Skip to main content
The Journal of Physiological Sciences : JPS logoLink to The Journal of Physiological Sciences : JPS
. 2026 Sep 14;76(3):100101. doi: 10.1016/j.jphyss.2026.100101

Potential roles of β3-adrenergic receptor in heart rate regulation via sinus node activity and local adipocyte metabolism

Yukihiro Harada a,1, Chih Chi Kao a,b,1, Tomoe Ueyama c,1, Alphonse Boché d, Morshedul Alam Azad Khandaker d,e, Shu Nakao a,c,d,e,⁎,2, Teruhisa Kawamura a,f,⁎
PMCID: PMC13613536  PMID: 42759187

Abstract

β-Adrenergic signalling plays a central role in the regulation of diverse physiological processes, including cardiovascular function. In the heart, β1-adrenergic receptors (β1-ARs) mediate most sympathetic effects on contractility and heart rate, whereas the role of β3-ARs remains poorly understood. Here we investigated the expression and functional significance of β3-ARs in the sinus node (SN), the primary cardiac pacemaker. β3-AR expression showed a clear regional gradient, being highest in adipose tissue associated with the SN, modest in the SN itself, and minimal in atrial and ventricular myocardium. Single-nucleus RNA sequencing further demonstrated enriched β3-AR transcripts in adipocytes within the SN region and modest expression in SN and atrial myocytes. Pharmacological modulation of β3-AR activity influenced heart rate and altered spontaneous firing in isolated right atrial preparations containing the SN. These findings suggest that β3-AR signalling may influence pacemaker activity both directly within the SN and indirectly through local adipose tissue metabolism.

Keywords: β-adrenergic receptors, Heart rate, Cardiac conduction system, Autonomic regulation, Metabolism

Graphical abstract

graphic file with name ga1.webp

Highlights

  • •

    β3-adrenergic receptors (ARs) are enriched in the sinus node compared to other cardiac regions.

  • •

    β3-AR stimulation enhances generation and propagation of cardiac impulses.

  • •

    β3-ARs are expressed in adipocytes and pacemaker cells within the sinus node region.

  • •

    Adipose tissue localised in the sinus node region may contribute to heart rate regulation.

Introduction

β-adrenergic signalling regulates diverse physiological processes across multiple organ systems. β-adrenergic receptors (β-ARs) comprise three distinct isoforms: β1-, β2-, and β3-ARs. In the heart, β1-AR is the major isoform and couples to Gαs proteins, mediating downstream signalling in response to sympathetic activation and producing positive inotropic and chronotropic effects. In contrast, β2-AR is expressed at low levels under physiological conditions but is upregulated in the failing heart, where it exerts cardioprotective effects through activation of Gαi-dependent signalling pathways [1]. However, the role of β3-AR in cardiac physiology remains incompletely understood.

β3-AR is well known as the predominant β-AR subtype in adipose tissue and primarily activates Gαs-mediated signalling. In adipocytes, β3-AR stimulation promotes lipolysis in white adipose tissue and non-shivering thermogenesis in brown adipose tissue [2]. Several studies have demonstrated that β3-AR is also expressed in the heart, although at very low levels. In the failing heart, β3-AR expression is increased and has been reported to protect cardiomyocytes from apoptosis and dysfunction via nitric oxide synthase (NOS) activation, leading to vasodilation [3], as well as through the reduction of oxidative stress and hypertrophic signaling [4]. More recently, in vivo studies have suggested that mirabegron, a selective β3-AR agonist, may suppress catecholamine-induced ventricular arrhythmias [5]. In a pharmacological study using human atrial myocardium, mirabegron modestly stimulated contractility via β1-AR activation, an effect that was further enhanced in the presence of a phosphodiesterase inhibitor [6].

In the sinus node, the primary cardiac pacemaker, β1-ARs increase heart rate through multiple pathways involving activation of protein kinase A (PKA). PKA signalling enhances the activity of several pacemaking proteins, including hyperpolarisation-activated cyclic nucleotide-gated (HCN) pacemaker channels, voltage-gated Ca2 + channels, sarcoplasmic reticulum Ca2+ pumps, and ryanodine receptors, resulting in a shortened action potential duration [7], [8], [9]. Although one study reported that overexpression of human β3-AR in mice increased heart rate [10], the role of β3-AR signalling in heart rate regulation remains poorly understood. Therefore, the present study aimed to determine whether β3-AR signalling contributes to the regulation of sinus node pacemaking and heart rate. We found that, unlike atrial and ventricular myocardium, the sinus node exhibited unexpectedly high mRNA levels of β3-AR. In addition, single-nucleus RNA sequencing revealed the presence of adipocyte populations within the sinus node region, suggesting a potential local metabolic environment surrounding pacemaker cells. Pharmacological activation of β3-AR enhanced spontaneous firing of sinus node pacemaker cells and increased heart rate. These findings identify β3-AR signalling as a regulator of sinus node function and suggest that β3-AR signalling may link local metabolic regulation with pacemaker activity.

Methods

Animals

All experiments were performed in accordance with institutional guidelines. All animal experimental procedures in this study were approved by the Animal Care Committee at Ritsumeikan University BKC and Tokai University (approved #250060). Male C57BL/6 mice (10–12 weeks old) were housed in a temperature- (22–24 °C) and humidity-controlled environment under a 12 h/12 h light–dark cycle. Mice were acclimatised at least one week before use.

To collect heart samples, mice were humanely euthanised by cervical dislocation. Immediately after euthanasia, the heart was removed from the thoracic cavity, and a right atrial preparation containing the intact sinus node region was dissected in warm, oxygenated Tyrode’s solution containing (mM): 100 NaCl, 4 KCl, 1.2 MgSO4, 1.2 KH2PO4, 1.8 CaCl2, 25 NaHCO3 and 10 glucose [11]. The solution was bubbled with 95% O2 and 5% CO2 to maintain the pH at 7.4.

mRNA expression analysis

Total RNA was isolated from the sinus node, right atrial appendage, and ventricular apex of mouse hearts using TriPure Isolation Reagent (Merck, 11667165001) according to the manufacturer’s instructions. Following further purification, total RNA was subjected to reverse transcription using ReverTra Ace (Toyobo, TRT-101) to generate complementary DNA. Quantitative PCR was performed using SYBR Green polymerase (TB Green Premix Ex Taq II, Takara Bio, RR820S) on a StepOne Real-Time PCR System (Applied Biosystems). 18S rRNA was used as an endogenous control for normalisation. Primers used in this study were as follows (5’ –3’): Hcn4: forward, GGCGGACACCGCTATCAAA; reverse, TGCCGAACATCCTTAGGGAGA. Adrb1: forward, CTCATCGTGGTGGGTAACGTG; reverse, ACACACAGCACATCTACCGAA. Adrb2: forward, GGGAACGACAGCGACTTCTT; reverse, GCCAGGACGATAACCGACAT. Adrb3: forward, GGCCCTCTCTAGTTCCCAG; reverse, TAGCCATCAAACCTGTTGAGC. 18 s: forward, CTTAGAGGGACAAGTGGCG; reverse, ACGCTGAGCCAGTCAGTGTA.

Electrocardiogram recording

Mice anaesthetised with isoflurane (2–2.5% for induction and ∼1.5% for maintenance) were subjected to electrocardiogram (ECG) recording. Animals were placed in dorsal recumbency on a heater pad to maintain body temperature. ECG signals were recorded using a PowerLab 26 T system with LabChart8 software (ADInstruments) at a sampling rate of 2 kHz. Twenty-two-gauge needle electrodes were inserted subcutaneously into the right axillary and left lateral thigh regions to record limb lead II. Once heart rate had reached a steady state, ECG signals were recorded for 5–10 min to determine basal heart rate, followed by intraperitoneal injection of propranolol hydrochloride (2 mg/kg, INDERAL Injection, TAIYO Pharma Co. Ltd.). ECG recording was continued for additional 15 min. The decreased heart rate under propranolol was considered to reflect β1- and β2-AR blockade due to its high selectivity for β1- and β2-ARs. Mice then administered 1 mg/kg BRL 37344, a selective β3-AR agonist (Sigma-Aldrich B169–5MG) [12], [13], under inhibition of the basal autonomic tone and minimising of off-target effect of the agonist. After BRL 37344 administration, heart rate was monitored for a further 20 min. RR and PR intervals were analysed from the ECG recordings in which P waves could be clearly identified; recordings with excessive baseline noise were excluded from PR interval analysis. Heart rate was calculated from 50 to 100 consecutive RR intervals. β3-dependemt heart rate was defined as the difference between heart rate under propranolol alone and heart rate following combined propranolol and BRL 37344 treatment.

Ex vivo tissue electrophysiology

The spontaneous beating rate originating from sinus node activity was determined by extracellular recording as described previously [14]. In brief, the right atrial preparation encompassing the sinus node was rapidly dissected from a euthanised mouse and superfused with warm (34–35 °C), oxygenated Tyrode’s solution. Preparations were allowed to stabilise in the perfusion chamber for 20–30 min before baseline recordings were obtained. Extracellular potentials were recorded using a PowerLab 26 T system with LabChart8 software (ADInstruments) via needle electrodes positioned near the superior end of the crista terminalis and the coronary sinus. The spontaneous beating rate was calculated from continuous recordings over 30–60 s. To evaluate the effect of the selective β3-AR agonist BRL 37344, the superfused solution was replaced with Tyrode’s solution containing 10 μM BRL 37344. This concentration was selected based on an ex vivo concentration-response assessment demonstrating a robust and reproducible positive chronotropic effect with relatively low variability compared with other tested concentrations (Fig. S1). Recordings were continued for 10 min, after which the preparation was superfused with Tyrode’s solution containing 10 μM BRL 37344 and 10 μM isoproterenol, a non-selective β-AR agonist (Proternol-L injection; Kowa Co Ltd.), for a further 10 min. Drug effects were quantified from recordings obtained between 6 and 10 min after each solution change. For experiments involving pharmacological pretreatment, preparations were superfused in Tyrode’s solution containing the indicated reagent, including propranolol, dorsomorphin and AICAR, for 15 min following the stabilisation period. BRL 37344 was then added to the superfused solution while maintaining the pretreatment reagent, and recordings were continued for an additional 10 min.

Histology and immunofluorescence labelling

Right atrial tissue encompassing the sinus node region was quickly dissected from mouse hearts as described above, embedded in optimal cutting temperature compound, and snap-frozen in cold isopentane cooled with liquid nitrogen. Frozen tissue blocks were cut into 20 μm sections. Tissue pieces of the atrioventricular junction of the interatrial/ventricular septum and the right atrial and ventricular myocardium were also dissected and processed for sections of the atrioventricular conduction system including the compact node (atrioventricular node), the bundle of His, and bundle branches. Sections were fixed in 10% phosphate-buffered formalin and subsequently permeabilised with 0.1% triton-X100 in PBS for 30 min, followed by blocking in 1% bovine serum albumin in PBS for 60 min. The sections were then incubated at 4 °C overnight with either anti-mouse HCN4 antibody (Alomone Lab, APC-052, 1:100 dilution) or β3-AR antibody (Alomone Lab, AAR-017, 1:50 dilution). Sections were subsequently labelled with Alexa Fluor 488-conjugated or Alexa Fluor 594-conjugated anti-rabbit IgG secondary antibody at room temperature for 45 min. For autofluorescence correction, control sections were incubated in blocking solution instead of primary antibody solution. Images were acquired using a Leica TCS SP5 inverted confocal laser-scanning microscope equipped with a 63x/1.40 HCX PL Apo objective and LAS-AF software (Leica Microsystems).

For lipid labelling, Oil Red O staining was performed on formalin-fixed frozen sections. After immersion in 60% isopropanol, sections were stained with 0.5% Oil Red O for 30 min at 37 °C. Following differentiation in 60% isopropanol, sections were counterstained with Mayer’s haematoxylin. Stained sections were imaged using a BX63 upright microscope and cellSens software (Evident Scientific).

Data processing and downstream analysis for single-nucleus RNA-seq

To analyse the transcriptome at single-cell resolution, we utilized the publicly available dataset GSE130710, comprising 5357 nuclei isolated from sinus node regions in 16 mice [15]. Pre-normalised gene expression matrices and associated metadata were processed using R (v4.5.2) and the Seurat (v5.4.0) [16]. To ensure data quality and minimise potential doublets, only cells annotated as "singlets" in the original metadata were retained for analysis. Highly variable features (n = 2000) were identified using the "mvp" method implemented in FindVariableFeatures. Data were scaled using ScaleData, with total unique molecular identifier counts (nCount_RNA) and the proportions of mitochondrial (percent.mito) and ribosomal (percent.ribo) transcripts regressed out to regress technical variation. Principal component analysis (PCA) was performed on the selected features, and the top 50 principal components were retained. To account for inter-sample variability, data integration was performed using a reciprocal PCA (RPCA) approach via IntegrateLayers in Seurat 5. The integrated RPCA space was used to construct a shared nearest-neighbour graph (FindNeighbors), followed by unsupervised clustering using the Louvain algorithm (FindClusters, resolution of 0.3). Two-dimensional visualization was generated using uniform manifold approximation and projection (UMAP) based on the integrated dimensions. Cell types were annotated based on established marker gene expression, including adipocytes (Plin1, Gpam, Prdm16), pacemaker cells (Hcn4, Tbx3, Shox2) and cardiomyocytes (Myh6, Myh7, Myl4).

Statistics

Sample size (N) was calculated to achieve > 80% statistical power at a 95% confidence level. Statistical analyses were performed in R (version 4.4.2). Biological outliers were identified and excluded using Grubbs’ test implemented in outliers package. Comparisons among multiple groups were performed using one-way ANOVA followed by post hoc testing using rstatix package. Tukey–Kramer’s test was applied to datasets with equal variance, whereas Games–Howell test was used for datasets with unequal variance. Repeated-measures ANOVA was conducted using the afex package to evaluate differences across three time points. When a significant main effect of time was detected, post hoc pairwise comparisons were performed using the emmeans package with Holm adjustment for multiple comparisons. A value of p < 0.05 was considered statistically significant. Representative qualitative data, such as microscopy images, were obtained from at least three independent animals to confirm reproducibility.

Results

The sinus node exhibits the highest β3-AR expression in the heart

To quantify the distribution of β-AR subtypes in the heart, we examined the mRNA expression levels of β1-, β2-, and β3-ARs in the sinus node, adjacent right atrial myocardium, and ventricular myocardium. Sinus node samples were carefully dissected from right atrial preparations using anatomical landmarks as previously described [11]. Compared with atrial and ventricular samples, the sinus node preparations exhibited significantly higher expression of Hcn4, which encodes the pacemaker channel HCN4 and serves as a marker of sinus node cells (2.23E-05 ± 8.88E-06 in sinus node, 7.32E-09 ± 9.65E-09 in atrium, and 3.92E-09 ± 2.19E-09 in ventricle, n = 4, p < 0.05 at sinus node vs atrium or ventricle) (Fig. S2). Quantitative PCR analysis revealed that β1-AR was the predominant subtype in both the sinus node and ventricular myocardium (2.68E-05 ± 6.70E-06 in sinus node, 9.22E-06 ± 2.33E-06 in atrium, and 1.72E-05 ± 8.96E-06 in ventricle, n = 7–8, p < 0.05 in sinus node or ventricle vs atrium). β2-AR expression was low across all cardiac regions examined (5.47E-06 ± 1.57E-06 in sinus node, 1.41E-06 ± 5.98E-07 in atrium, and 1.96E-06 ± 3.56E-07 in ventricle, n = 6–10, p < 0.05 in sinus node vs atrium or ventricle). Whereas β3-AR transcripts were barely detectable in atrial and ventricular tissues, the sinus node showed modest but significantly higher β3-AR expression (4.90E-06 ± 3.65E-06 in sinus node, 1.20E-08 ± 1.45E-08 in atrium, and 1.78E-08 ± 1.73E-08 in ventricle, n = 6–8, p < 0.05 in sinus node vs atrium or ventricle) (Fig. 1).

Fig. 1.

Fig. 1

mRNA expression patterns of β-adrenergic receptor (β-AR) subtypes in mouse cardiac regions. Expression levels of β1-AR (Adrb1), β2-AR (Adrb2), and β3-AR (Adrb3) in the sinus node (SN), atrial myocardium (AM), and ventricular myocardium (VM). n = 6–10. *P < 0.05 vs SN (one-way ANOVA followed by Games–Howell post hoc test).

Selective activation of β3-AR increases heart rate

We next tested whether β3-ARs contribute to heart rate control in the sinus node. A pharmacological assessment using a selective β3-AR agonist was conducted in vivo under presence of propranolol, a β1/β2 blocker, that minimises the autonomic activity and pharmacological off-target effects of the β3-AR agonist. To evaluate the effect of BRL 37344, a selective β3-AR agonist, on heart rate, C57BL/6 N mice were lightly anaesthetised with isoflurane inhalation and subjected to ECG recording (Fig. 2A). After recording the basal heart rate, propranolol was administered intraperitoneally. Propranolol significantly reduced the heart rate (486.8 ± 41.7 bpm at baseline vs 418.2 ± 18.5 bpm after propranolol, n = 10, p < 0.05). Subsequent administration of BRL 37344 resulted in an increase in heart rate (527.6 ± 35.0 bpm, n = 10, p < 0.05 vs propranolol) (Fig. 2B). PR intervals, which reflect impulse conduction from the sinus node to the ventricles, were prolonged following propranolol administration (34.4 ± 3.3 ms at baseline vs 37.3 ± 3.0 ms after propranolol, n = 9, p < 0.05 vs baseline) and were recovered to the basal level after BRL 37344 treatment (34.4 ± 1.6 ms, n = 9, p < 0.05 vs propranolol) (Fig. 2C). These results indicate that selective β3-AR activation positively regulates spontaneous firing and AV conduction.

Fig. 2.

Fig. 2

Effect of a selective β3-AR agonist on heart rate. A. Representative electrocardiogram recordings before and after administration of propranolol, a β1- and β2-AR antagonist, and BRL 37344, a selective β3-AR agonist, in anaesthetised mice. B. Mean heart rate before and after the administrations. C. Mean PR intervals before and after the administrations. n = 9–10. *P < 0.05 vs. baseline, †p < 0.05 vs. propranolol (repeated-measures ANOVA with Holm-adjusted post hoc comparisons).

Selective stimulation of β3-ARs increases sinus node firing rate

We next investigated the effect of a selective β3-AR agonist on the spontaneous firing rate of the sinus node in a denervated condition to eliminate autonomic activity. Right atrial preparations encompassing the sinus node region were rapidly dissected and used to record spontaneous firing activity originating from the sinus node. The tissue was superfused with oxygenated Tyrode’s solution at 34–35 °C (Fig. 3A). The beating rate stabilised after approximately 20 min. The basal spontaneous firing rate was 200.4 ± 29.1 counts per minute (cpm), which was lower than the physiological heart rate because the preparation was maintained at a temperature below body temperature and lacked autonomic and circulating chronotropic factors. Application of BRL 37344, a selective β3-AR agonist, increased the spontaneous firing rate to 247.9 ± 28.7 cpm (n = 7, p < 0.05 vs baseline). Subsequent treatment with isoproterenol, a non-selective β-AR agonist, further elevated the firing rate to 411.4 ± 41.2 cpm (n = 7, p < 0.05 vs baseline or BRL 37344) (Figs. 3B and 3C). We also tested the effect of β3 stimulation under a presence of propranolol to minimise off-target effects of BRL 37344. Ex vivo tissue electrophysiological recoding revealed that BRL 37344 increased the sinus node rate (230.2 ± 40.8 cpm at baseline, 211.6 ± 21.0 cpm after propranolol, and 245.1 ± 38.4 cpm after BRL 37344, n = 6), consistent with the in vivo findings. The firing rate following BRL 37344 administration was significantly higher than those in baseline and following propranolol treatment (p < 0.05; Fig. S3). These results demonstrate that activation of β3-ARs enhances sinus node firing activity.

Fig. 3.

Fig. 3

Effect of BRL 37344, a selective β3-AR agonist, on heart rate. A. Representative photographs of the right atrial preparation used for extracellular potential recording. B. Representative traces of extracellular potential recordings in baseline, selective β3- and non-selective β-adrenergic stimulation conditions. C. Mean sinus node rate before and after administration of BRL 37344, a selective β-3AR agonist, and subsequent isoproterenol, a non-selective β-AR agonist. n = 7, *P < 0.05 vs. baseline and † P < 0.05 vs. BRL 37344 (repeated-measures ANOVA with Holm-adjusted post hoc comparisons).

Distribution of β3-ARs in the sinus node region

To further investigate the localisation of β3-ARs in the sinus node region, we performed immunofluorescence imaging in serial sections of the mouse right atrium encompassing the sinus node region. The sinus node region was identified as an HCN4-positive area in the tissue sections (Fig. 4A). Adjacent serial sections were labelled with anti-β3-AR antibody to examine the distribution of β3-ARs in the corresponding region. The specificity of the anti-β3-AR antibody used in this study was verified for immunofluorescence imaging using murine interscapular brown adipose tissue and epididymal white adipose tissue, where β3-AR expression is known to be high (Fig. S4). Moderate β3-AR immunofluorescence signals were detected within the sinus node region, whereas stronger signals were observed in neighbouring white adipose tissue (Fig. 4A). In addition, β3-AR fluorescence intensity in atrial myocardium was weaker than that in the sinus node region (Fig. 4B). Lipid deposits were observed in regions adjacent to the sinus node but not in atrial myocardium (Fig. 4C). Furthermore, we examined the distributions of β3-AR and lipid deposition throughout the atrioventricular conduction axis, including the inferior nodal extension, the compact node (atrioventricular node), the bundle of His, and the bundle branches. Modest β3-AR expression and local lipid droplet accumulation were observed in the upper atrioventricular conduction axis, including the inferior nodal extension and the compact note, whereas neither β3-AR expression nor lipid droplet accumulation was detected in the lower conduction axis (Fig. S5). These histological findings are consistent with the functional effects of β3-AR modulation on spontaneous firing and atrioventricular conduction observed in the electrophysiological experiments.

Fig. 4.

Fig. 4

Representative micrographs showing β3-AR distribution in the sinus node region and neighbouring atrial myocardium. (A) β3-AR expression is observed in adipocytes surrounding the HCN4-positive sinus node region. (B) No expression of HCN4 or β3-AR is detected in the atrial myocardium, whereas β3-AR is expressed modestly in HCN4-positive pacemaker cells and prominently in adipose tissue. (C) Lipid deposits, indicated by arrowheads, are observed in regions adjacent to the sinus node. The boxed area in the left micrograph is shown at higher magnification. n = 6 biological replicates.

β3-AR expression in specific cell types within the sinus node

Based on the results above, we further examined which cell types expressing β3-AR within the sinus node. We analysed the publicly available single-nucleus RNA-seq dataset GSE130710 generated from the sinus node region in adult mice [15]. Uniform manifold approximation and projection (UMAP) analysis revealed marked cellular heterogeneity within the sinus node region. Consistent with the collagen-rich structure of the sinus node, a large fibroblast cluster was observed together with clusters of pacemaker cells and adjacent atrial myocytes (Fig. 5 A). A substantial population of adipocytes was also identified within the sinus node region. In addition, cell clusters corresponding to endothelium and epicardium were detected, along with smaller clusters of neurons, pericytes, and macrophages. To examine β-AR distribution across cell types, we focused on pacemaker cells, atrial myocytes, and adipocytes. Feature plots confirmed the expression of canonical marker genes in each of these cell populations (Fig. 5B and Fig. S6A). Analysis of β-AR subtype expression showed moderate levels of β1-AR transcripts and minimal β2-AR expression in pacemaker cells, atrial myocytes, and adipocytes. In contrast, β3-AR transcripts were broadly expressed in adipocytes and were detected at low levels in pacemaker and atrial myocytes (Fig. 5 C and Fig. S6B). In addition, whereas the adipocyte cluster were enriched with white adipocyte marker genes, a subset of cells expressed marker genes associated with brown adipocytes. These results suggest that β3-AR signalling in the sinus node region may involve both pacemaker cells and neighbouring adipocytes.

Fig. 5.

Fig. 5

β-AR expression across cell types in the murine sinus node revealed by single-nucleus RNA sequencing. (A) Two-dimensional UMAP plot showing cell clusters identified from analysis of the GSE130710 dataset, including 5357 nuclei isolated from sinus node regions of 16 mice. (B) Centred and scaled expression of marker genes defining the indicated cell types. (C) Feature plots showing the distribution of β1-AR (Adrb1), β2-AR (Adrb2), and β3-AR (Adrb3) transcripts across clusters.

Downstream signalling pathways involved in the positive chronotropic effect of β3-AR activation

We next examined underlying downstream mechanisms underlying the positive chronotropic effect of β3-AR activation. As β3-AR signalling has been reported to activate adenosine monophosphate-activated protein kinase (AMPK) in the adipose tissue, thereby promoting lipolysis, we pharmacologically tested the contribution of AMPK signalling to spontaneous firing in the sinus node using right atrial preparations. Dorsomorphin, an AMPK antagonist, decreased the sinus node rate (255.33 ± 42.8 cpm at baseline vs 208.36 ± 20.4 cpm after dorsomorphin, n = 6, p < 0.05). Under AMPK inhibition, subsequent β3-AR activation by BRL 37344 markedly increased the rate (361.6 ± 71.3 cpm, n = 6, p < 0.05 vs baseline and dorsomorphin; Fig. S7A). We further tested the effect of AICAR, an AMPK agonist, on sinus node automaticity. AICAR also decreased the sinus node rate (218.2 ± 17.6 cpm at baseline vs 159.4 ± 31.1 cpm after AICAR, n = 4, p < 0.05) consistent with a previous report showing that AMPK activation suppresses pacemaker current through HCN channel phosphorylation [17]. Despite AMPK activation, subsequent administration of BRL 37344 restored the sinus node rate to approximately the basal level (223.8 ± 42.8 cpm, n = 4, p < 0.05 vs AICAR; Fig. S7B). These findings suggest that pharmacological activation or inhibition of AMPK modulate basal spontaneous firing of the sinus node, whereas neither intervention prevented the positive chronotropic response to β3-AR stimulation.

Discussion

β-AR signalling for heart rate regulation

The present study revealed that the sinus node exhibits higher mRNA levels of β3-ARs compared with other cardiac regions. Electrophysiological experiments using a selective β3-AR agonist further suggested that β3-ARs contribute to positive regulation of heart rate. At the single-cell resolution, our analysis indicates that β3-AR activation may increase heart rate through enhancement of energy supply from adjacent adipocytes as well as direct modulation of spontaneous firing in sinus node cells.

β-AR signalling is well known to mediate positive chronotropic effects through activation of the Gαs subunit. The Gαs subunit stimulates adenylyl cyclase activity, leading to the generation of cyclic adenosine monophosphate (cAMP) and subsequent activation of PKA. PKA phosphorylates calcium-handling proteins and ion channels, resulting in enhanced intracellular calcium signalling and increased pacemaker channel activity [18], [19]. Although β1-AR is the predominant subtype in the heart, the modestly expressed β3-ARs in the sinus node may also engage this β-AR signalling pathway in pacemaker cells to increase heart rate.

β3-AR for cardiac function and its mechanisms

β3-ARs are well known to mediate sympathetic activation of downstream signalling pathways that enhance lipid metabolism in adipose tissue for energy production and thermogenesis [20], [21]. As key regulators of fat mobilisation for use in other tissues, β3-ARs control lipolysis, thermogenesis, lipogenesis, and glucose metabolism across white, brown, and brite adipocytes. The canonical mechanism involves norepinephrine activation of β3-ARs, which triggers a cAMP-dependent pathway leading to activation of PKA and hormone-sensitive lipase [22], [23]. In brown adipocytes, fatty acids released from lipolysis directly activate uncoupling protein 1-mediated thermogenesis [20], [22]. β1-ARs are also known to contribute, although to a lesser extent, to the regulation of lipolysis and adipocyte differentiation in white, brown, and brite adipose tissues.

In contrast, the role of β3-ARs in cardiac function remains relatively unclear. Studies using β3-AR knockout mice demonstrated that depletion of β3-AR leads to left ventricular diastolic dysfunction, potentially through reduction of cardiac energy metabolism and contractile function [24]. Another study reported that cardiac β3-AR deletion increased myocardial fibrosis and altered paracrine signalling [25]. In an endotoxin-induced heart failure model, β3-AR blockade was reported to improve survival, possibly by suppressing NOS activity and preserving cardiac metabolism [26]. Conversely, several studies have shown that overexpression or pharmacological activation of β3-ARs reduces contractility in healthy hearts [10], [27], [28]. One proposed mechanism is that β3-AR induces coupling to Gi proteins, leading to activation of nitric oxide (NO)- and cyclic guanosine monophosphate (cGMP)-dependent pathways. Activation of Gi inhibits adenylyl cyclase, reducing intracellular cyclic AMP levels, while Gi-dependent signalling has also been reported to activate endothelial NOS signalling in ventricular myocytes and endothelial cells [27]. Through NOS-mediated signalling pathways, β3-AR overexpression or selective agonism appears to exert protective effects against cardiac remodelling and dysfunction under pathological conditions, induced by pressure overload, myocardial infarction, or neurohormonal stimulation, [29], [30], [31]. Nevertheless, a clinical trial investigating therapy with a β3-AR agonist showed only limited improvement in ejection fraction and left ventricular volume in patients with heart failure [32]. Therefore, further studies are required to clarify the protective or detrimental roles of β3-ARs in the heart.

Given the marked functional differences between ventricular myocytes and sinus node cells, the intracellular signalling pathways activated by β3-ARs may not be identical in these cardiac regions. In the present study, pharmacological activation of β3-ARs consistently increased heart rate and sinus node firing, whereas the downstream signalling mechanisms in sinus node cells remain incompletely understood. Therefore, the positive chronotropic effect observed in the present study is not necessarily inconsistent with the previously reported negative inotropic actions of β3-AR activation in ventricular myocardium. Furthermore, to elucidate the mechanisms underlying both direct and indirect β3-AR-dependent regulation of heart rate, future studies using mouse models with sinus node- or adipose tissue-specific deletion of β3-ARs will be needed. Taken together, the present findings suggest that β3-AR signalling exert context-dependent effects within the heart, potentially influencing contractility and heart rate regulation through distinct cellular mechanisms.

Roles of epicardial and intramyocardial adipose tissue

Epicardial adipose tissue is commonly described at a source of inflammation that contributes to arrhythmias such as atrial fibrillation, particularly in obese individuals [33]. In physiological context, however, epicardial adipose tissue provides mechanical cushioning, supplies free fatty acids for myocardial energy metabolism, exhibits brown-fat-like thermogenic properties, and acts as an endocrine organ [34], [35].

Intramyocardial adipocytes are also present in the healthy myocardium and increase gradually with normal aging, but accumulating evidence indicates their pathological significance in cardiovascular disease [36]. For example, fatty infiltration in the ventricular myocardium is a characteristic finding of arrhythmogenic cardiomyopathy [37]. In addition, myocardial triglyceride accumulation in obesity and diabetes may impair left ventricular function through lipotoxicity [38]. However, studies examining adipose tissue within the atrial myocardium remain limited, and the physiological significance of adipocytes located near the sinus node remains unclear. Given the close anatomical proximity between adipose tissue and the sinus node region observed in the present study, these adipocytes may represent a potential local metabolic niche that could influence pacemaker function. Further investigations are required to determine whether adipocyte-derived metabolites contribute to β3-AR-mediated regulation of sinus node automaticity.

ATP-dependent heart rate regulation

We speculated that an indirect mechanism may support pacemaker activity through β3-AR-dependent activation of fatty acid oxidation in adipocytes adjacent to sinus node cells. Several ATP-dependent processes contribute to impulse generation in pacemaker cells. A series of studies in laboratory animals and humans has shown that the coupled-clock system driving automaticity is regulated by Ca²⁺-cAMP-PKA signalling [39]. Basal Ca²⁺-cAMP/PKA signalling consumes ATP to produce spontaneous action potentials in sinus node cells [40]. Furthermore, higher levels of PKA-dependent phosphorylation of phospholamban, L-type Ca²⁺ channels, and ryanodine receptors increase the frequency of spontaneous local Ca²⁺ releases and thus promote regular beating [41]. Increased abundance of sarcoplasmic/endoplasmic reticulum Ca2+ ATPase is also an important component of the pacemaking mechanism [42]. Supplementation of ATP sources from the local adipocytes may upregulate these ATP-dependent proteins involved in Ca2+ regulation that enhances spontaneous firing in the sinus node.

AMPK is another key molecule that acts as a critical ATP-dependent energy sensor regulating cardiac pacemaker activity. AMPK is a serine/threonine kinase activated by an increased AMP/ATP ratio during metabolic stress, thereby compensating for energy depletion [43]. In sinus node cells, AMPK activation under low-energy conditions directly phosphorylates HCN4 channels, reducing the If current and slowing heart rate as an energy-conserving mechanism [44]. Moreover, activation of the γ2 AMPK subunit, an ATP-sensitive regulatory component of AMPK, downregulates pacemaker current and ryanodine receptor-dependent local Ca2+ release, leading to a reduction in heart rate [17]. Consistent with these previous findings, pharmacological activation of AMPK with AICAR reduced spontaneous firing of the sinus node in the present study. However, β3-AR stimulation with BRL 37344 restored the firing rate despite AMPK activation. Likewise, although pharmacological inhibition of AMPK with dorsomorphin modestly reduced basal sinus node firing, it did not attenuate the positive chronotropic response to BRL 37344. Together, these findings suggest that while AMPK contributes to the regulation of basal sinus node automaticity, it is unlikely to represent the principal downstream mediator of the β3-AR-dependent chronotropic response under the present experimental conditions. One possible explanation for the relatively small effect of dorsomorphin is that endogenous AMPK activity was limited under our experimental conditions, in which the preparations were superfused with glucose-containing Tyrode's solution rather than exposed to metabolic stress. Nevertheless, because AICAR and dorsomorphin are not completely selective pharmacological modulators of AMPK, the present findings should be interpreted with caution, and complementary genetic approaches will be required to define the contribution of AMPK signalling to β3-AR-mediated heart rate regulation. In addition, as another ATP-dependent protein for regulation of spontaneous firing, ATP-sensitive potassium (KATP) channels are expressed in cardiac pacemaker cells. These channels open in response to decreased intracellular ATP levels, which in turn inhibit pacemaker automaticity and slowing heart rate during metabolic stress. This mechanism is also considered protective for the sinus node under conditions such as ischemia [45], [46], [47]. Although the specific contributions of AMPK and KATP channels to physiological pacing remain incompletely defined, these studies collectively demonstrate that cardiac pacemaker activity requires substantial energy supply. Therefore, ATP supply from adipocytes located adjacent to sinus node cells may represent an important component supporting cardiac automaticity. Given the enrichment of adipocytes in the sinus node region observed in our analysis, metabolic interactions between adipocytes and pacemaker cells may contribute to local energy homeostasis.

Conclusion

The present study demonstrates that β3-AR stimulation increased heart rate and enhances pacemaker activity in the sinus node. Our findings reveal that β3-AR expression is relatively enriched in the sinus node region and that spontaneous firing activity responds to β3-AR-selective pharmacological activation. These observations suggest that β3-AR signalling may contribute to the metabolic regulation of pacemaker function and raise the possibility that selective β3-AR activation could represent a therapeutic strategy for bradycardia without producing undesirable inotropic effects in the working myocardium. Further studies are required to define the metabolic mechanisms supporting sinus node pacemaking and the physiological significance of β3-AR signalling in cardiac rhythm regulation.

Ethics declaration

This study was conducted in accordance with the following guidelines for animal welfare and/or reporting: Standards relating to the Care and Keeping and Reducing Pain of Laboratory Animals (the Ministry of the Environment Notification No. 88 of 2006); Fundamental Guidelines for Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions (the Ministry of Education, Culture, Sports, Science and Technology Notification No. 71 of 2006); Guidelines for Proper Conduct of Animal Experiments (the Science Council of Japan). This study was approved by the Institutional Animal Care and Use Committee at Tokai University. (Approval No. 250060)

CRediT authorship contribution statement

Yukihiro Harada: Writing – review & editing, Writing – original draft, Visualization, Validation, Methodology, Investigation, Formal analysis, Data curation. Morshedul Alam Azad Khandaker: Formal analysis, Methodology, Writing – review & editing. Teruhisa Kawamura: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Shu Nakao: Writing – original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Alphonse Boché: Visualization, Methodology, Investigation, Formal analysis, Data curation. Tomoe Ueyama: Writing – review & editing, Validation, Project administration, Methodology, Investigation, Formal analysis, Data curation. Chih Chi Kao: Writing – review & editing, Writing – original draft, Visualization, Methodology, Investigation, Formal analysis, Data curation.

Declaration of Competing Interest

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Shu Nakao reports financial support was provided by Japan Society for the Promotion of Science. Teruhisa Kawamura reports financial support was provided by Japan Society for the Promotion of Science. Shu Nakao reports financial support was provided by Takeda Science Foundation, Tokai University School of Medicine Research Aid, Tokai University Research Organization Grant, and MUI Animal Medical Science Foundation. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper

Footnotes

Appendix A

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.jphyss.2026.100101.

Contributor Information

Shu Nakao, Email: nakao.shu.s@tokai.ac.jp.

Teruhisa Kawamura, Email: kawater@fc.ritsumei.ac.jp.

Appendix A. Supplementary material

Supplementary material

mmc1.pdf (1.4MB, pdf)

References

  • 1.Grogan A., Lucero E.Y., Jiang H., Rockman H.A. Pathophysiology and pharmacology of G protein-coupled receptors in the heart. Cardiovasc. Res. 2023;119(5):1117–1129. doi: 10.1093/cvr/cvac171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chechi K., van Marken Lichtenbelt W., Richard D. Brown and beige adipose tissues: phenotype and metabolic potential in mice and men. J. Appl. Physiol. (1985) 2018;124(2):482–496. doi: 10.1152/japplphysiol.00021.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Morimoto A., Hasegawa H., Cheng H.J., Little W.C., Cheng C.P. Endogenous beta3-adrenoreceptor activation contributes to left ventricular and cardiomyocyte dysfunction in heart failure. Am. J. Physiol. Heart Circ. Physiol. 2004;286(6):H2425–H2433. doi: 10.1152/ajpheart.01045.2003. [DOI] [PubMed] [Google Scholar]
  • 4.Watts V.L., Sepulveda F.M., Cingolani O.H., Ho A.S., Niu X., Kim R., Miller K.L., Vandegaer K., Bedja D., Gabrielson K.L., Rameau G., O'Rourke B., Kass D.A., Barouch L.A. Anti-hypertrophic and anti-oxidant effect of beta3-adrenergic stimulation in myocytes requires differential neuronal NOS phosphorylation. J. Mol. Cell. Cardiol. 2013;62:8–17. doi: 10.1016/j.yjmcc.2013.04.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Liu X., Sung Y.L., Zhang L., Guo S., Yang M., Tisdale J.E., Chen Z., Goldhaber J.I., Rubart M., Li X., Chen P.S. Antiarrhythmic effects of mirabegron on ventricular fibrillation in Langendorff-perfused rabbit ventricles. J. Physiol. 2025;603(9):2533–2549. doi: 10.1113/JP286901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Mo W., Michel M.C., Lee X.W., Kaumann A.J., Molenaar P. The beta3 -adrenoceptor agonist mirabegron increases human atrial force through beta1 -adrenoceptors: an indirect mechanism? Br. J. Pharmacol. 2017;174(16):2706–2715. doi: 10.1111/bph.13897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Irisawa H., Brown H.F., Giles W. Cardiac pacemaking in the sinoatrial node. Physiol. Rev. 1993;73(1):197–227. doi: 10.1152/physrev.1993.73.1.197. [DOI] [PubMed] [Google Scholar]
  • 8.Ju Y.K., Allen D.G. How does beta-adrenergic stimulation increase the heart rate? The role of intracellular Ca2+ release in amphibian pacemaker cells. J. Physiol. 1999;516(Pt 3):793–804. doi: 10.1111/j.1469-7793.1999.0793u.x. (Pt 3) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Vinogradova T.M., Zhou Y.Y., Bogdanov K.Y., Yang D., Kuschel M., Cheng H., Xiao R.P. Sinoatrial node pacemaker activity requires Ca2+/calmodulin-dependent protein kinase II activation. Circ. Res. 2000;87(9):760–767. doi: 10.1161/01.res.87.9.760. [DOI] [PubMed] [Google Scholar]
  • 10.Tavernier G., Toumaniantz G., Erfanian M., Heymann M.F., Laurent K., Langin D., Gauthier C. beta3-Adrenergic stimulation produces a decrease of cardiac contractility ex vivo in mice overexpressing the human beta3-adrenergic receptor. Cardiovasc. Res. 2003;59(2):288–296. doi: 10.1016/s0008-6363(03)00359-6. [DOI] [PubMed] [Google Scholar]
  • 11.Kobayashi K., Nakatani M., Harada Y., Suzuki Y., Fukunishi N., Boché A., Ueyama T., Nakao S., Kawamura T. Doxorubicin-induced sinus node dysfunction associated with mitochondria and nuclear impairment in a mouse model. J. Physiol. Sci. 2025;75(3) doi: 10.1016/j.jphyss.2025.100047. [DOI] [Google Scholar]
  • 12.Cernecka H., Sand C., Michel M.C. The odd sibling: features of beta3-adrenoceptor pharmacology. Mol. Pharmacol. 2014;86(5):479–484. doi: 10.1124/mol.114.092817. [DOI] [PubMed] [Google Scholar]
  • 13.Hoffmann C., Leitz M.R., Oberdorf-Maass S., Lohse M.J., Klotz K.N. Comparative pharmacology of human beta-adrenergic receptor subtypes--characterization of stably transfected receptors in CHO cells. Naunyn Schmiede Arch. Pharmacol. 2004;369(2):151–159. doi: 10.1007/s00210-003-0860-y. [DOI] [PubMed] [Google Scholar]
  • 14.D'Souza A., Pearman C.M., Wang Y., Nakao S., Logantha S., Cox C., Bennett H., Zhang Y., Johnsen A.B., Linscheid N., Poulsen P.C., Elliott J., Coulson J., McPhee J., Robertson A., da Costa Martins P.A., Kitmitto A., Wisloff U., Cartwright E.J., Monfredi O., Lundby A., Dobrzynski H., Oceandy D., Morris G.M., Boyett M.R. Targeting miR-423-5p reverses exercise training-induced HCN4 channel remodeling and sinus bradycardia. Circ. Res. 2017;121(9):1058–1068. doi: 10.1161/CIRCRESAHA.117.311607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Linscheid N., Logantha S., Poulsen P.C., Zhang S., Schrolkamp M., Egerod K.L., Thompson J.J., Kitmitto A., Galli G., Humphries M.J., Zhang H., Pers T.H., Olsen J.V., Boyett M., Lundby A. Quantitative proteomics and single-nucleus transcriptomics of the sinus node elucidates the foundation of cardiac pacemaking. Nat. Commun. 2019;10(1):2889. doi: 10.1038/s41467-019-10709-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hao Y., Stuart T., Kowalski M.H., Choudhary S., Hoffman P., Hartman A., Srivastava A., Molla G., Madad S., Fernandez-Granda C., Satija R. Dictionary learning for integrative, multimodal and scalable single-cell analysis. Nat. Biotechnol. 2024;42(2):293–304. doi: 10.1038/s41587-023-01767-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yavari A., Bellahcene M., Bucchi A., Sirenko S., Pinter K., Herring N., Jung J.J., Tarasov K.V., Sharpe E.J., Wolfien M., Czibik G., Steeples V., Ghaffari S., Nguyen C., Stockenhuber A., Clair J.R.S., Rimmbach C., Okamoto Y., Yang D., Wang M., Ziman B.D., Moen J.M., Riordon D.R., Ramirez C., Paina M., Lee J., Zhang J., Ahmet I., Matt M.G., Tarasova Y.S., Baban D., Sahgal N., Lockstone H., Puliyadi R., de Bono J., Siggs O.M., Gomes J., Muskett H., Maguire M.L., Beglov Y., Kelly M., Dos Santos P.P.N., Bright N.J., Woods A., Gehmlich K., Isackson H., Douglas G., Ferguson D.J.P., Schneider J.E., Tinker A., Wolkenhauer O., Channon K.M., Cornall R.J., Sternick E.B., Paterson D.J., Redwood C.S., Carling D., Proenza C., David R., Baruscotti M., DiFrancesco D., Lakatta E.G., Watkins H., Ashrafian H. Mammalian gamma2 AMPK regulates intrinsic heart rate. Nat. Commun. 2017;8(1):1258. doi: 10.1038/s41467-017-01342-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Vinogradova T.M., Lakatta E.G. Regulation of basal and reserve cardiac pacemaker function by interactions of cAMP-mediated PKA-dependent Ca2+ cycling with surface membrane channels. J. Mol. Cell. Cardiol. 2009;47(4):456–474. doi: 10.1016/j.yjmcc.2009.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Liu Y., Chen J., Fontes S.K., Bautista E.N., Cheng Z. Physiological and pathological roles of protein kinase A in the heart. Cardiovasc. Res. 2022;118(2):386–398. doi: 10.1093/cvr/cvab008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Collins S. beta-Adrenergic receptors and adipose tissue metabolism: evolution of an old story. Annu. Rev. Physiol. 2022;84:1–16. doi: 10.1146/annurev-physiol-060721-092939. [DOI] [PubMed] [Google Scholar]
  • 21.Evans B.A., Merlin J., Bengtsson T., Hutchinson D.S. Adrenoceptors in white, brown, and brite adipocytes. Br. J. Pharmacol. 2019;176(14):2416–2432. doi: 10.1111/bph.14631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Braun K., Oeckl J., Westermeier J., Li Y., Klingenspor M. Non-adrenergic control of lipolysis and thermogenesis in adipose tissues. J. Exp. Biol. 2018;221(Pt 1) doi: 10.1242/jeb.165381. [DOI] [PubMed] [Google Scholar]
  • 23.Carmen G.Y., Victor S.M. Signalling mechanisms regulating lipolysis. Cell. Signal. 2006;18(4):401–408. doi: 10.1016/j.cellsig.2005.08.009. [DOI] [PubMed] [Google Scholar]
  • 24.Yang W., Wei X., Su X., Shen Y., Jin W., Fang Y. Depletion of beta3-adrenergic receptor induces left ventricular diastolic dysfunction via potential regulation of energy metabolism and cardiac contraction. Gene. 2019;697:1–10. doi: 10.1016/j.gene.2019.02.038. [DOI] [PubMed] [Google Scholar]
  • 25.Hermida N., Michel L., Esfahani H., Dubois-Deruy E., Hammond J., Bouzin C., Markl A., Colin H., Steenbergen A.V., De Meester C., Beauloye C., Horman S., Yin X., Mayr M., Balligand J.L. Cardiac myocyte beta3-adrenergic receptors prevent myocardial fibrosis by modulating oxidant stress-dependent paracrine signaling. Eur. Heart J. 2018;39(10):888–898. doi: 10.1093/eurheartj/ehx366. [DOI] [PubMed] [Google Scholar]
  • 26.Kawaguchi S., Okada M., Ijiri E., Koga D., Watanabe T., Hayashi K., Kashiwagi Y., Fujita S., Hasebe N. beta3-Adrenergic receptor blockade reduces mortality in endotoxin-induced heart failure by suppressing induced nitric oxide synthase and saving cardiac metabolism. Am. J. Physiol. Heart Circ. Physiol. 2020;318(2):H283–H294. doi: 10.1152/ajpheart.00108.2019. [DOI] [PubMed] [Google Scholar]
  • 27.Gauthier C., Leblais V., Kobzik L., Trochu J.N., Khandoudi N., Bril A., Balligand J.L., Le Marec H. The negative inotropic effect of beta3-adrenoceptor stimulation is mediated by activation of a nitric oxide synthase pathway in human ventricle. J. Clin. Invest. 1998;102(7):1377–1384. doi: 10.1172/JCI2191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Varghese P., Harrison R.W., Lofthouse R.A., Georgakopoulos D., Berkowitz D.E., Hare J.M. beta3-adrenoceptor deficiency blocks nitric oxide-dependent inhibition of myocardial contractility. J. Clin. Invest. 2000;106(5):697–703. doi: 10.1172/JCI9323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Niu X., Zhao L., Li X., Xue Y., Wang B., Lv Z., Chen J., Sun D., Zheng Q. beta3-Adrenoreceptor stimulation protects against myocardial infarction injury via eNOS and nNOS activation. PLoS. One. 2014;9(6) doi: 10.1371/journal.pone.0098713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Niu X., Watts V.L., Cingolani O.H., Sivakumaran V., Leyton-Mange J.S., Ellis C.L., Miller K.L., Vandegaer K., Bedja D., Gabrielson K.L., Paolocci N., Kass D.A., Barouch L.A. Cardioprotective effect of beta-3 adrenergic receptor agonism: role of neuronal nitric oxide synthase. J. Am. Coll. Cardiol. 2012;59(22):1979–1987. doi: 10.1016/j.jacc.2011.12.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Belge C., Hammond J., Dubois-Deruy E., Manoury B., Hamelet J., Beauloye C., Markl A., Pouleur A.C., Bertrand L., Esfahani H., Jnaoui K., Gotz K.R., Nikolaev V.O., Vanderper A., Herijgers P., Lobysheva I., Iaccarino G., Hilfiker-Kleiner D., Tavernier G., Langin D., Dessy C., Balligand J.L. Enhanced expression of beta3-adrenoceptors in cardiac myocytes attenuates neurohormone-induced hypertrophic remodeling through nitric oxide synthase. Circulation. 2014;129(4):451–462. doi: 10.1161/CIRCULATIONAHA.113.004940. [DOI] [PubMed] [Google Scholar]
  • 32.Bundgaard H., Axelsson A., Hartvig Thomsen J., Sorgaard M., Kofoed K.F., Hasselbalch R., Fry N.A., Valeur N., Boesgaard S., Gustafsson F., Kober L., Iversen K., Rasmussen H.H. The first-in-man randomized trial of a beta3 adrenoceptor agonist in chronic heart failure: the BEAT-HF trial. Eur. J. Heart Fail. 2017;19(4):566–575. doi: 10.1002/ejhf.714. [DOI] [PubMed] [Google Scholar]
  • 33.Hatem S.N., Sanders P. Epicardial adipose tissue and atrial fibrillation. Cardiovasc. Res. 2014;102(2):205–213. doi: 10.1093/cvr/cvu045. [DOI] [PubMed] [Google Scholar]
  • 34.La V., Nair V., Sunny S., Benharash P., Thankam F.G. Epicardial adipocytes in cardiac pathology and healing. Cardiovasc. Drugs Ther. 2025;39(6):1507–1519. doi: 10.1007/s10557-024-07637-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Li C., Liu X., Adhikari B.K., Chen L., Liu W., Wang Y., Zhang H. The role of epicardial adipose tissue dysfunction in cardiovascular diseases: an overview of pathophysiology, evaluation, and management. Front. Endocrinol. (Lausanne) 2023;14 doi: 10.3389/fendo.2023.1167952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Selthofer-Relatic K., Bosnjak I. Myocardial fat as a part of cardiac visceral adipose tissue: physiological and pathophysiological view. J. Endocrinol. Invest. 2015;38(9):933–939. doi: 10.1007/s40618-015-0258-y. [DOI] [PubMed] [Google Scholar]
  • 37.Nakao S., Hirakawa A., Yamamoto S., Kobayashi M., Machida N. Pathological features of arrhythmogenic right ventricular cardiomyopathy in middle-aged dogs. J. Vet. Med. Sci. 2011;73(8):1031–1036. doi: 10.1292/jvms.11-0080. [DOI] [PubMed] [Google Scholar]
  • 38.Iozzo P. Myocardial, perivascular, and epicardial fat. Diabetes Care. 2011;34(2):S371–S379. doi: 10.2337/dc11-s250. (Suppl 2) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tsutsui K., Monfredi O.J., Sirenko-Tagirova S.G., Maltseva L.A., Bychkov R., Kim M.S., Ziman B.D., Tarasov K.V., Tarasova Y.S., Zhang J., Wang M., Maltsev A.V., Brennan J.A., Efimov I.R., Stern M.D., Maltsev V.A., Lakatta E.G. A coupled-clock system drives the automaticity of human sinoatrial nodal pacemaker cells. Sci. Signal. 2018;11(534) doi: 10.1126/scisignal.aap7608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yaniv Y., Juhaszova M., Lyashkov A.E., Spurgeon H.A., Sollott S.J., Lakatta E.G. Ca2+-regulated-cAMP/PKA signaling in cardiac pacemaker cells links ATP supply to demand. J. Mol. Cell. Cardiol. 2011;51(5):740–748. doi: 10.1016/j.yjmcc.2011.07.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Vinogradova T.M., Lyashkov A.E., Zhu W., Ruknudin A.M., Sirenko S., Yang D., Deo S., Barlow M., Johnson S., Caffrey J.L., Zhou Y.-Y., Xiao R.-P., Cheng H., Stern M.D., Maltsev V.A., Lakatta E.G. High basal protein kinase A–dependent phosphorylation drives rhythmic Internal Ca2+ store oscillations and spontaneous beating of cardiac pacemaker cells. Circ. Res. 2006;98(4):505–514. doi: 10.1161/01.RES.0000204575.94040.d1. [DOI] [PubMed] [Google Scholar]
  • 42.Sirenko S., Yang D., Li Y., Lyashkov A.E., Lukyanenko Y.O., Lakatta E.G., Vinogradova T.M. Ca2+-dependent phosphorylation of Ca2+ cycling proteins generates robust rhythmic local Ca2+ releases in cardiac pacemaker cells. Sci. Signal. 2013;6(260):ra6. doi: 10.1126/scisignal.2003391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Harada M., Nattel S.N., Nattel S. AMP-activated protein kinase: potential role in cardiac electrophysiology and arrhythmias. Circ. Arrhythm. Electrophysiol. 2012;5(4):860–867. doi: 10.1161/CIRCEP.112.972265. [DOI] [PubMed] [Google Scholar]
  • 44.Palloni L.M.G., Sarno N., Azzoni C., Furia N., Mangoni M.E., Porro A., Neeman T., Saponaro A., Thiel G., Moroni A., DiFrancesco D. AMPK-mediated HCN4 channel phosphorylation contributes to age-related intrinsic bradycardia. J. Gen. Physiol. 2026;158(2) doi: 10.1085/jgp.202513873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Aziz Q., Finlay M., Montaigne D., Ojake L., Li Y., Anderson N., Ludwig A., Tinker A. ATP-sensitive potassium channels in the sinoatrial node contribute to heart rate control and adaptation to hypoxia. J. Biol. Chem. 2018;293(23):8912–8921. doi: 10.1074/jbc.RA118.002775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Fukuzaki K., Sato T., Miki T., Seino S., Nakaya H. Role of sarcolemmal ATP-sensitive K+ channels in the regulation of sinoatrial node automaticity: an evaluation using Kir6.2-deficient mice. J. Physiol. 2008;586(11):2767–2778. doi: 10.1113/jphysiol.2007.148932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Han X., Light P.E., Giles W.R., French R.J. Identification and properties of an ATP-sensitive K+ current in rabbit sino-atrial node pacemaker cells. J. Physiol. 1996;490(Pt 2):337–350. doi: 10.1113/jphysiol.1996.sp021148. (Pt 2) [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material

mmc1.pdf (1.4MB, pdf)

Articles from The Journal of Physiological Sciences : JPS are provided here courtesy of Elsevier

RESOURCES