynthetic pigments. As the first rate-limiting enzyme of the MEP pathway, overexpression of DXS enhances the accumulation of plastid-derived terpenoids such as chlorophyll, carotenoids, partial monoterpenes and diterpenoids in many plant species. Heterologous overexpression of PmDXS in tobacco significantly elevated chlorophyll and carotenoid contents, and overexpression of SmDXS2 promoted diterpene tanshinone production in Salvia miltiorrhiza hairy roots [34,35]. In summary, it can be concluded that EuDXS1 and EuDXS2 may be involved in terpenoid biosynthesis of E. ulmoides.

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

The fruits and leaves of E. ulmoides were obtained from the Yuanyang Test Base, Research Institute of Non-timber Forestry, Chinese Academy of Forestry. Fruit samples were collected starting on April 20, with sampling performed every 30 days for a total of six time-points, which were designated F1–F6. Leaf samples were collected starting on April 10, with sampling performed every 30 days for a total of five time-points, which were designated L1–L5. All samples were subjected to three biological replicates and were immediately frozen in liquid nitrogen and stored in an ultra-low temperature refrigerator at −80 °C for transcriptome sequencing.

Two-month-old E. ulmoides seedlings with consistent growth were subjected to salt stress (200 mmol·L−1 NaCl, Tianjin, China) and drought stress (20% PEG-6000, Tianjin, China) treatments. Leaves were collected at five time points including 0 h, 2 h, 4 h, 8 h and 12 h after treatment, then immediately frozen in liquid nitrogen for total RNA extraction.

Seeds of Nicotiana benthamiana L. were sown in peat in seedling trays and placed in a growth chamber maintained at 25 °C and 50% relative humidity under a 16-h light/8-h dark cycle. Once the seedlings developed three to four true leaves, they were transferred to larger trays and cultured for 5 to 6 weeks for Agrobacterium-mediated transient expression.

4.2. Genome-Wide Identification of EuDXS Gene Family

Genome data and DXS protein sequences of E. ulmoides were provided by our research group [36]. BLASTp (sequence identity threshold > 70%) and Simple HMM search (E < 1 × 10−5) function in TBtools‑II (v2.390) were used to screen DXS gene family members from the E. ulmoides genome. The sequences of candidate members were uploaded to InterPro (https://www.ebi.ac.uk/interpro/, accessed on 15 May 2026) to verify the presence of the conserved domain DXP, and only gene family members with the DXP conserved domain were retained. The pfam model was downloaded from the InterPro website to identify the PF number of the DXS gene, and PF13292 was selected for HMMER analysis. The protein sequences of candidate members were uploaded to the SMART website (https://smart.embl.de/, accessed on 16 May 2026) to identify conserved protein sequences of the candidates, and only members with characteristic DXS proteins were retained. The DXS gene family members were ultimately determined by integrating results from BLASTp and HMMER.

4.3. Physicochemical Property and Phylogenetic Relationship Analysis

The Protein Parameter Calc function of TBtools was used to analyze the amino acid number, molecular weight, isoelectric point, instability index and aliphatic index of EuDXS gene members. In silico subcellular localization prediction was performed using the Cell-PLoc website (http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc/, accessed on 20 May 2026). Protein secondary structure prediction was carried out using the NPS@ website (https://npsa.lyon.inserm.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_sopma.html, accessed on 20 May 2026).

The phylogenetic evolutionary tree of the DXS gene members from E. ulmoides, Arabidopsis thaliana, Solanum lycopersicum and ‘84K’ poplar was constructed using the MEGA-X software (v10.2.1). Genome data and DXS protein sequences of E. ulmoides were provided by our research group. The genome data and DXS protein sequences of Arabidopsis thaliana, ‘84K’ poplar and Solanum lycopersicum were downloaded from TAIR (https://www.arabidopsis.org/, accessed on 15 May 2026), NCBI (https://www.ncbi.nlm.nih.gov/, accessed on 15 May 2026) and Ensembl (https://www.ensembl.org/index.html?redirect=no, accessed on 15 May 2026), respectively. The Gene Location Visualize from GTF/GFF function embedded in TBtools was adopted to map the chromosomal distribution of EuDXS family members.

4.4. Gene Structure and Promoter Cis-Acting Elements Analysis

The MEME-Suite(v5.5.1, http://meme-suite.org/tools/meme, accessed on 26 May 2026) was applied to identify conserved motifs. The domain analysis was carried out using the NCBI-CDD tool (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 26 May 2026). All results were visualized leveraging TBTools.

The 2000-bp upstream promoter regions of EuDXS genes were extracted using TBtools, and then cis-acting elements analysis was performed with PlantCARE (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 29 May 2026).

4.5. Expression Pattern of EuDXS Genes

Transcriptome sequencing of fruits and leaves was performed by Tianjin Jizhi Gene Technology Co., Ltd. (Tianjin, China). The transcriptome data of different tissues (stem, leaf, fruit and bark) was downloaded from NCBI (PRJNA792509). The relative expression profiles of EuDXS genes were evaluated, and the heatmap was constructed by TBtools software. Real-time fluorescence quantitative PCR (qRT-PCR) reaction was performed to detect expression level of EuDXS genes under salt and drought stress. The Actin was used as the reference gene. The data was analyzed via the 2-△△Ct method, and graphs were plotted using SigmaPlot 12.5 software. The primer sequences are shown in Table 3. Relative gene-expression data were subjected to one-way analysis of variance (ANOVA), followed by Duncan multiple-comparison test for pairwise comparisons among groups.

Table 3.

Primer sequences of EuDXS genes.

Gene Name Forward (5′-3′) Reverse (5′-3′)
EuDXS1 TGGCTGTGGGAAGGGATCTA CCGGCATTGTTCATGGCTTC
EuDXS2 AAGGTTTCCGGATCGCTGTT TGAGTAGATGGCGCAGAACG
EuDXS3 TTTCTCCCAAAGTGCAGTTT GCGGTCCTTGAAATTAAGTG
EuDXS4 TTTCTCCCAAAGTGCAGTTC GCGTTCCTTGAAATTAAGTA
Actin TTGTTAGCAACTGGGATGATATGG CAGGGTGTTCTTCAGGAGCAA
Open in a new tab

4.6. Transient Expression in Tobacco

Based on the results of expression pattern analysis, EuDXS1 and EuDXS2 were selected as candidate genes. The target full-length native coding-sequence fragments of EuDXS1 and EuDXS2 were generated by gene synthesis based on their reference gene sequences. No codon optimization was performed, and the predicted N-terminal chloroplast transit peptide was fully retained in the synthetic fragments. These synthetic fragments were assembled into pCAMBIA1301-RUBY vector. The primers used for vector construction are shown in Table S1. The recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101 cells. The bacterial suspension was grown at 28 °C in selective YEB medium supplemented with rifampicin and kanamycin. After shaking for 36h, agrobacterium cells were harvested through centrifugation, resuspended in infiltration buffer to a final OD600 of 1.0. After 3 h of incubation, the agrobacterium was infiltrated into the leaves with a micro syringe. Tobacco leaves infiltrated with A. tumefaciens harboring empty pCAMBIA1301-RUBY vector were used as the control (CK). The phenotypic observation and leaf RNA extraction were performed 2 days after infiltration. Then the expression analysis of EuDXS1 and EuDXS2 was conducted by qRT-PCR. The primer sequences are shown in Table S2. The GAPDH was used as the reference gene. Further we determined the content of carotenoid and chlorophyll content in CK and transiently transformed tobacco leaves, and the methods were followed aas described by Li et al. [34].

5. Conclusions

The key role of the DXS genes in plant growth and development and terpenoid biosynthesis has been well elucidated in many plant species, however, no studies on DXS gene family in E. ulmoides have been reported yet. Here, we conducted a genome-wide identification and expression of DXS family members in E. ulmoides. A total of four EuDXS genes were identified. Phylogenetic and gene structure analysis revealed that EuDXS family members can be divided into three subfamilies, which were unevenly distributed on three chromosomes. Expression pattern analysis indicated that EuDXS1 and EuDXS2 might play specific roles in the growth and rubber synthesis of E. ulmoides. Transient expression in tobacco confirmed that EuDXS1 and EuDXS2 could increase the content of terpenoid substances such as total chlorophyll and carotenoid. Our findings will provide theoretical reference for further exploring the molecular characteristics and biological functions of EuDXS genes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants15182843/s1, File S1: The CDS sequences of four EuDXS genes. File S2: The genomic sequences of four EuDXS genes. Table S1: Primer sequences of vector construction. Table S2: Primer sequences used in transient expression.

plants-15-02843-s001.zip (143.6KB, zip)

Author Contributions

Conceptualization, P.L., X.X. and Q.D.; methodology, P.L. and X.X.; software, X.X. and J.Z.; validation, H.D., M.L. and Q.D.; formal analysis, P.L. and X.X.; investigation, J.Z., G.L. and K.X.; resources, H.D. and K.X.; data curation, Q.D.; writing—original draft preparation, P.L. and X.X.; writing—review and editing, Q.D.; supervision, P.L.; project administration, P.L. and Q.D.; funding acquisition, P.L. and Q.D. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

The data presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This research was funded by Joint Fund for Science and Technology R&D of Henan Province (grant No. 245200810111), Henan Province Natural Science Foundation Project (grant No. 252300423799).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Li C., Zha W., Li W., Wang J., You A. Advances in the Biosynthesis of Terpenoids and Their Ecological Functions in Plant Resistance. Int. J. Mol. Sci. 2023;24:11561. doi: 10.3390/ijms241411561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Du H., Hu W., Yu R. China Eucommia Rubber Resources and Industry Development Report (2013) Social Sciences Academic Press; Beijing, China: 2013. pp. 1–3. [Google Scholar]
  • 3.Jin C., Li Z., Li Y., Wang S., Li L., Liu M., Ye J. Transcriptome Analysis of Terpenoid Biosynthetic Genes and Simple Sequence Repeat Marker Screening in Eucommia ulmoides. Mol. Biol. Rep. 2020;47:1979–1990. doi: 10.1007/s11033-020-05294-w. [DOI] [PubMed] [Google Scholar]
  • 4.Bamba T., Murayoshi M., Gyoksen K., Nakazawa Y., Okumoto H., Katto H., Kobayashi A. Contribution of mevalonate and methylerythritol phosphate pathways to polyisoprenoid biosynthesis in the rubber-producing plant Eucommia ulmoides Oliver. Z. Für Naturforschung C. 2010;65:363–372. doi: 10.1515/znc-2010-5-608. [DOI] [PubMed] [Google Scholar]
  • 5.Lange B.M., Rujan T., Martin W., Croteau R. Isoprenoid biosynthesis: The evolution of two ancient and distinct pathways across genomes. Proc. Natl. Acad. Sci. USA. 2000;97:13172–13177. doi: 10.1073/pnas.240454797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sprenger G.A., Schörken U., Wiegert T., Grolle S., Graaf A.A.D., Taylor S.V., Begley T.P., Bringer-Meye S., Sahm H. Identification of a thiamin-dependent synthase in Escherichia coli required for the formation of the 1-deoxy-d-xylulose-5-Phosphate precursor to isoprenoids, thiamin, and pyridoxol. Proc. Natl. Acad. Sci. USA. 1997;94:12857–12862. doi: 10.1073/pnas.94.24.12857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Estévez J.M., Cantero A., Reindl A., Reichler S., Leon P. 1-deoxy-d-xylulose-5-Phosphate synthase, a limiting enzyme for plastidic isoprenoid biosynthesis in plants. J. Biol. Chem. 2001;276:22901–22909. doi: 10.1074/jbc.m100854200. [DOI] [PubMed] [Google Scholar]
  • 8.Zhang L., Zhang Z., Zheng T., Wei W., Zhu Y., Gao Y., Yang X., Lin S. Characterization of carotenoid accumulation and carotenogenic gene expression during fruit development in yellow and white loquat fruit. Hortic. Plant J. 2016;2:9–15. doi: 10.1016/j.hpj.2016.02.006. [DOI] [Google Scholar]
  • 9.Di X., Rodriguez-Concepcion M. Exploring the deoxy-D-xylulose-5-phosphate synthase gene family in tomato (Solanum lycopersicum) Plants. 2023;12:3886. doi: 10.3390/plants12223886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Qi C., Zhang L., Wang B., Cao J., Ma Y., Cao B. Genome-wide identification and expression analysis of LbDXS gene family in Lycium barbarum. J. Cent. S. Univ. For. Technol. 2025;45:154–165. [Google Scholar]
  • 11.Zhang M. Master’s Thesis. Nanjing Agricultural University; Nanjing, China: 2008. Identification and Characterization of Genes Encoding Key Enzymes in Soybean Non-Mevalonate Pathway. [Google Scholar]
  • 12.Zhao H., Su J., Zhong Z., Xiong T., Dai W., Zhang D., Chang Y. Functional identification and regulatory active site screening of the DfDXS gene of Dryopteris fragrans. Plants. 2024;13:2647. doi: 10.3390/plants13182647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mo J., Zhao D. The relationship between the expression of isoprene metabolic pathway genes and gutta-percha rubber contents in Eucommia ulmoides Oliver. J. Mt. Agric. Biol. 2014;33:28–32. [Google Scholar]
  • 14.Wang L., Du H., Wuyun T. Genome-wide identification of microRNAs and their targets in the leaves and fruits of Eucommia ulmoides using high-throughput sequencing. Front. Plant Sci. 2016;7:1632–1645. doi: 10.3389/fpls.2016.01632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chen J., Zhao D.G. Research advances on the enzymes and their coding gene involved in plant terpene biosynthesis. Mol. Plant Breed. 2004;2:757–764. [Google Scholar]
  • 16.Kim B.R., Kim S.U., Chang Y.J. Differential expression of three 1-deoxy-D-xylulose-5-phosphate synthase genes in rice. Biotechnol. Lett. 2005;27:997–1001. doi: 10.1007/s10529-005-7849-1. [DOI] [PubMed] [Google Scholar]
  • 17.Zeng S., Gao T., Gu M., Hou B., Ren W., Zhang Y., Ye N. Genome-wide identification and expression of the DXS gene family in Huangdan (Camellia sinensis) Chin. J. Appl. Environ. Biol. 2024;30:811–817. [Google Scholar]
  • 18.Chen D., Ye H., Li G., Liu Y. Advances in molecular biology of plant isoprenoid metabolic pathways. Acta Bot. Sin. 2000;42:551–558. [Google Scholar]
  • 19.Ganjewala D., Kumar S., Luthra R. An account of cloned genes of methyl-erythritol-4-phosphate pathway of isoprenoid biosynthesis in plants. Curr. Issues Mol. Biol. 2009;11:i35–i45. doi: 10.21775/9781912530069.05. [DOI] [PubMed] [Google Scholar]
  • 20.Kelaremu K., Chen Y., Li C., He Q., Chen L. Genome-wide identification and expression analysis of the DXS gene family in Lavandula angustifolia. Genom. Appl. Biol. 2023;42:919–926. [Google Scholar]
  • 21.Sun Y., Ouyang X., Ma H., Shi N., Yao H., Shen H. Identification of the DXS gene family in licorice and its expression analysis under abiotic stress. Plant Physiol. J. 2025;61:869–885. [Google Scholar]
  • 22.Liu W.H. Ph.D. Thesis. Chongqing University; Chongqing, China: 2016. Study on Functional Differentiation of AaDXS Gene Family and Molecular Mechanism of Low Temperature Improving Artemisinin Production in Artemisia annua L. [Google Scholar]
  • 23.Dong N., Yu H., Liu M.L., Li J., Chen B.W., Chang X.W., Wang J.T., Cha L.P., Gui S.Y. Prokaryotic expression, subcellular localization and enzyme activity analysis of DXS gene from Platycodon grandiflorum. Acta Pharmacol. Sin. 2023;58:1059–1068. [Google Scholar]
  • 24.Zhang W.H. Master’s Thesis. Anhui Agricultural University; Hefei, China: 2018. Expression, Cloning of DXS and DXR Genes in Tea Plant and Their Response to Exogenous Potassium. [Google Scholar]
  • 25.Liu J., Chen Y., Liu Y., Si F. Identification and expression analysis of TIFY transcription factors in Eucommia ulmoides. Chin. J. Exp. Tradit. Med. Formulae. 2021;27:165. [Google Scholar]
  • 26.Chen J., Lu C., Wang G., Li C., Li Y., Su F., Wang C., Zhang Y. Cloning and expression analysis of U6 promoter in Panax Quinquefolius. China J. Chin. Mater. Medica. 2023;48:2931. doi: 10.19540/j.cnki.cjcmm.20230213.101. [DOI] [PubMed] [Google Scholar]
  • 27.Dabiri M., Majdi M., Bahramnejad B. Partial sequence isolation of DXS and AOS genes and gene expression analysis of terpenoids and pyrethrin biosynthetic pathway of Chrysanthemum cinerariaefolium under abiotic elicitation. Acta Physiol. Plant. 2020;42:30. doi: 10.1007/s11738-020-3019-2. [DOI] [Google Scholar]
  • 28.Wan J., Fan R., Yang W., Wei F., Gao H., Wei H., Qiu J. New insights into ethylene-induced latex flow in a dose-dependent manner in rubber tree. Ind. Crops Prod. 2024;222:120012. doi: 10.1016/j.indcrop.2024.120012. [DOI] [Google Scholar]
  • 29.Zhu M.Y. Master’s Thesis. Northeast Forestry University; Harbin, China: 2016. Effect of Light on Alkaloid Synthesis and Gene Expression Levels in Catharanthus roseus Seedlings. [Google Scholar]
  • 30.Dong X.T. Master’s Thesis. Hebei Agricultural University; Baoding, China: 2015. Effect of Shading Bagging on Quality Traits Such as Carotenoid Accumulation and Related Gene Expression in Yellow Peach Fruit. [Google Scholar]
  • 31.Li X.M. Master’s Thesis. Zhejiang University; Hangzhou, China: 2020. Study on the Role of HY5 in Carotenoid Synthesis in Tomato Fruit. [Google Scholar]
  • 32.Xie B., Du H., Du L., Fu J. Variations of gutta-percha content in samara from different Eucommia ulmoides forms. Sci. Silvae Sin. 2005;41:144–146. [Google Scholar]
  • 33.Wuyun T., Wang L., Liu H., Wang X., Zhang L., Bennetzen J.L., Li T., Yang L., Liu P., Du L., et al. The hardy rubber tree genome provides insights into the evolution of polyisoprene biosynthesis. Mol. Plant. 2018;11:429–442. doi: 10.1016/j.molp.2017.11.014. [DOI] [PubMed] [Google Scholar]
  • 34.Liu Y., Wang Y., Wang X., Li Y. Characterization and function of the 1-deoxy-D-xylose-5-phosphate synthase (DXS) gene related to terpenoid synthesis in Pinus massoniana. Int. J. Mol. Sci. 2021;22:1190. doi: 10.3390/ijms22020848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wu Y., Zhou J., Li M., Wang G. Molecular cloning and characterization of two 1-deoxy-D-xylulose-5-phosphate synthase genes involved in tanshinone biosynthesis in Salvia miltiorrhiza. J. Exp. Bot. 2010;61:3587–3598. [Google Scholar]
  • 36.Du Q., Wu Z., Liu P., Qing J., He F., Du L., Sun Z., Zhu L., Zheng H., Sun Z., et al. The chromosome-level genome of Eucommia ulmoides provides insights into sex differentiation and α-linolenic acid biosynthesis. Front. Plant Sci. 2023;12:1118363. doi: 10.3389/fpls.2023.1118363. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

plants-15-02843-s001.zip (143.6KB, zip)

Data Availability Statement

The data presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Articles from Plants are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES