ABSTRACT
To investigate the role of cathepsin B (CTSB) in microglial ferroptosis after subarachnoid hemorrhage (SAH) and its upstream regulatory mechanisms. A SAH mouse model was established, and BV2 microglial cell line was utilized. Gene expression was detected by qRT‐PCR and western blot. Co‐immunoprecipitation was performed to verify the interaction between NEDD4 and CTSB. CCK‐8 and PI staining were used to evaluate cell viability and death. Immunofluorescence was employed to observe protein localization and oxidative stress marker levels. TUNEL staining was conducted to detect neuronal apoptosis. CTSB was specifically upregulated in microglia after SAH. CTSB knockdown significantly enhanced cell viability, reduced cell death, and reversed the abnormal changes in ferroptosis‐related proteins and oxidative stress markers induced by hemin/RSL3. Mechanistically, NEDD4 was identified as an E3 ubiquitin ligase for CTSB, capable of directly binding and ubiquitinating CTSB protein for degradation. NEDD4 overexpression effectively reduced CTSB protein levels in SAH mouse brains while simultaneously alleviating brain edema, neuronal apoptosis, and neurological deficits, significantly inhibiting ferroptosis after SAH. NEDD4 attenuates secondary brain injury after SAH by ubiquitinating and degrading CTSB, thereby inhibiting microglial ferroptosis.
Keywords: CTSB, NEDD4, SAH, ubiquitination
NEDD4 attenuates secondary brain injury after SAH by ubiquitinating and degrading CTSB, thereby inhibiting microglial ferroptosis.

1. Introduction
Subarachnoid hemorrhage (SAH) is a critical cerebrovascular disease characterized by high morbidity and mortality rates, with pathological mechanisms involving early brain injury, inflammatory responses, oxidative stress, and multiple cell death processes [1]. In recent years, ferroptosis, an iron‐dependent form of programmed cell death, has garnered increasing attention for its role in secondary neurological injury after SAH [2]. Studies have demonstrated that microglia, as the primary immune cells in the central nervous system, are extensively activated after SAH and may undergo ferroptosis, subsequently releasing large amounts of inflammatory factors and oxidative substances that exacerbate neuronal injury and blood‐brain barrier disruption [3]. Elucidating the specific molecular regulatory mechanisms of microglial ferroptosis is important for developing novel neuroprotective strategies targeting SAH.
Cathepsin B (CTSB) is a lysosomal cysteine protease that not only participates in intracellular protein degradation and metabolic regulation but also plays important roles in inflammation, cellular autophagy, and death processes [4, 5]. Recent studies have found that CTSB is upregulated in neurological injury models, such as intracerebral hemorrhage and ischemia‐reperfusion, and may participate in the regulation of cellular ferroptosis by promoting oxidative stress and lipid peroxidation [6, 7]. However, in the context of SAH, whether CTSB specifically regulates microglial ferroptosis remains lacking direct evidence. It is noteworthy that the protein stability and function of CTSB are precisely regulated by post‐translational modifications such as ubiquitination, wherein E3 ubiquitin ligase‐mediated targeted degradation may be a key factor influencing its expression and activity [7].
Among the E3 ubiquitin ligase family, neural precursor cell expressed developmentally down‐regulated protein 4 (NEDD4), as an important member of the HECT family, is extensively involved in the regulation of cell survival, inflammation, autophagy, and stress responses [8]. Through systematic screening of potential E3 ligases for CTSB using bioinformatics tools (including PhosphoSitePlus and UbiBrowser databases), NEDD4 was found to have high confidence for ubiquitination modification binding to CTSB, suggesting its potential role as an upstream molecule regulating CTSB stability. Previous studies have indicated that NEDD4 can exert protective effects through ubiquitin‐mediated degradation of target proteins in neurodegenerative diseases and ischemic brain injury [9, 10]. However, whether it participates in microglial ferroptosis regulation by targeting CTSB in SAH models remains to be thoroughly investigated.
Based on the above background, this study aims to investigate the critical role of CTSB in microglial ferroptosis after SAH, with particular focus on validating whether NEDD4 acts as an E3 ubiquitin ligase mediating the ubiquitination and degradation of CTSB, thereby participating in the regulation of ferroptosis and neurological injury after SAH. The research findings are expected to provide new perspectives for in‐depth understanding of the molecular mechanisms of cell death after SAH and offer theoretical basis for developing intervention strategies targeting the NEDD4‐CTSB signaling axis.
2. Methods
2.1. Animal Models
Adult male C57/BL6 mice (weighing 20–25 g, purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd.) were used in this study and randomly divided into four groups: sham‐operated group (Sham), SAH model group (SAH), SAH + empty vector control group (SAH + LV‐NC), and SAH + NEDD4 overexpression virus group (SAH + LV‐NEDD4). Each group consisted of six mice. Sample size was determined by power analysis (α = 0.05, power = 0.8) based on pilot data, with n = 6 per group ensuring adequate statistical power. The SAH model was established using the endovascular perforation method. The procedure was briefly performed as follows: mice were anesthetized with intraperitoneal injection of pentobarbital (40 mg/kg), and a 5‐0 monofilament nylon suture was inserted through the external carotid artery into the left internal carotid artery, then advanced to the bifurcation of the anterior cerebral artery and middle cerebral artery to perform vascular perforation. After repeated puncturing four times, the nylon suture was withdrawn. The sham‐operated group underwent identical surgical procedures except for the vascular perforation. Vectors for each group were administered via intraperitoneal injection 30 min prior to SAH modeling. All animal experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee, ZJCLA, approval number [ZJCLA‐IACUC‐25010033]. Neurological scoring and brain water content measurements were performed blinded to group allocation.
2.2. Cell Culture and Treatment
BV2 microglial cells were cultured in DMEM/F12 medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37°C in a 5% CO2 incubator. For functional experiments, cells were divided into the following treatment groups: shNC group, shCTSB group, Hemin (60 μM) group, Hemin + shCTSB group, RSL3 (2 μM, a direct GPx4 inhibitor and ferroptosis inducer) group, RSL3 + shCTSB group, and NEDD4 overexpression group (NEDD4).
2.3. Real‐Time Quantitative Polymerase Chain Reaction (qRT‐PCR)
Total RNA was extracted from mouse brain tissues or cells using TRIzol reagent. cDNA was synthesized using a reverse transcription kit. Subsequently, amplification reactions were performed on a quantitative PCR instrument using SYBR Green premix reagent. GAPDH was used as the internal reference gene, and the relative mRNA expression levels of CTSB and NEDD4 were calculated using the 2^(‐ΔΔCt) method. The primer sequences used are listed in Table 1.
Table 1.
The primer sequences.
| Name | Primer | Sequences (5′−3′) |
|---|---|---|
| CTSB | Forward | AGTGGGAGTTGAGGACCAAC |
| Reverse | TCCAGGTACTCCCCATCAAG | |
| NEDD4 | Forward | CAGCAAGACCAAGCTGAAGG |
| Reverse | GCTGGGTCTTGTAGTGCATG | |
| GAPDH | Forward | AGGTCGGTGTGAACGGATTTG |
| Reverse | TGTAGACCATGTAGTTGAGGTCA |
2.4. Western Blot
Total proteins were extracted from mouse brain tissues or cells using RIPA lysis buffer, and protein concentrations were determined by the BCA method. Equal amounts of protein samples were separated by SDS‐PAGE electrophoresis and transferred to PVDF membranes. After blocking with 5% skim milk, membranes were incubated with specific primary antibodies overnight at 4°C, including anti‐CTSB (31399‐1‐AP, Proteintech, USA, 1:1000), anti‐NEDD4 (21698‐1‐AP, Proteintech, USA, 1:3000), anti‐GPX4 (67763‐1‐Ig, Proteintech, USA, 1:2000), and anti‐GAPDH (60004‐1‐Ig, Proteintech, USA, 1:100000). The following day, after incubation with HRP‐conjugated secondary antibodies, membranes were developed using ECL chemiluminescent reagent, and images were captured using an imaging system. Band intensity analysis was performed using ImageJ software.
2.5. Immunofluorescence Staining
Following perfusion, mouse brains were harvested, and frozen brain sections were prepared. Cells were cultured and treated on coverslips. Samples were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X‐100, and blocked with 5% BSA. Subsequently, samples were incubated with primary antibodies overnight at 4°C, including anti‐CTSB (31399‐1‐AP, Proteintech, USA, 1:100), anti‐Iba1 (10904‐1‐AP, Proteintech, USA, 1:100), anti‐GFAP (16825‐1‐AP, Proteintech, USA, 1:100), and anti‐NeuN (26975‐1‐AP, Proteintech, USA, 1:300). The following day, samples were incubated with corresponding fluorescently labeled secondary antibodies for 2 h at room temperature in the dark. Finally, samples were mounted with DAPI‐containing mounting medium and observed under a confocal microscope for image acquisition.
2.6. Cell Viability and Death Detection
Cell viability (CCK‐8 assay): Treated BV2 cells were seeded in 96‐well plates, and 10 μL CCK‐8 reagent was added to each well. After incubation at 37°C for 2 h, absorbance values at 450 nm were measured using a microplate reader.
Cell death (PI staining): Treated cells were incubated with propidium iodide (PI) working solution (final concentration 5 μg/mL) in the dark for 15 min, washed with PBS, and immediately observed under a fluorescence microscope to count red fluorescent cells.
2.7. TUNEL Staining
Neuronal apoptosis in brain tissues was detected using a commercial TUNEL cell apoptosis detection kit. Briefly, paraffin sections were deparaffinized and rehydrated, repaired with proteinase K, then incubated with TUNEL reaction mixture at 37°C in the dark for 1 h. Finally, cell nuclei were counterstained with DAPI and observed under a fluorescence microscope. TUNEL‐positive cells (green fluorescence) represented apoptotic cells.
2.8. Brain Water Content Measurement
The degree of brain edema following SAH was assessed using the wet‐dry weight method. After sacrificing mice, intact brains were rapidly harvested and weighed (wet weight). Subsequently, brains were placed in a 100°C oven and dried for 72 h to constant weight, then weighed (dry weight). Brain water content (%) = [(wet weight ‐ dry weight)/wet weight] × 100%.
2.9. Co‐Immunoprecipitation (Co‐IP)
To verify the protein interaction between NEDD4 and CTSB, Co‐IP experiments were performed. The procedure was briefly as follows: BV2 microglial cells were treated with DMSO or hemin, then cells were harvested and whole cell lysates (WCL) were extracted. Control IgG (ab205718), anti‐NEDD4 antibody (ab240753), and anti‐CTSB antibody (ab30443) were respectively incubated with the lysates overnight at 4°C. Subsequently, Protein A/G magnetic beads were added to capture the antigen‐antibody complexes. After washing, the co‐precipitated target proteins were detected by western blot to analyze the interaction between NEDD4 and CTSB.
2.10. Neurological Function Assessment
At 24 h post‐SAH, neurological function of mice was evaluated using the modified Garcia scoring system by researchers blinded to experimental groups. The modified Garcia score includes six items: spontaneous activity, limb movement, forepaw extension, climbing, body proprioception, and vibrissae response (total score 3‐18 points). Lower scores indicate poorer neurological function.
2.11. Determination of Malondialdehyde (MDA), Ferrous Ion (Fe2+), Reduced Glutathione (GSH), and Oxidized Glutathione (GSSG) Content
The intracellular contents of MDA, Fe2+, GSH, and GSSG were determined using corresponding detection kits, strictly following the operating instructions provided by each manufacturer. All kits were purchased from Abbkine Scientific Co. Ltd. The procedure was briefly as follows: treated BV2 cells were collected, and cell lysates were prepared. MDA assay kit, Fe2+ colorimetric detection kit, GSH detection kit, and GSSG detection kit were used respectively to detect absorbance values at specific wavelengths, and the content of each indicator was calculated through standard curves. Each sample was measured in triplicate (intra‐assay CV < 8%, inter‐assay CV < 12%).
2.12. Intracellular Lipid Peroxidation (LPO) Level Detection
The LPO levels in BV2 cells were detected using the Image‐iT® Lipid Peroxidation Sensor (C10445, Invitrogen, USA). The procedure was briefly as follows: cells were incubated with the probe at a final concentration of 10 μM for 30 min at 37°C in the dark. The intracellular LPO levels were quantitatively assessed by monitoring the ratio of emission fluorescence intensity at 590–510 nm.
2.13. Intracellular Reactive Oxygen Species (ROS) Level Detection
ROS levels in BV2 cells were detected using the MitoSOX™ Red fluorescent probe (M36008, Invitrogen, USA). Cells were incubated with 5 μM MitoSOX for 30 min at 37°C in a dark environment. Samples were randomly selected from each group for imaging, and experiments were independently repeated three times. Fluorescence intensity was quantitatively analyzed using ImageJ software.
2.14. Statistical Analysis
All data are presented as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism software. Student's t‐test was used for comparisons between two groups, and one‐way analysis of variance (One‐way ANOVA) was used for multiple group comparisons, with Tukey's post hoc test. p < 0.05 was considered statistically significant.
3. Results
3.1. CTSB Is Highly Expressed in Microglia After SAH
To investigate the association between CTSB and SAH, we established a SAH mouse model and examined CTSB expression in the brain tissues. The results demonstrated that both mRNA and protein levels of CTSB were significantly elevated in the SAH group compared to the Sham group (Figure 1A, B). Immunofluorescence staining further revealed that CTSB was predominantly localized in microglia rather than neurons or astrocytes (Figure 1C). These findings indicate that CTSB is specifically upregulated in microglia after SAH.
Figure 1.

CTSB is highly expressed in microglia after SAH. Mice were divided into two groups (n = 6 per group): Sham and SAH. (A, B) The mRNA and protein levels of CTSB in mouse brain tissues were detected by qRT‐PCR and Western blot, respectively. (C) Immunofluorescence staining was used to detect the co‐localization of CTSB with neurons (NeuN, red), astrocytes (GFAP, red), and microglia (Iba‐1, red). Scale bar = 100 μm. n = 6 mice per group as independent biological replicates. **p < 0.01, versus Sham.
3.2. CTSB Knockdown Significantly Attenuates Ferroptosis in BV2 Microglia
To investigate the role of CTSB in microglial ferroptosis, we treated BV2 microglia with shCTSB, hemin, and RSL3, followed by functional assays. The results showed that shCTSB significantly reduced CTSB mRNA and protein expression, while hemin increased the expression levels, and shCTSB could reverse the hemin‐induced effects (Figure 2A). CCK‐8 assays demonstrated that CTSB knockdown enhanced cell viability and reversed the viability reduction caused by hemin or RSL3 (Figure 2B, G). PI staining indicated that CTSB knockdown reduced cell death and reversed hemin‐induced cell death (Figure 2C). Western blot analysis revealed that CTSB knockdown decreased ferroptosis‐related proteins ALOX15 and ACSL4 while increasing GPX4, whereas hemin or RSL3 treatment showed opposite trends, which could be reversed by shCTSB (Figure 2D, H). Immunofluorescence and biochemical assays further demonstrated that CTSB knockdown significantly reduced hemin‐induced accumulation of LPO, ROS, and MDA (Figure 2E, F, I). These results indicate that CTSB knockdown can significantly inhibit microglial ferroptosis and related oxidative stress markers.
Figure 2.

CTSB knockdown attenuates Hemin‐ or RSL3‐induced ferroptosis in BV2 microglial cells. BV2 microglial cells were divided into four groups: shNC, shCTSB, Hemin, Hemin + shCTSB. (A) RT‐qPCR and Western blot analysis of CTSB mRNA and protein levels in BV2 cells after shCTSB knockdown. (B) Cell viability measured by CCK‐8 assay. (C) Cell death assessed by PI staining. (D) The protein levels of ferroptosis‐related markers (ALOX15, ACSL4, GPX4) were detected by Western blot. (E) Immunofluorescence staining of LPO (Image‐iT®, 590/510 nm ratio) and ROS (MitoSOX™ Red). Scale bar = 100 μm. (F) The MDA content was quantified by ELISA. BV2 microglial cells were divided into three groups: Control, RSL3, RSL3+ shCTSB. (G) Cell viability. (H) The protein levels of ferroptosis‐related markers (ALOX15, ACSL4, GPX4). (I) The MDA content. All in vitro experiments were independently repeated at least three times (n = 3). **p < 0.01, versus shNC or Control. ##p < 0.01, versus Hemin or RSL3.
3.3. NEDD4 Ubiquitinates and Degrades CTSB
To investigate the degradation mechanism of CTSB, we screened potential E3 ubiquitin ligases through PhosphoSitePlus (https://www.phosphosite.org/) and UbiBrowser (http://ubibrowser.bio-it.cn/ubibrowser/) databases and identified NEDD4 as a potential E3 ubiquitin ligase for CTSB (Figure 3A, B). Co‐IP experiments confirmed the interaction between NEDD4 and CTSB, with this interaction being weakened under hemin treatment (Figure 3C). Furthermore, NEDD4 overexpression reduced CTSB protein levels without affecting its mRNA expression (Figure 3D, E). To directly verify whether NEDD4 ubiquitinates CTSB, we performed Co‐IP ubiquitination assay. As shown in Figure S1A, NEDD4 overexpression markedly enhanced CTSB ubiquitination. CHX chase assay further demonstrated that NEDD4 shortened CTSB half‐life from approximately 6 h to 3 h (Figure S1B). Moreover, MG132, but not NH4Cl, reversed NEDD4‐induced CTSB downregulation (Figure S1C), indicating that NEDD4 promotes CTSB degradation primarily via the proteasomal pathway. These findings suggest that NEDD4 promotes CTSB degradation through ubiquitination at the post‐translational level.
Figure 3.

NEDD4 ubiquitinates and degrades CTSB. (A) Visualizing post‐translational modification sites in lollipop plots. The lollipop plots illustrate the phosphorylation (blue), acetylation (green), ubiquitination (brown), and other (gray) post‐translational modification sites on CTSB. (B) Nedd4 is predicted as the specific E3 ligase of CTSB by UbiBrowser database. (C) The interaction between endogenous NEDD4 and CTSB was confirmed by Co‐IP. (D) RT‐PCR was performed to detect the mRNA expression level of CTSB in BV2 microglia. (E) Western blot was performed to detect the protein expression level of CTSB in BV2 microglia. All in vitro experiments were independently repeated at least three times (n = 3). **p < 0.01 vERSUs Vector.
3.4. NEDD4 Overexpression Alleviates Brain Injury After SAH
To further evaluate the role of NEDD4 in SAH, we constructed a SAH mouse model with NEDD4 overexpression. The results showed that NEDD4 mRNA and protein expression were significantly increased in the LV‐NEDD4 treatment group, while CTSB protein levels were markedly decreased without significant changes in mRNA levels (Figure 4A, B). TUNEL staining demonstrated that NEDD4 overexpression reduced neuronal apoptosis (Figure 4C). Additionally, NEDD4 overexpression effectively reduced brain edema after SAH (Figure 4D) and improved neurological function scores (Figure 4E). These results suggest that NEDD4 overexpression can alleviate brain injury and neurological dysfunction through CTSB degradation after SAH.
Figure 4.

Overexpression of NEDD4 alleviates brain injury after SAH in mice. Mice were divided into four groups (n = 6 per group): Sham, SAH, SAH + LV‐NC, SAH + LV‐NEDD4. (A–B) The mRNA and protein levels of NEDD4 and CTSB in mouse brain tissues were detected by qRT‐PCR and Western blot. (C) Representative images of TUNEL staining (green) showing neuronal apoptosis in the brain tissues. (D) Left and right brain water content measurement indicates brain edema. (E) Neurological function was assessed. Scale bar = 100 μm. n = 6 mice per group as independent biological replicates. *p < 0.05 or **p < 0.01, versus Sham. ##p < 0.01, versus SAH + LV‐NC.
3.5. NEDD4 Overexpression Prevents Ferroptosis After SAH
To validate the regulatory role of NEDD4 on ferroptosis in vivo, we treated SAH mice with LV‐NEDD4. Western blot analysis showed that NEDD4 overexpression reversed SAH‐induced changes in ferroptosis‐related proteins (increased ALOX15 and ACSL4, decreased GPX4) (Figure 5A). Meanwhile, the increased levels of Fe2+, MDA, and GSSG, as well as the decreased GSH levels after SAH, were all reversed by NEDD4 overexpression (Figure 5B). These findings demonstrate that NEDD4 overexpression can effectively inhibit ferroptosis and associated biochemical abnormalities after SAH.
Figure 5.

Overexpression of NEDD4 inhibits ferroptosis after SAH in mice. Mice were divided into four groups (n = 6 per group): Sham, SAH, SAH + LV‐NC, SAH + LV‐NEDD4. (A) The protein levels of ferroptosis‐related markers (ALOX15, ACSL4, GPX4) in the brain tissues were detected by Western blot. (B) The levels of Fe2+, MDA, GSSG, and GSH in the brain tissues were measured by ELISA. ELISA assays included three technical replicates per sample. n = 6 mice per group as independent biological replicates. *p < 0.05 or **p < 0.01, versus Sham. ##p < 0.01, versus SAH + LV‐NC.
4. Discussion
In recent years, ferroptosis, an iron‐dependent, lipid peroxidation‐driven form of regulated cell death, has been increasingly recognized for its role in secondary injury after SAH [11]. Microglia, as the resident immune cells of the central nervous system, become excessively activated after SAH, and their ferroptosis process releases large amounts of inflammatory mediators and oxidative factors, significantly exacerbating neuroinflammation and neuronal injury [11]. This study focused on microglial ferroptosis, revealing the critical role of CTSB in its occurrence, and further uncovering a novel mechanism whereby E3 ubiquitin ligase NEDD4 alleviates ferroptosis and neurological injury through ubiquitination‐mediated degradation of CTSB.
The proteolytic enzyme CTSB is widely present in eukaryotes and primarily participates in physiological processes such as intracellular protein degradation, apoptosis, and tissue remodeling [5]. In recent years, multiple studies have suggested that CTSB plays an important role in neurological diseases. For instance, in Alzheimer's disease and cerebral ischemia models, CTSB has been reported to participate in inflammatory responses and cell death processes [7, 12]. Particularly in microglia, CTSB activation is closely associated with lysosomal membrane permeabilization and mitochondrial dysfunction, processes that have multiple intersections with ferroptosis occurrence [13]. This study is the first to confirm that CTSB is specifically highly expressed in microglia in SAH models. Furthermore, gain‐ and loss‐of‐function experiments revealed that CTSB knockdown significantly alleviated hemin‐ and RSL3‐induced ferroptosis in BV2 microglia, manifested as increased cell viability, reduced cell death, and reversal of changes in key ferroptosis markers and oxidative indicators. These results fully demonstrate that CTSB is a positive regulator promoting microglial ferroptosis. This finding echoes the results of Jace et al., who found that CTSB deficiency could reduce oxidative stress in Parkinson's disease models [14], suggesting that CTSB may broadly participate in ferroptosis processes in various central nervous system diseases through regulation of redox balance.
To explore the upstream regulatory mechanisms of CTSB, we predicted through bioinformatics databases and experimentally validated that NEDD4 is an E3 ubiquitin ligase targeting CTSB. NEDD4 belongs to the HECT‐type E3 ubiquitin ligase family and has been reported to participate in various biological processes including autophagy, apoptosis, and inflammation [15]. For example, in traumatic brain injury models, NEDD4 exerts neuroprotective effects through PTEN degradation, while in cancer research, NEDD4 can also regulate the stability of multiple substrate proteins [16, 17]. This study found that NEDD4 interacts with CTSB, and this interaction is weakened under hemin stimulation; NEDD4 overexpression can downregulate CTSB protein levels without affecting its transcription, indicating that NEDD4 promotes ubiquitination‐mediated degradation of CTSB at the post‐translational level. This finding is highly innovative, as current research on CTSB stability regulation is very limited. Meanwhile, this study is the first to propose the NEDD4‐CTSB regulatory axis, enriching the functional spectrum of NEDD4 in central nervous system diseases.
Furthermore, in vivo validation experiments, NEDD4 overexpression not only significantly reduced CTSB protein levels in SAH mouse brains but also effectively alleviated brain edema, cell apoptosis, and neurological deficits after SAH, indicating that NEDD4 has neuroprotective effects. Most importantly, NEDD4 overexpression significantly reversed SAH‐induced changes in ferroptosis‐related proteins and oxidative marker abnormalities. These results not only confirm that NEDD4 can inhibit ferroptosis through CTSB degradation at the animal level but also suggest its therapeutic potential. Previous studies have largely focused on the protective effects of ferroptosis inhibitors (such as Ferrostatin‐1) in SAH [18], while this study proposes that enhancing endogenous protein degradation mechanisms (NEDD4‐mediated ubiquitination) may be a novel and more specific therapeutic strategy.
Despite these achievements, this study still has some limitations. First, the specific downstream mechanisms by which CTSB regulate ferroptosis have not been fully elucidated. Second, whether NEDD4 also regulates other ferroptosis‐related proteins (such as GPX4 or ACSL4) remains to be clarified. Finally, current experiments are mostly based on mouse models and BV2 cell lines, and whether the conclusions are applicable to human SAH requires validation with more clinical samples.
5. Conclusion
In conclusion, this study systematically revealed the critical role of CTSB in microglial ferroptosis after SAH and discovered that NEDD4, as its upstream E3 ubiquitin ligase, regulates CTSB protein stability through the ubiquitin‐proteasome pathway. These results not only deepen our understanding of the mechanisms underlying ferroptosis occurrence after SAH but also provide important experimental evidence for developing intervention strategies targeting the NEDD4‐CTSB axis. Future research may further explore the specific downstream signaling molecules of CTSB and develop small molecule compounds that specifically activate NEDD4 or inhibit CTSB, providing new insights for the clinical treatment of SAH.
Author Contributions
Xiuyou Yan and Lu Feng designed the experiments, Xiuyou Yan, Lu Feng, Xuanhao Zhu, Panxing Wu, Wei Chen carried them out. Xiuyou Yan, Lu Feng, Xuanhao Zhu, Panxing Wu, Wei Chen, Hao Yan analyzed and interpreted the data, Xiuyou Yan, Lu Feng and Chao Ding prepared the manuscript. All authors have read and approved the manuscript.
Ethics Statement
This study protocol was reviewed and approved by Institutional Animal Care and Use Committee, ZJCLA, approval number [ZJCLAACUC‐25010033].
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Figure S1: NEDD4 promotes CTSB ubiquitination and degradation in BV2 microglial cells. (A) Co‐IP assay of CTSB ubiquitination. BV2 cells were co‐transfected with Flag‐CTSB, HA‐ubiquitin, and Myc‐NEDD4 or vector, treated with MG132, and immunoprecipitated with anti‐Flag followed by immunoblotting with anti‐HA. IgG served as negative control. (B) CHX chase assay. BV2 cells overexpressing NEDD4 or vector were treated with CHX (50 μg/mL) for 0, 2, 4, 8 h, and CTSB protein levels were detected by Western blot. (C) BV2 cells overexpressing NEDD4 were treated with MG132 (10 μM, 6 h) or NH4Cl (10 mM, 6 h), and CTSB protein levels were detected by Western blot. All in vitro experiments were independently repeated at least three times (n = 3). **p < 0.01 versus Vector.
Acknowledgments
The authors have nothing to report.
Yan X., Feng L., Zhu X., et al., “E3 Ubiquitin Ligase NEDD4‐Mediated CTSB Ubiquitination Prevents Microglial Ferroptosis After Subarachnoid Hemorrhage,” Journal of Biochemical and Molecular Toxicology 40 (2026): e71084, 10.1002/jbt.71084.
Xiuyou Yan and Lu Feng contributed equally to the work and should be considered co‐first authors.
Data Availability Statement
The authors declare that all data supporting the findings of this study are available within the paper and any raw data can be obtained from the corresponding author upon request.
References
- 1. Claassen J. and Park S., “Spontaneous Subarachnoid Haemorrhage,” Lancet 400 (2022): 846–862, 10.1016/s0140-6736(22)00938-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Deng X., Wu Y., Hu Z., et al., “The Mechanism of Ferroptosis in Early Brain Injury After Subarachnoid Hemorrhage,” Frontiers in Immunology 14 (2023): 1191826, 10.3389/fimmu.2023.1191826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Ning W., Lv S., Wang Q., and Xu Y., “The Pivotal Role of Microglia in Injury and the Prognosis of Subarachnoid Hemorrhage,” Neural Regeneration Research 20 (2025): 1829–1848, 10.4103/nrr.Nrr-d-24-00241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Sharma A., Swetha R., Bajad N. G., et al., “Cathepsin B‐A Neuronal Death Mediator in Alzheimer's Disease Leading to Neurodegeneration,” Mini Reviews in Medicinal Chemistry 22 (2022): 2012–2023, 10.2174/1389557522666220214095859. [DOI] [PubMed] [Google Scholar]
- 5. Xie Z., Zhao M., Yan C., et al., “Cathepsin B in Programmed Cell Death Machinery: Mechanisms of Execution and Regulatory Pathways,” Cell Death & Disease 14 (2023): 255, 10.1038/s41419-023-05786-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Zhou Y., Dong W., Wang L., Ren S., Wei W., and Wu G., “Cystatin C Attenuates Perihematomal Secondary Brain Injury by Inhibiting the Cathepsin B/NLRP3 Signaling Pathway in a Rat Model of Intracerebral Hemorrhage,” Molecular Neurobiology 61 (2024): 9646–9662, 10.1007/s12035-024-04195-4. [DOI] [PubMed] [Google Scholar]
- 7. Gaire B. P., Subedi L., Teramoto H., and Hu B., “The Role of Cathepsin B in Ischemia‐Reperfusion Injury After Stroke,” in Cerebral Ischemia, ed. Pluta R.. (Exon Publications, 2021). [PubMed] [Google Scholar]
- 8. Huang X., Chen J., Cao W., et al., “The Many Substrates and Functions of NEDD4‐1,” Cell Death & Disease 10 (2019): 904, 10.1038/s41419-019-2142-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Haouari S., Vourc'h P., Jeanne M., et al., “The Roles of NEDD4 Subfamily of HECT E3 Ubiquitin Ligases in Neurodevelopment and Neurodegeneration,” International Journal of Molecular Sciences 23, no. 7 (2022): 3882, 10.3390/ijms23073882. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Dai C., Wu B., Chen Y., et al., “Aagab Acts as a Novel Regulator of NEDD4‐1‐Mediated Pten Nuclear Translocation to Promote Neurological Recovery Following Hypoxic‐Ischemic Brain Damage,” Cell Death and Differentiation 28 (2021): 2367–2384, 10.1038/s41418-021-00757-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Dabbagh Ohadi M. A., Maroufi S. F., Mohammadi M. R., Hosseini Siyanaki M. R., Khorasanizadeh M., and Kellner C. P., “Ferroptosis as a Therapeutic Target in Subarachnoid Hemorrhage,” World Neurosurgery 182 (2024): 52–57, 10.1016/j.wneu.2023.11.049. [DOI] [PubMed] [Google Scholar]
- 12. Hook V., Yoon M., Mosier C., et al., “Cathepsin B in Neurodegeneration of Alzheimer's Disease, Traumatic Brain Injury, and Related Brain Disorders,” Biochim Biophys Acta Proteins Proteom 1868 (2020): 140428, 10.1016/j.bbapap.2020.140428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Gao Z., Luo K., Hu Y., et al., “Melatonin Alleviates Chronic Stress‐Induced Hippocampal Microglia Pyroptosis and Subsequent Depression‐Like Behaviors by Inhibiting Cathepsin B/NLRP3 Signaling Pathway in Rats,” Translational Psychiatry 14 (2024): 166, 10.1038/s41398-024-02887-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Jones‐Tabah J., He K., Karpilovsky N., et al., “The Parkinson's Disease Risk Gene Cathepsin B Promotes Fibrillar Alpha‐Synuclein Clearance, Lysosomal Function and Glucocerebrosidase Activity in Dopaminergic Neurons,” Molecular Neurodegeneration 19 (2024): 88, 10.1186/s13024-024-00779-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Sicari D., Weber J., Maspero E., and Polo S., “The NEDD4 Ubiquitin E3 Ligase: A Snapshot View of Its Functional Activity and Regulation,” Biochemical Society Transactions 50 (2022): 473–485, 10.1042/bst20210731. [DOI] [PubMed] [Google Scholar]
- 16. Christie K. J., Martinez J. A., and Zochodne D. W., “Disruption of E3 Ligase NEDD4 in Peripheral Neurons Interrupts Axon Outgrowth: Linkage to PTEN,” Molecular and Cellular Neuroscience 50 (2012): 179–192, 10.1016/j.mcn.2012.04.006. [DOI] [PubMed] [Google Scholar]
- 17. Tian X., Chen Y., Peng Z., Lin Q., and Sun A., “NEDD4 E3 Ubiquitin Ligases: Promising Biomarkers and Therapeutic Targets for Cancer,” Biochemical Pharmacology 214 (2023): 115641, 10.1016/j.bcp.2023.115641. [DOI] [PubMed] [Google Scholar]
- 18. Wang H., Zhou Y., Zhao M., Yu L., Lin Y., and Kang D., “Ferrostatin‐1 Attenuates Brain Injury in Animal Model of Subarachnoid Hemorrhage via Phospholipase A2 Activity of PRDX6,” Neuroreport 34 (2023): 606–616, 10.1097/wnr.0000000000001931. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1: NEDD4 promotes CTSB ubiquitination and degradation in BV2 microglial cells. (A) Co‐IP assay of CTSB ubiquitination. BV2 cells were co‐transfected with Flag‐CTSB, HA‐ubiquitin, and Myc‐NEDD4 or vector, treated with MG132, and immunoprecipitated with anti‐Flag followed by immunoblotting with anti‐HA. IgG served as negative control. (B) CHX chase assay. BV2 cells overexpressing NEDD4 or vector were treated with CHX (50 μg/mL) for 0, 2, 4, 8 h, and CTSB protein levels were detected by Western blot. (C) BV2 cells overexpressing NEDD4 were treated with MG132 (10 μM, 6 h) or NH4Cl (10 mM, 6 h), and CTSB protein levels were detected by Western blot. All in vitro experiments were independently repeated at least three times (n = 3). **p < 0.01 versus Vector.
Data Availability Statement
The authors declare that all data supporting the findings of this study are available within the paper and any raw data can be obtained from the corresponding author upon request.
