Characterization of Circ_0048766: an oncogenic circular rna promoting triple-negative breast cancer progression via the miR-329-3p/CXCR4 axis and regulated by METTL3

Abstract

Background

Circular_RNAs (circ_RNAs) are involved in the development and progression of human malignancies, including breast cancer. Novel circ_RNAs for breast cancer remain to be further determined. This study investigates the role and mechanism of a novel circ_RNA circ_0048766 in triple-negative breast cancer (TNBC) progression.

Methods

Bioinformatics analysis was performed using the GSE165884 database to identify differentially expressed circ_RNAs. The expression of circ_0048766 was validated in various breast cancer cell lines through quantitative real-time PCR. Functional assays, including CCK-8, flow cytometry, colony formation, and Transwell assays, were conducted in BT-549 and MDA-MB-231 cells. The mechanisms involving methyltransferase-like 3 (METTL3), miR-329-3p, and C-X-C Motif Chemokine Receptor 4 (CXCR4) were examined through bioinformatics, dual-luciferase reporter assays, RNA immunoprecipitation, and RNA pull-down. In vivo studies were conducted using a nude mouse xenograft model to evaluate tumor growth and CXCR4 expression.

Results

Circ_0048766 was significantly upregulated in TNBC cell lines compared to normal breast epithelial cells. Knockdown of circ_0048766 resulted in reduced cell viability, colony formation, migration, and invasion while increasing apoptosis in BT-549 and MDA-MB-231 cells. Mechanistically, circ_0048766 was confirmed to function as a sponge for miR-329-3p. Moreover, miR-329-3p directly suppressed CXCR4 expression, and circ_0048766 regulated CXCR4 in a miR-329-3p-dependent manner. Additionally, circ_0048766 promoted epithelial-mesenchymal transition, as evidenced by its regulation of E-cadherin, N-cadherin, and Vimentin expression via miR-329-3p. MiR-329-3p inhibition or CXCR4 overexpression reversed the effects of circ_0048766 knockdown. In vivo, circ_0048766 knockdown significantly diminished tumor growth and weight, along with decreased CXCR4 levels. METTL3 was identified as an upstream regulator mediating m6A modification of circ_0048766. Functionally, METTL3 knockdown suppressed CXCR4 expression and cell proliferation, effects that were rescued by CXCR4 overexpression.

Conclusions

Circ_0048766 is a novel oncogenic circ_RNA that promotes TNBC progression through the miR-329-3p/CXCR4 signaling axis, regulated by METTL3. This study highlights the potential of targeting the METTL3/circ_0048766/miR-329-3p/CXCR4 axis as a novel therapeutic strategy for TNBC treatment.

Trial registration

Not applicable.

Background

Breast cancer has become the most prevalent malignancy in women globally. Despite recent advances in early diagnosis and effective treatment, the incidence and mortality of breast cancer continue to increase worldwide [1]. In 2022, there were 2.3 million new cases and 660,000 deaths globally. Breast cancer poses a serious threat to patients’ physical health and brings significant psychological, social, and economic burdens to patients and their families. Triple-negative breast cancer (TNBC), as a specific subtype of breast cancer, is characterized by high invasiveness, a high recurrence rate, and a poor prognosis. The occurrence and development of TNBC involve multiple facets, including genetic mutations, abnormal signaling pathways, and epigenetic alterations [2, 3]. Therefore, understanding the pathogenesis of TNBC is crucial for developing novel diagnostic and therapeutic targets.

Circular RNAs (circ_RNAs) are a unique class of non-coding RNAs characterized by a covalent closed-loop structure without a 5 ‘cap and 3’ poly-A tail [4]. They possess a special circular covalent bond structure that makes them more stable than linear RNA and more tolerant to RNase degradation [5–7]. Furthermore, circ_RNAs exhibit cell-type or tissue-specific expression patterns. Functional studies have demonstrated that circ_RNAs can act as microRNA (miRNA) sponges or bind to proteins, thereby participating in the regulation of gene expression [8, 9]. These characteristics make circ_RNAs unique molecular markers for various human diseases, including breast cancer [10–15]. For example, Chen et al. found that circ_0001777 was expressed at low levels in TNBC and its overexpression could modulate the expression of AKAP12 by competitively binding to miR-95-3p, thus inhibiting the proliferation and metastasis of breast cancer cells [16]. In contrast, Zan et al. found that circ-CSNK1G1 was upregulated in breast cancer tissues, where it promoted cancer progression by sponging miR-28-5p and regulating the expression of LDHA [17]. Thus, different circ_RNAs may exert distinct roles. Nevertheless, novel circ_RNAs for breast cancer remain to be further determined.

Notably, we identified a novel circ_RNA, i.e. circ_0048766, through bioinformatics analysis. Its level was elevated in TNBC. Herein, we explored its biological functions and potential mechanisms in the progression of TNBC. Our findings may provide new molecular targets for the clinical treatment of TNBC.

Methods

Bioinformatics analysis

Differentially expressed novel circRNAs were identified from the GSE165884 dataset (https://www.ncbi.nlm.nih.gov/geo/geo2r/?acc=GSE165884) of the GEO database (https://www.ncbi.nlm.nih.gov/). The screening criteria were log2FC > = 1 and P < 0.05. R language was used for data preprocessing. The “heatmap.2” function in R language was utilized to generate a circRNA expression heatmap. Additionally, we predicted potential miRNAs for circ_0048766, the downstream molecules of miR-329-3p implicated in the carcinogenic effects of circ_0048766, and the upstream regulatory factors of circ_0048766 by using the ENCORI database.

Cell lines and cell culture

The cell lines MCF10A, BT-549, MCF-7, HCC1937, and MDA-MB-231 were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cell lines were authenticated by short tandem repeat profiling within the last three years by the supplier. Upon receipt, cells were expanded and cryopreserved within three passages, and all experiments were performed using cells within 15 passages after thawing to ensure genetic authenticity. Cells were cultured in DMEM/F12 (1:1) liquid medium (Biosharp, Beijing, China) supplemented with 0.1% penicillin-streptomycin (Biosharp) and 10% low-endotoxin fetal bovine serum (Beijing NobleRyder Tech, Beijing, China) at 37 °C with 5% CO₂. All cell lines were routinely tested for mycoplasma contamination every two weeks using the PCR-based Mycoplasma Detection Kit (TransGen Biotech, China). The most recent testing was performed for all cell lines used in this study, and all results were negative. Only mycoplasma-negative cells were used for experiments.

Cell transfection

The BT-549 and MDA-MB-231 cells were transfected with circ_0048766 siRNAs (si-circ_0048766-1/2/3) (Ribobio, Guangzhou, China), miR-329-3p mimics (Ribobio), anti-miR-329-3p (Ribobio), C-X-C Motif Chemokine Receptor 4 (CXCR4) overexpression plasmids (pcDNA3.1-CXCR4) (Beyotime Biotechnology, Shanghai, China), or short hairpin RNA targeting methyltransferase-like 3 (sh-METTL3) (sh-METTL3#1 and sh-METTL3#2; Ribobio), along with their corresponding negative controls (NC) using Lipofectamine™3000 transfection reagent (Invitrogen, Carlsbad, CA, USA). For circ_0048766 overexpression, the full-length circ_0048766 sequence was cloned into the pcDNA3.1(+) circRNA mini vector (Addgene, Watertown, MA, USA), which promotes circularization through flanking inverted complementary sequences. The construct was verified by Sanger sequencing and transfected into cells using Lipofectamine™3000 transfection reagent (Invitrogen). All transfections were performed for 48 h, and cells were then harvested for subsequent analyses.

Quantitative real-time PCR (qRT-PCR)

Trizol reagents (Vazyme Biotech, Nanjing, China) were utilized to isolate total RNA from cells and xenograft tumor tissues. For circ_RNA and mRNA, cDNA synthesis was conducted using the HiScript III First Strand cDNA Synthesis Kit (+ gDNA Wiper) (Vazyme Biotech). For miRNA detection, the miRNA First Strand cDNA Synthesis Kit (Vazyme Biotech) was used with a stem-loop reverse transcription method. The qRT-PCR was performed using the SYBR qPCR Master Mix (Vazyme Biotech) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The primer sequences are presented in Table 1. The internal reference genes were GAPDH and U6. The 2^-ΔΔCt method was used to quantify relative gene levels.

Table 1.

Primer sequences

Name	Sequence (5’-3’)
Circ_0048766 Forward	GGAAAGCTGCTGCCAAGAAA
Circ_0048766 Reverse	ACACACCTCCCGAATCATGTC
miR-329-3p Forward	GTGGAACAGACCTGGTAAAC
miR-329-3p Reverse	CAAGTGCGAGTCGTGCAGT
CXCR4 Forward	ACTACACCGAGGAAATGGGCT
CXCR4 Reverse	CCCACAATGCCAGTTAAGAAGA
METTL3 Forward	TTGTCTCCAACCTTCCGTAGT
METTL3 Reverse	CCAGATCAGAGAGGTGGTGTAG
U6 Forward	GCTTCGGCAGCACATATACT
U6 Reverse	GTGCAGGGTCCGAGGTATTC
GAPDH Forward	GGAGCGAGATCCCTCCAAAAT
GAPDH Reverse	GGCTGTTGTCATACTTCTCATGG

Circ_0048766, Circular RNA 0048766; miR-329-3p, MicroRNA-329-3p; CXCR4, C-X-C Motif Chemokine Receptor 4; METTL3, Methyltransferase Like 3; GAPDH, Glyceraldehyde-3-Phosphate Dehydrogenase

To validate the circular structure of circ_0048766, RNase R digestion assay was performed. Total RNA (2 µg) was incubated with or without 3 U/µg RNase R (Epicentre Technologies, Madison, WI, USA) for 15 min at 37 °C, followed by purification using the RNeasy MinElute Cleanup Kit (Qiagen, Hilden, Germany). The purified RNA was then subjected to qRT-PCR analysis as described above. GAPDH was used as a linear RNA control.

For miRNA detection, the forward primers listed are specific to the mature miRNA sequence. The reverse primer used is the universal primer provided in the miRNA First Strand cDNA Synthesis Kit (Vazyme Biotech).

Methylated RNA immunoprecipitation-qPCR (MeRIP-qPCR) assay

To assess m6A modification levels on circ_0048766, MeRIP-qPCR assays were performed using the Magna MeRIP m6A Kit (Millipore, Burlington, MA, USA). Total RNA was isolated from BT-549 and MDA-MB-231 cells transfected with sh-NC or sh-METTL3 using Trizol reagent (Vazyme Biotech, Nanjing, China). RNA was fragmented to approximately 100–200 nucleotides using fragmentation buffer provided in the kit. Fragmented RNA was then incubated with anti-m6A antibody-conjugated magnetic beads or control IgG in immunoprecipitation buffer at 4 °C for 2 h with rotation. After incubation, the beads were washed three times with 500 µL of wash buffer (provided in the kit) at 4 °C for 5 min each to remove non-specifically bound RNA. Following washing, bound RNA was eluted from the beads by incubation with 200 µL of elution buffer containing proteinase K at 55 °C for 30 min, followed by purification using RNA Clean & Concentrator columns (Zymo Research, Irvine, CA, USA). The enrichment of circ_0048766 in the m6A-immunoprecipitated fraction was analyzed by qRT-PCR and calculated as fold change relative to the input control. The primers used for circ_0048766 detection are listed in Table 1.

Dual-luciferase reporter assay

The wild-type (WT) sequences of circ_0048766 and the CXCR4 3’ untranslated region (UTR) containing the predicted miR-329-3p binding sites, as well as their corresponding mutant (MUT) sequences with disrupted seed sequence binding sites, were designed and synthesized by Genecreate (Wuhan, China). The sequences were as follows: circ_0048766 WT: 5’-GACAUGAUUCGGGAGGUGUGUG-3’, circ_0048766 MUT: 5’-GACAUGAUUCGGUCCACACAG-3’, CXCR4 3’UTR WT: 5’-UUGUUUCAUAUUGAUGUGUGUC-3’, and CXCR4 3’UTR MUT: 5’-UUGUUUCAAUUUGUUCACACAC-3’. These sequences were cloned into the pmirGLO dual-luciferase reporter vector (Promega, Madison, WI, USA) downstream of the firefly luciferase gene to generate circ_0048766-WT, circ_0048766-MUT, CXCR4-3’UTR-WT, and CXCR4-3’UTR-MUT reporter plasmids.

For the luciferase reporter assay, HEK293T cells were seeded in 96-well plates at a density of 1 × 10⁴ cells per well and cultured for 24 h. Cells were then co-transfected with 100 ng of the respective luciferase reporter plasmid and 50 nM of miR-329-3p mimics or mimic NC (Ribobio, Guangzhou, China) using Lipofectamine™3000 transfection reagent (Invitrogen, Carlsbad, CA, USA). After 48 h of transfection, cells were harvested and luciferase activities were measured using the Dual-Luciferase Assay Kit (Genecreate, Wuhan, China). Firefly luciferase activity was normalized to Renilla luciferase activity for each sample.

Cell counting Kit-8 (CCK-8) assay

CCK-8 assay was performed using the CCK-8 cell viability assay kit (Beyotime Biotechnology). Briefly, cells were seeded in 96-well plates. After culture for 24 h, 10 µL of CCK-8 reagent was added to each well and incubated at 37 °C for 2 h. The absorbance of each well was measured at 450 nm using an ultra-micro spectrophotometer (Colibri + LB916, Berthold, Germany).

Transwell assay

Transwell migration and invasion assays were conducted using Transwell plates with an 8 μm pore size (Beijing Nuobolaide Technology Co., LTD, China). For invasion assay, the plate was pre-coated with Matrigel. Cells were seeded in a 24-well plate and incubated for 48 h. The upper chamber was filled with 300 µL of serum-free medium, while the lower chamber contained 700 µL of medium supplemented with 10% fetal bovine serum. After incubation for 12 to 48 h, non-migrated/non-invaded cells were gently removed with a cotton swab, and the cells on both the upper and lower surfaces were fixed with methanol for 30 min. Subsequently, the cells were stained with 0.1% crystal violet for 20 min. Finally, the migrated/invaded cells were photographed and counted. The relative proportion of migrated/invaded cells was calculated.

Colony formation assay

Cells were plated in a 6-well plate at a density of 500 cells per well. After culturing for 14 days, the colonies were fixed with 100% methanol for 30 min and subsequently stained with 0.5% crystal violet at room temperature for 30 min. Next, the colonies were washed with distilled water and counted under a microscope.

Flow cytometry

Cells (5–10 × 10⁴) were collected and gently washed with phosphate-buffered saline (PBS). After centrifugation at 1000 ×g for 5 min, cells were resuspended in 195 µL of Annexin V-APC binding solution (Ybscience, Shanghai, China) and incubated with 5 µL of Annexin V-APC (Ybscience) in the dark at room temperature for 10 min. Subsequently, 10 µL of PE (Wuhan Yipu Biotechnology Co., LTD, China) was added and incubated in the dark at room temperature for an additional 10–20 min. Stained cells were analyzed within 1 h using an Attune CytPix flow cytometer (ThermoFisher Scientific, Waltham, MA, USA).

For each independent experiment, gates were established using unstained control cells and single-stained compensation controls to define quadrant boundaries. The lower left quadrant represents viable cells (Annexin V-APC-/PE-), the lower right quadrant represents early apoptotic cells (Annexin V-APC+/PE-), the upper right quadrant represents late apoptotic cells (Annexin V-APC+/PE+), and the upper left quadrant represents necrotic cells (Annexin V-APC-/PE+). Total apoptosis rate was calculated as the percentage of cells in lower right quadrant (early apoptosis) plus upper right quadrant (late apoptosis). Data were analyzed using Attune Cytometric Software (ThermoFisher Scientific).

Western blot analysis

Total proteins were extracted from cells and separated using 10% CFAS-PAGE (Shaanxi Zhonghui Hecai Biomedical Technology Co., Ltd., Xi’an, China), after which the proteins were transferred to a PVDF membrane. The PVDF membrane was blocked at room temperature for 1 h using 5% nonfat milk (Beyotime Biotechnology). Subsequently, primary antibodies against E-cadherin (Clone 67A4, 1:5000, BioLegend), N-cadherin (Clone 8C11, 1:1000, Sigma-Aldrich), Vimentin (Clone VIM 3B4, 1:20000, PROGEN), METTL3 (Clone 105817, 1:2000, Proteintech), and CXCR4 (Clone 12G5, 1:1000, LifeSpan Biosciences) were added and incubated overnight at 4 °C. After washing with TBST, the membrane was incubated with the corresponding secondary antibodies (horseradish peroxidase-conjugated goat anti-rabbit IgG, Beyotime Biotechnology) for 2 h. Finally, the protein bands were detected using an ECL chemiluminescent gel imaging system (4160SF, Tianneng, China).

RNA pull-down assay

To verify the direct interaction between circ_0048766 and METTL3 protein, RNA pull-down assays were performed using a biotin-labeled circ_0048766-specific probe targeting the back-splice junction (designed and synthesized by Ribobio, Guangzhou, China). The biotinylated circ_0048766 probe or control probe (biotin-labeled random sequence, 3 µg) was incubated with streptavidin magnetic beads (Invitrogen, Carlsbad, CA, USA) in binding buffer (20 mM Tris-HCl pH 7.5, 100 mM NaCl, 2 mM MgCl₂, 0.1% NP-40) at 4 °C for 2 h to generate probe-coated beads. BT-549 and MDA-MB-231 cells were collected and lysed in RIP buffer containing protease inhibitors. Protein lysates (1 mg) were pre-cleared with uncoated beads and then incubated with the probe-coated beads overnight at 4 °C. After incubation, the beads were washed five times with wash buffer (20 mM Tris-HCl pH 7.5, 300 mM NaCl, 2 mM MgCl₂, 0.5% NP-40) to remove non-specific binders. Proteins bound to the beads were eluted by boiling in SDS loading buffer and subjected to Western blot analysis as described in Sect.  2.11.

Nude mouse xenograft model

BALB/c nude mice were obtained from Chengdu Dashuo Biotechnology Co., Ltd. (Chengdu, China) and maintained under standard conditions. A total of 6 mice were used in this study (3 in sh-NC group and 3 in sh-circ_0048766 group). For tumor cell inoculation, BT-549 cells were transfected with sh-NC or sh-circ_0048766 plasmids. After 48 h of transfection, cells were exposed to 2 µg/mL puromycin for 24 h to enrich for transfected cells. Viable cells were then harvested and resuspended in PBS, and 1 × 10⁷ cells in 0.1 mL were subcutaneously injected into the right flank of each nude mouse. All injections were performed immediately after puromycin enrichment to ensure sufficient knockdown efficiency. Tumor formation was assessed after 7 days, and the mice were monitored for a total of 30 days.

All animal experiments were approved by the Ethics Committee of The Affiliated Tumor Hospital of Xinjiang Medical University (protocol code: G-2023010). The maximal permitted tumor burden was 2000 mm³ in volume as defined by the institutional guidelines. Body weight and tumor dimensions were measured every three days. Tumor volumes were calculated using the formula: volume = (length × width²) / 2. Throughout the study period, all measured tumors remained below this limit (maximum observed volume: 1700 mm³), and no mice exhibited signs of distress exceeding the approved humane endpoints, including weight loss (> 20%), tumor ulceration, or impaired ambulation. The study is reported in accordance with ARRIVE guidelines.

Sample collection

Mice were sacrificed after 30 days using inhalation euthanasia with CO₂ (flow rate of 1.5 L/min for 5 min), followed by cervical dislocation to confirm death. Tumor tissue was then excised within 15 min and weighed.

Immunohistochemistry

Tumor tissues were fixed in 4% formaldehyde for 24 h, embedded in paraffin, and cut into sections. The sections were dewaxed and rehydrated in graded alcohols, followed by incubation with 0.3% hydrogen peroxide to inactivate endogenous peroxidase activity. Antigen retrieval was performed using sodium citrate (pH 6.0) (Beyotime Biotechnology). After blocking, the sections were incubated with the anti-CXCR4 primary antibody (Hangzhou Huaan Biotechnology Co.) overnight at 4 °C. Following washing with PBS, the horseradish peroxidase-conjugated goat anti-rabbit IgG (Beyotime Biotechnology) was added and incubated in the dark for 30 min. The sections were then developed using DAB chromogenic reagent. Finally, the sections were counterstained with hematoxylin (Beyotime Biotechnology). After hydrochloric acid differentiation and dimethylbenzene transparency, the sections were mounted with neutral gum. Five high-magnification fields were randomly selected for observation. For immunohistochemistry controls, NC sections were incubated with PBS instead of primary antibody under identical conditions to assess non-specific staining. All control samples were processed simultaneously with experimental samples.

Statistical analysis

SPSS version 22.0 (IBM SPSS, Armonk, NY, USA) and GraphPad Prism 8.0 (GraphPad, San Diego, CA, USA) were used for statistical analysis. All experiments were performed in three independent biological replicates, with data presented as the mean ± standard deviation (SD). Differences between the two groups of data were tested by student’s t-test. One-way ANOVA was used for the analysis among multiple groups, with Bonferroni as a post hoc test. P < 0.05 was considered statistically significant.

Results

Circ_0048766 is upregulated in TNBC

To identify the differentially expressed circ_RNAs in breast cancer progression, we conducted bioinformatics analysis on the GSE165884 database. A total of 576 circ_RNAs were identified as differentially expressed, including 280 upregulated and 296 downregulated circ_RNAs (Fig. 1A). The top five circ_RNAs with significant increases and decreases are presented in Fig. 1B. Among them, circ_0048766 showed the most prominent upregulation in the dataset.

Fig. 1.

Analysis of circ_RNAs in breast cancer. A: Volcano plot depicting differentially expressed circ_RNAs based on GSE165884. B: Heatmap showing the top five circ_RNAs with the most significant upregulation and downregulation. C: Expression levels of circ_0048766 in various cell lines detected by qRT-PCR. D: Schematic illustration of circ_0048766 formation from the RPL36 gene. E: RNase R digestion assay confirming the circular structure of circ_0048766. All data are presented as mean ± SD from three independent biological replicates (n = 3). **p < 0.01, ***p < 0.001

To validate the expression of circ_0048766, we assessed its levels across various cell lines using qRT-PCR. The results revealed that compared to the MCF10A cell line, circ_0048766 expression was significantly increased in all three TNBC cell lines tested (BT-549, MDA-MB-231, and HCC1937) as well as in the non-TNBC cell line MCF-7 (Fig. 1C) (P < 0.05). This confirms that circ_0048766 upregulation is a consistent feature across multiple TNBC cell models. Notably, its expression level was highest in BT-549 and MDA-MB-231 cells, which are widely recognized as the most representative TNBC cell lines. Therefore, these two cell lines were selected for subsequent functional experiments.

Further analysis revealed that circ_0048766 was generated through the head-to-tail splicing of exons 4 and 5 of the RPL36 gene (Fig. 1D). To experimentally validate the circular nature of circ_0048766, we performed an RNase R digestion assay. As shown in Fig. 1E, the expression of the linear control GAPDH was dramatically reduced after RNase R treatment. In contrast, circ_0048766 expression remained stable after RNase R treatment, confirming its resistance to exonuclease degradation and supporting its circular structure.

Knockdown of circ_0048766 attenuates the aggressive characteristics of TNBC cells

To determine the role of circ_0048766 in TNBC progression, we knocked down its expression in BT-549 and MDA-MB-231 cells by using si-circ_0048766-1/2/3). The results revealed that these circ_0048766 siRNAs significantly reduced the expression of circ_0048766 in both BT-549 and MDA-MB-231 cells (P < 0.05) (Fig. 2A). The most pronounced reduction was observed in cells transfected with si-circ_0048766-1, which was subsequently selected for circ_0048766 knockdown in further experiments.

Fig. 2.

Analysis of cell viability, colony formation, apoptosis, migration, and invasion of breast cancer cells after circ_0048766 knockdown. Circ_0048766 expression was knocked down in BT-549 and MDA-MB-231 cells using siRNA. A: Level of circ_0048766 expression detected by qRT-PCR. B-C: CCK-8 assays were performed to assess the viability of BT-549 (B) and MDA-MB-231 cells (C). D: Colony formation assays were conducted to evaluate the cell proliferation abilities. E: Flow cytometry was performed to assess the cell apoptosis. Total apoptosis rate was calculated as the sum of early apoptotic (lower right) and late apoptotic (upper right) cells. F: Transwell migration assay was conducted to evaluate the cell migratory abilities. G: Transwell invasion assay determined the cell invasive abilities. Compared with si-NC. * p < 0.05, ** p < 0.01, *** p < 0.001. Representative images from three independent experiments are shown. All data are presented as mean ± SD from three independent biological replicates (n = 3)

Next, we evaluated the effects of circ_0048766 knockdown on cell viability, colony formation, apoptosis, migration, and invasion of TNBC cells. CCK-8 assay revealed that the OD450 value of BT-549 and MDA-MB-231 cells was significantly inhibited by si-circ_0048766, indicating suppressed cell viability (P < 0.05) (Fig. 2B and C). As shown in Fig. 2D, the colony formation assay demonstrated that circ_0048766 knockdown significantly inhibited the formation of cell colonies in both cell lines (P < 0.05). Furthermore, circ_0048766 knockdown significantly increased apoptosis of BT-549 and MDA-MB-231 cells (P < 0.05) (Fig. 2E), as shown by flow cytometry analysis. In addition, Transwell assays found that inhibition of circ_0048766 significantly reduced the migration (Fig. 2F) and invasion ability (Fig. 2G) of BT-549 and MDA-MB-231 cells (P < 0.05). These results indicate that circ_0048766 may be a crucial contributor to the aggressive characteristics of TNBC, as its knockdown leads to reduced cell viability, impaired colony formation, increased apoptosis, and diminished migratory and invasive capacities in BT-549 and MDA-MB-231 cells.

Circ_0048766 functions as a sponge of miR-329-3p

Circ_RNAs have been demonstrated to interact with regulatory miRNAs as competitive endogenous RNAs, thereby regulating miRNA expression at the post-transcriptional level [18]. Using the ENCORI database, we predicted potential miRNAs for circ_0048766 and identified miR-329-3p as a candidate sponge (Fig. 3A). To validate this prediction, we constructed both WT and MUT luciferase plasmids of circ_0048766 for co-transfection with miR-329-3p mimics. As shown in Fig. 3B, the luciferase activity in cells co-transfected with circ_0048766-WT and miR-329-3p mimics significantly reduced (P < 0.05), while no such effect was observed in cells co-transfected with circ_0048766-MUT and miR-329-3p levels (P > 0.05). To functionally validate the interaction between circ_0048766 and miR-329-3p in a cellular context, we examined miR-329-3p levels upon modulation of circ_0048766 expression. As shown in Fig. 3C, knockdown of circ_0048766 in BT-549 and MDA-MB-231 cells resulted in a significant increase in miR-329-3p levels compared to the si-NC group (P < 0.05). Conversely, overexpression of circ_0048766 led to a significant decrease in miR-329-3p levels. These results provide functional evidence that circ_0048766 acts as a molecular sponge for miR-329-3p in cells, affecting its free cellular levels.

Fig. 3.

Circ_0048766 functions as a sponge for miR-329-3p. A: Prediction of miR-329-3p as a downstream target of circ_0048766. B: Relative luciferase activities were assessed in HEK293T cells following co-transfection with miR-329-3p mimics or mimic-NC and circ_0048766-WT or circ_0048766-MUT luciferase reporter plasmids. C: qRT-PCR analysis of miR-329-3p expression in BT-549 and MDA-MB-231 cells following circ_0048766 knockdown (si-circ_0048766) or overexpression (oe-circ_0048766). D: Validation of anti-miR-329-3p transfection efficiency. miR-329-3p expression levels were measured by qRT-PCR in BT-549 and MDA-MB-231 cells transfected with anti-miR-329-3p or anti-miR-NC. E-F: CCK-8 assays were performed to assess cell viability under various treatments in BT-549 (E) and MDA-MB-231 cells (F). G: Colony formation assay was conducted to evaluate proliferation under different treatments. H: Flow cytometry assessed cell apoptosis across different treatments. Total apoptosis rate was calculated as the sum of early apoptotic (lower right) and late apoptotic (upper right) cells. I: Transwell migration assay evaluated migratory abilities under various treatments. J: Transwell invasion assay determined invasive capabilities under different treatments. K: Western blot analysis of E-cadherin, N-cadherin, and Vimentin in different experimental groups. * p < 0.05. ** p < 0.01. *** p < 0.001. Representative images from three independent experiments are shown. All data are presented as mean ± SD from three independent biological replicates (n = 3)

To ascertain whether circ_0048766 exerts its pro-cancer effects through miR-329-3p, we inhibited miR-329-3p by using anti-miR-329-3p (Fig. 3D). In subsequent rescue experiments, circ_0048766 knockdown significantly inhibited the viability of BT-549 (Fig. 3E) and MDA-MB-231 cells (Fig. 3F) (P < 0.05). Notably, the reduction in cell viability caused by circ_0048766 knockdown was reversed by anti-miR-329-3p (P < 0.05). Furthermore, circ_0048766 knockdown significantly diminished cell colony formation compared to the si-NC group (P < 0.05) (Fig. 3G). Furthermore, when comparing the si-circ_0048766 + si-NC group to the si-circ_0048766 + anti-miR-329-3p group, we observed a significant increase in the number of cell colonies (P < 0.05). Additionally, flow cytometry, migration, and invasion assays revealed that the induction of apoptosis (Fig. 3H) and the decrease in migration (Fig. 3I) and invasion abilities (Fig. 3J) resulting from circ_0048766 knockdown were inhibited by anti-miR-329-3p (P < 0.05). We then assessed whether circ_0048766 affects the expression of epithelial-mesenchymal transition markers (E-cadherin, N-cadherin, and Vimentin). Western blot analysis revealed that circ_0048766 knockdown significantly increased E-cadherin expression while markedly decreasing N-cadherin and Vimentin levels (P < 0.05) (Fig. 3K). The regulatory effects of circ_0048766 on these epithelial-mesenchymal transition markers were reversed by anti-miR-329-3p, indicating that circ_0048766 regulates epithelial-mesenchymal transition through miR-329-3p. Therefore, circ_0048766 may enhance the viability, colony formation, migration, and invasion of breast cancer cells while inhibiting their apoptosis through its interaction with miR-329-3p.

Circ_0048766 exerts its cancer-promoting effect through miR-329-3p/CXCR4

To identify the downstream molecules of miR-329-3p implicated in the carcinogenic effects of circ_0048766, we conducted a bioinformatics analysis using the ENCORI database. As presented in Fig. 4A, CXCR4 was identified as a potential downstream target of miR-329-3p. To validate this finding, the dual-luciferase reporter assay was performed using CXCR4-3’ UTR-WT and CXCR4-3’ UTR-MUT along with miR-329-3p. The results demonstrated that miR-329-3p significantly reduced the luciferase activity in cells co-transfected with CXCR4-3’ UTR-WT and miR-329-3p (P < 0.05), suggesting the interaction between miR-329-3p and CXCR4 (Fig. 4B).

Fig. 4.

Circ_0048766 promotes cancer progression through the miR-329-3p/CXCR4 axis. A: Prediction of CXCR4 as a downstream target of miR-329-3p using the ENCORI database. B: Relative luciferase activities were determined in HEK293T cells after co-transfection with CXCR4-WT or CXCR4-MUT luciferase reporter plasmids and miR-329-3p mimics or mimic-NC. C: Western blot analysis of CXCR4 protein expression in BT-549 and MDA-MB-231 cells transfected with miR-329-3p mimics or mimic-NC. D: Western blot analysis of CXCR4 protein expression in BT-549 and MDA-MB-231 cells under different treatment conditions: si-NC, si-circ_0048766, si-circ_0048766 + anti-miR-NC, and si-circ_0048766 + anti-miR-329-3p. E: Verification of CXCR4 overexpression efficiency in BT-549 and MDA-MB-231 cells transfected with oe-CXCR4 or empty vector. F-G: CCK-8 assays assessing cell viability in BT-549 (F) and MDA-MB-231 (G) cells under indicated treatments. H: Colony formation assays evaluating cell proliferation under different treatments. I: Flow cytometry analysis of cell apoptosis. Total apoptosis rate was calculated as the sum of early apoptotic (lower right) and late apoptotic (upper right) cells. J: Transwell migration assays. K: Transwell invasion assays. * p < 0.05, ** p < 0.01, *** p < 0.001. Representative images from three independent experiments are shown. All data are presented as mean ± SD from three independent biological replicates (n = 3)

To further confirm that miR-329-3p functionally regulates CXCR4, we transfected BT-549 and MDA-MB-231 cells with miR-329-3p mimics and examined CXCR4 protein levels by Western blot. As shown in Fig. 4C, miR-329-3p mimics significantly reduced CXCR4 expression compared to mimic-NC in both cell lines (P < 0.05). This demonstrates that CXCR4 is a direct functional target of miR-329-3p.

To determine whether circ_0048766 regulates CXCR4 via miR-329-3p, we performed a rescue experiment. TNBC cells were transfected with si-NC, si-circ_0048766, si-circ_0048766 + anti-miR-NC, or si-circ_0048766 + anti-miR-329-3p, and CXCR4 protein levels were assessed by Western blot. As shown in Fig. 4D, circ_0048766 knockdown significantly decreased CXCR4 expression compared to si-NC (P < 0.05). Co-transfection with anti-miR-NC did not affect this decrease. However, co-transfection with anti-miR-329-3p significantly reversed the si-circ_0048766-induced downregulation of CXCR4 (P < 0.05). These results confirm that circ_0048766 regulates CXCR4 expression in a miR-329-3p-dependent manner.

To evaluate the involvement of CXCR4 in the cancer-promoting effects of circ_0048766, we constructed an overexpression plasmid for CXCR4, which successfully induced the overexpression of CXCR4 in BT-549 and MDA-MB-231 cells (P < 0.05) (Fig. 4E). Then, we assessed the cellular behavior of BT-549 and MDA-MB-231 cells after co-transfection of CXCR4 overexpression plasmid with si-circ_0048766. CCK-8 assay revealed that the substantial decrease in cell viability resulting from circ_0048766 knockdown was reversed by CXCR4 overexpression (P < 0.05) (Fig. 4F and G). Similar trends were observed in colony formation ability (Fig. 4H), apoptosis (Fig. 4I), cell migration (Fig. 4J), and invasion capabilities (Fig. 4K). Thus, the ability of circ_0048766 knockdown to inhibit colony formation, promote apoptosis, and reduce cell migration and invasion was effectively rescued by CXCR4 overexpression.

Encouraged by the in vitro findings, we further investigated the role of circ_0048766 in vivo. As illustrated in Fig. 5A and C, circ_0048766 knockdown significantly reduced tumor growth and weight in xenograft mouse models (P < 0.05). To validate the regulatory axis in vivo, we examined miR-329-3p and CXCR4 mRNA expression in xenograft tumor tissues by qRT-PCR. As shown in Fig. 5D, circ_0048766 knockdown significantly increased miR-329-3p expression and decreased CXCR4 mRNA levels compared to the sh-NC group (P < 0.05). Consistently, immunohistochemical analyses showed that circ_0048766 knockdown resulted in a notable decrease in CXCR4 expression (Fig. 5E).

Fig. 5.

In vivo study of circ_0048766 knockdown affecting tumor formation and CXCR4 expression. A: Images of subcutaneous tumor xenografts. B: Tumor growth curves for xenografts. C: Tumor weights of xenografts. D: qRT-PCR analysis of miR-329-3p and CXCR4 mRNA expression in xenograft tumor tissues. E: Immunohistochemistry analysis of CXCR4 expression in tumor xenografts. Representative images from three independent experiments are shown. Scale bar: 200 μm. ** p < 0.01, *** p < 0.001. For qRT-PCR and tumor measurements, data are presented as mean ± SD from three independent biological replicates (n = 3). For animal studies, n = 3 mice per group. These findings indicate that miR-329-3p/CXCR4 acts as critical mediators of circ_0048766-induced tumor progression

METTL3 regulates circ_0048766 and downstream CXCR4 expression

To elucidate the upstream regulatory factors of circ_0048766, we conducted a bioinformatics analysis using the ENCORI database, which suggested that circ_0048766 may be regulated by m6A methylation (Figs. 6 A-6B). To directly assess whether circ_0048766 contains m6A modifications, we performed MeRIP-qPCR assays in BT-549 and MDA-MB-231 cells. As shown in Fig. 6C and D, circ_0048766 exhibited significantly higher m6A enrichment in the anti-m6A group compared to the IgG control in both cell lines (P < 0.05), confirming the presence of m6A modifications on circ_0048766. Furthermore, this m6A enrichment was markedly reduced following METTL3 knockdown (sh-METTL3) compared to the control group (sh-NC) (P < 0.05), demonstrating that METTL3 is responsible for m6A modification of circ_0048766.

Fig. 6.

METTL3 regulates circ_0048766 and downstream CXCR4 expression. A-B: Bioinformatics prediction of METTL3-mediated m6A modification of circ_0048766 using the ENCORI database. C-D: MeRIP-qPCR analysis of m6A enrichment on circ_0048766 in BT-549 (C) and MDA-MB-231 (D) cells following METTL3 knockdown (sh-METTL3) or control (sh-NC). E-F: RNA pull-down assays verifying the direct interaction between METTL3 protein and circ_0048766 in BT-549 (E) and MDA-MB-231 (F) cells. G: Western blot analysis of METTL3 expression after METTL3 knockdown in BT-549 and MDA-MB-231 cells. H: qRT-PCR analysis of circ_0048766 expression after METTL3 knockdown in BT-549 and MDA-MB-231 cells. I: Western blot analysis of CXCR4 protein expression in BT-549 and MDA-MB-231 cells under different treatment conditions: sh-NC, sh-METTL3, and sh-METTL3 + oe-CXCR4. J: Colony formation assays evaluating cell proliferation under the same treatment conditions. **p < 0.01, ***p < 0.001. Representative images from three independent experiments are shown. All data are presented as mean ± SD from three independent biological replicates (n = 3)

To verify the interaction between METTL3 and circ_0048766, we performed RNA pull-down assays using a biotin-labeled circ_0048766 probe. As shown in Fig. 6E and F, circ_0048766 probe significantly pulled down METTL3 protein compared to the control probe in both BT-549 and MDA-MB-231 cells, indicating a direct binding between circ_0048766 and METTL3. Moreover, following METTL3 knockdown in BT-549 and MDA-MB-231 cells (Figs. 6G), we observed a significant reduction in circ_0048766 levels (P < 0.05) (Fig. 6H). These results confirm that METTL3 positively regulates circ_0048766 expression, likely through m6A modification.

To further validate that METTL3 functions through the circ_0048766/miR-329-3p/CXCR4 axis, we performed rescue experiments. As shown in Fig. 6I, METTL3 knockdown significantly suppressed CXCR4 protein expression compared to the sh-NC group (P < 0.05). Importantly, overexpression of CXCR4 significantly reversed the CXCR4 reduction induced by METTL3 knockdown (P < 0.05). Furthermore, colony formation assays demonstrated that METTL3 knockdown significantly inhibited cell proliferation, and this inhibitory effect was substantially rescued by CXCR4 overexpression (P < 0.05) (Fig. 6J). These results confirm that METTL3 exerts its oncogenic function, at least in part, through the circ_0048766/miR-329-3p/CXCR4 axis.

Discussion

Circ_RNAs are an emerging class of endogenous non-coding RNAs characterized by their circular structure, formed through the covalent linkage of the 3’ and 5’ ends via exon or intron cyclization [4]. Recent advances in high-throughput RNA sequencing and circ_RNA-specific bioinformatics algorithms have facilitated the identification of numerous circ_RNAs across various cells, tissues, and organisms, many of which are implicated in tumorigenesis and cancer progression [19, 20]. In this study, we identified a novel circ_RNA, circ_0048766, which was generated by head-to-tail splicing from exon 4 to exon 5 of the RPL36 gene. The expression of circ_0048766 was regulated by METTL3. In vitro and in vivo experiments demonstrated that circ_0048766 knockdown significantly inhibited the proliferation, migration, and invasion of TNBC cells while promoting apoptosis. Furthermore, these effects of circ_0048766 knockdown were counteracted by the miR-329-3p inhibitor and CXCR4 overexpression. To our knowledge, this study is the first to elucidate the role of circ_0048766 in promoting the progression of TNBC.

Increasing evidence supports the notion that circ_RNAs function as sponges for miRNAs, thereby regulating the expression of miRNA target genes in various malignant tumors [8, 21]. The sponging of miRNAs is a primary mechanism through which circ_RNAs exert their biological functions. For example, Chen et al. reported that circ_001777 was downregulated in breast cancer, and its overexpression regulated AKAP12 expression by competitively binding to miR-95-3p, thereby inhibiting breast cancer proliferation and metastasis [16]. He et al. demonstrated that knocking down circRAD54L2 inhibited the proliferation and invasion of breast cancer by targeting the miR-888/PDK1 pathway axis [22]. Ji et al. revealed that circ_000851 was involved in regulating the malignant progression of breast cancer through the miR-1183/PDK1/p-AKT signaling axis [23]. Zan et al. found that circ-CSNK1G1 was upregulated in breast cancer tissues, promoting the occurrence and progression of breast cancer by sponging miR-28-5p and modulating the expression of LDHA [17]. miR-329-3p is a member of the 14q32 miRNA gene cluster, which plays a significant role in vascular remodeling, cell proliferation, and apoptosis regulation. In liver cancer, miR-329-3p promotes the proliferation, migration, and invasion of tumor cells by inhibiting the expression of tumor suppressor genes (such as Hbp1) and activating the PI3K-AKT-mTOR pathway [24]. In this study, we found that circ_0048766 knockdown resulted in decreased proliferation, migration, and invasion ability of BT-549 and MDA-MB-231 cells as well as increased apoptosis. These effects were abolished by the miR-329-3p inhibitor. Notably, we confirmed for the first time that circ_0048766 directly regulated miR-329-3p, thereby enhancing the survival rate, clonogenic ability, migration, and invasion of TNBC cells through its interaction with miR-329-3p, while simultaneously inhibiting apoptosis. This further expands the role of circ_RNAs in the pathogenesis of TNBC. Furthermore, we found that circ_0048766 promoted epithelial-mesenchymal transition, a key process in cancer metastasis, by regulating epithelial-mesenchymal transition markers including E-cadherin, N-cadherin, and Vimentin in a miR-329-3p-dependent manner. This adds another layer to the pro-metastatic function of the circ_0048766/miR-329-3p axis.

CXCR4 is a G-protein-coupled receptor characterized by seven transmembrane domains and is widely expressed across various tissues and organs. It functions as the sole transmembrane receptor for CXCL12 [25]. The specific binding between CXCR4 and CXCL12 activates a series of downstream intracellular signaling pathways and effector molecules, thereby regulating cellular proliferation, migration, and other biological processes [26–29]. Numerous studies have demonstrated an association between CXCR4 and several cancers, including breast cancer, ovarian cancer, lung cancer, colorectal cancer, primary brain tumors, pancreatic cancer, prostate cancer, multiple myeloma, acute myeloid leukemia, chronic lymphocytic leukemia, and non-Hodgkin lymphoma [20, 30–39]. It has been indicated that CXCR4 promotes angiogenesis, metastasis, growth, and survival [40]. In this study, we demonstrated that miR-329-3p directly suppressed CXCR4 protein expression, and circ_0048766 regulated CXCR4 in a miR-329-3p-dependent manner. Moreover, these effects of circ_0048766 knockdown on cell proliferation, migration, invasion, and apoptosis of BT-549 and MDA-MB-231 cells were rescued by CXCR4 overexpression. In other words, overexpression of CXCR4 could promote TNBC progression, which is consistent with previous findings [40]. Our findings further reinforced the role of CXCR4 in cancer. Various drugs targeting CXCR4 have been developed, including Plerixafor, Ulocuplumab, and LY2510924 [41–43]. Our results also suggested that CXCR4 may be a viable therapeutic target in breast cancer. Additionally, CXCR4 was regulated by circ_0048766, indicating its potential as a target for drug development as well.

Epigenetics primarily regulates gene expression through various gene modification mechanisms without altering the nucleotide sequence of the genes [44]. RNA modification widely affects the structure, function, and stability of RNA, and has attracted much attention in recent years [45]. Among all RNA modifications, m6A is the most prevalent modification in eukaryotic mRNA and is one of the most extensively studied [45]. METTL3 is the first methyltransferase identified as being involved in m6A modification [46]. Dysregulation of METTL3 has been implicated in various human malignancies. Yang et al. demonstrated that METTL3 knockdown effectively inhibited the proliferation, migration, and invasion of gastric cancer cells, while overexpression enhanced its oncogenic potential [47]. Wang et al. found that METTL3 was upregulated in breast cancer tissues and cells [48]. Peng et al. indicated that the upregulation of METTL3 contributed to aberrant m6A modification in colorectal cancer and was positively correlated with tumor metastasis [49]. METTL3 affects cancer development through multiple mechanisms, including RNA stability, regulation of oncogene expression, epithelial-mesenchymal transition, and the AKT signaling pathway [50–53]. Moreover, it has been found that METTL3 regulates PTEN expression, impacting the progression of non-small cell lung cancer [54]. Zhang et al. demonstrated that METTL3 mediated the m6A modification of hsa_circ_0072380 and regulated the progression of gestational diabetes [55]. Li et al. showed that METTL3-mediated m6A modification of circ_0000620 regulated cisplatin sensitivity and apoptosis of lung adenocarcinoma cells through the miR-216b-5p/KRAS axis [56]. In this study, we found that METTL3 knockdown led to a significant decrease in circ_0048766, thereby broadening the spectrum of genes targeted by METTL3. Functionally, we demonstrated that METTL3 knockdown suppressed TNBC cell proliferation, an effect that was significantly rescued by CXCR4 overexpression. These findings provide functional evidence that METTL3 promotes TNBC progression through the circ_0048766/miR-329-3p/CXCR4 axis, further solidifying the role of this regulatory axis in TNBC pathogenesis.

Several limitations of this study should be acknowledged. First, while we have provided direct evidence that METTL3 modified circ_0048766 via m6A methylation and that circ_0048766 regulated the miR-329-3p/CXCR4 axis, the direct effect of METTL3 knockdown on miR-329-3p levels was not examined. Although it is reasonable to infer that METTL3 knockdown would increase miR-329-3p availability by reducing its sponge circ_0048766, direct measurement of mature miR-329-3p levels following METTL3 manipulation would provide additional confirmation. Second, the clinical significance of the METTL3/circ_0048766/miR-329-3p/CXCR4 axis in TNBC patients requires further validation using clinical tissue samples. Future studies should address these points to further establish the therapeutic potential of targeting this axis in TNBC. Third, while circ_0048766 upregulation was validated in three independent TNBC cell lines, the majority of functional experiments were performed in two TNBC cell lines (BT-549 and MDA-MB-231). Although these two cell lines are well-established models that recapitulate key features of TNBC, future studies should include additional TNBC cell lines to further validate the generalizability of our findings. Fourth, the in vivo experiments were performed using transiently transfected cells enriched by short-term puromycin treatment rather than genuine stable cell lines. While this approach allowed for timely assessment of circ_0048766 knockdown effects on tumor growth, the knockdown efficiency may diminish over time. Future studies using authentic stable cell lines generated through long-term antibiotic selection would provide more sustained and consistent gene silencing in vivo.

Conclusions

In summary, this study reveals the pivotal role of circ_0048766 in the promotion of TNBC progression. Our findings demonstrate that circ_0048766 is significantly upregulated in TNBC cell lines and is a crucial contributor to the aggressive characteristics of TNBC, including increased cell viability, enhanced migration and invasion, and decreased apoptosis. Mechanistically, circ_0048766 functions as a competitive endogenous RNA, sponging miR-329-3p and thereby facilitating the upregulation of CXCR4, a known oncogene associated with cancer metastasis and poor prognosis. Furthermore, the m6A methylation enzyme METTL3 is identified as a key regulator of circ_0048766 expression. Given the significant impact of circ_0048766 on TNBC cell behavior and its regulation by METTL3, this novel circ_RNA may serve not only as a promising biomarker for TNBC diagnosis and prognosis but also as a potential therapeutic target. Overall, our findings expand the understanding of the complex interplay of non-coding RNAs in cancer biology and underscore the importance of the METTL3/circ_0048766/miR-329-3p/CXCR4 axis as a critical pathway in TNBC progression. Future studies focusing on this axis may lead to innovative strategies for TNBC treatment, ultimately improving patient outcomes and providing new avenues for targeted therapies.

Abbreviations

circ_RNAs

Circular RNAs

TNBC

Triple-negative breast cancer

miRNA

MicroRNA

CXCR4

C-X-C Motif Chemokine Receptor 4

qRT-PCR

Quantitative real-time PCR

CCK-8

Cell counting Kit-8

WT

Wild type

MUT

Mutations

METTL3

Methyltransferase-like 3

Author contributions

Conceptualization, W.J. and G.S.; methodology, W.J. and Z.L.; software, Y.L.; formal analysis, W.J., Z.L. and Y.L.; investigation, W.J., Z.L., J.O. and N.Z.; resources, G.S.; data curation, W.J. and J.O.; writing—original draft preparation, W.J. and Z.L.; writing—review and editing, W.J., Z.L., J.O., Y.L., N.Z. and G.S.; supervision, G.S.; project administration, G.S.; funding acquisition, W.J. and N.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant number 82360468) and the Hunan Provincial Science and Technology Department (grant number 2024JJ7336).

Data availability

The datasets generated and/or analysed during the current study are available in the Figshare repository, [https://doi.org/10.6084/m9.figshare.29443220](https:/doi.org/10.6084/m9.figshare.29443220) .

Declarations

Ethics approval and consent to participate

The animal study protocol was approved by the Ethics Committee of The Affiliated Tumor Hospital of Xinjiang Medical University (protocol code: G-2023010). The study is reported in accordance with ARRIVE guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.