Skip to main content
NCBI home page
Journal of Neuroinflammation logoLink to Journal of Neuroinflammation
. 2026 Jul 4;23:322. doi: 10.1186/s12974-026-03939-4

Dysregulated glia and periglomerular cells in the olfactory bulb and altered lipocalins in the olfactory epithelium underlie olfactory dysfunction in a murine model of eosinophilic chronic rhinosinusitis

Ryoji Kagoya 1,✉, Hironobu Nishijima 1, Kyohei Horikiri 1, Kei Ogawa 1, Megumi Kishimoto-Urata 1, Shinji Urata 1, Kenji Kondo 1
PMCID: PMC13613770  PMID: 42401910

Abstract

Background

Eosinophilic chronic rhinosinusitis (ECRS) is a chronic inflammatory disease. It is characterized by type 2 inflammation and olfactory dysfunction. Although olfactory dysfunction in patients with ECRS may have sensorineural and central components, the underlying mechanism remains to be elucidated. We aimed to investigate changes in the olfactory bulb (OB) and olfactory epithelium (OE) associated with sinonasal type 2 inflammation, using a murine model of ECRS.

Methods

We developed a murine model of ECRS based on the topical application of calcipotriol and ovalbumin for 14 days and subsequent daily intranasal challenge with ovalbumin for 5 days. Histopathological analyses were performed to assess glial cells and periglomerular cells (PGCs) in the OB. Bulk RNA sequencing was performed to determine the impact of sinonasal type 2 inflammation on the OB and OE. Differentially expressed genes were identified using a false discovery rate < 0.05 (Benjamini–Hochberg adjustment). For molecules exhibiting marked fluctuations at the gene expression level, the protein expression was evaluated using enzyme-linked immunosorbent assay (ELISA).

Results

In the ECRS group, a significant increase was noted in the number of microglia/macrophages and astrocytes in the OB. In addition, the number of tyrosine hydroxylase-positive PGCs was significantly reduced in the OB of mice with ECRS. Bulk RNA sequencing analysis revealed a significant decrease in the gene expression levels of the lipocalin family in both the OB and OE. Subsequent ELISA confirmed a significant reduction in the protein levels of lipocalin 4 and major urinary protein 5 in the OE; conversely, lipocalin 3 levels in the OE were significantly increased. No significant differences were observed in the protein expression levels of these molecules within the OB.

Conclusion

Sinonasal type 2 inflammation causes various changes in the olfactory system. These changes may be involved in the pathogenesis of sensorineural and central olfactory dysfunction in ECRS.

Keywords: Eosinophilic chronic rhinosinusitis, Olfactory bulb, Microglia/macrophages, Tyrosine hydroxylase, Lipocalin

Background

The paranasal sinuses possess chemosensory receptors for odor stimulation and various defense mechanisms against pathogens [1]. Sinus inflammation frequently leads to olfactory dysfunction [2], which is conventionally categorized based on the site of injury as conductive, sensorineural, or central [3]. Conductive olfactory dysfunction is caused by physical blockage of the route from the anterior nostril to the olfactory epithelium (OE). Sensorineural olfactory dysfunction is caused by damage to the olfactory epithelial cells due to various external stimuli. Central olfactory dysfunction originates from abnormalities in the intracranial olfactory pathway following the olfactory bulb (OB) [3].

Eosinophilic chronic rhinosinusitis (ECRS) is a type 2 inflammatory disease of the paranasal sinuses characterized by nasal polyps with eosinophil infiltration. Olfactory dysfunction is a hallmark symptom of the disease [4]. The main mechanism of olfactory dysfunction associated with ECRS is thought to be a conductive disturbance caused by the nasal polyps. Recently, it has been suggested that olfactory dysfunction in patients with ECRS may have sensorineural and central components because inflammatory changes in the OE of patients with ECRS are histologically confirmed, and the degree of nasal airflow and olfactory dysfunction do not always match [4]. The volume of the OB in patients with CRS with nasal polyp (CRSwNP) was reported to be reduced compared with that in healthy participants [5]. Due to the technical and ethical difficulties associated with collecting human olfactory nerve tissue, research on olfactory dysfunction using human samples has not progressed very well.

In recent years, basic research using animal models of various types of rhinosinusitis has provided insights into the changes that occur in the OE and OB due to sinonasal inflammation [6–10]. Hasegawa-Ishii et al. [7] demonstrated an increase in microglia/macrophages in the OB of a murine model of bacterial rhinosinusitis using lipopolysaccharides (LPS). They also revealed a decrease in tyrosine hydroxylase (TH)-positive periglomerular cells (PGCs) in OB [7]. PGCs are interneurons in the glomerular layer of the OB that coordinate input signals from olfactory neurons. TH-positive periglomerular cells are dopaminergic neurons that receive synaptic inputs from olfactory nerves; these cells are known to decrease in number following the deprivation of olfactory input [11]. Our group revealed an increase in microglia/macrophages and proinflammatory cytokines in the OB of a murine model of toll-like receptor 3-mediated upper respiratory tract inflammation [9]. In addition, we established a murine model of short-term type 2 sinonasal inflammation model using calcipotriol and ovalbumin (OVA) and showed histological injury of the OE [12]. However, only a few previous basic researches have discussed the impact of sinonasal type 2 inflammation on the OB [13–15].

In the present study, we investigated the changes in the OB associated with sinonasal type 2 inflammation using histological analysis of glial cells and PGCs in the OB. We also conducted a bulk RNA sequence analysis (RNA-Seq) of the OB and OE samples collected from our ECRS model. Furthermore, we performed an enzyme-linked immunosorbent assay (ELISA) for several molecules that exhibited fluctuations in RNA-Seq.

Methods

Mice

Female BALB/c mice (7-weeks-old) were purchased from CLEA Japan (Tokyo, Japan). They were housed in a temperature-controlled facility maintained on a 12 h light/dark cycle and given with free access to food and water. All procedures were approved by the University of Tokyo Animal Care Committee and conducted in accordance with the University's guidelines for the handling and care of laboratory animals.

Experimental protocol

The mice were divided into following two groups: Control and ECRS. The procedure followed a previously described protocol [12] with some modifications (Fig. 1A).

Fig. 1.

Fig. 1

Open in a new tab

Protocol of the ECRS model and images for analysis. A Two groups of mice were treated with either calcipotriol and OVA or vehicle alone. B Images and levels of cutting positions for the evaluation of eosinophils and basophils. The areas for cell counting were the nasal septum (S) and lateral region (L). Scale bar = 500 µm. C Images and levels of cutting positions for the evaluation of glial and periglomerular cells. Glial cells in the olfactory bulb were evaluated in the GRL, EPL, and GML. PGCs were counted in the medial and lateral areas of the GML. Scale bar = 500 µm. D Sirius red-stained sections showing eosinophil infiltration (red arrow) into the nasal septum and lateral region. Scale bar = 50 μm. E Comparison of eosinophil counts in the two described areas between the groups. F Immunostained sections showing basophil infiltration (red arrow) in the nasal septum and lateral region. Scale bar = 50 μm. G Comparison of the basophil counts in the two described areas between the groups. H Protein level expression levels of cytokines in the OE. I Comparison of the latency [sec] to find buried food between the Control and ECRS groups. Statistical analysis was performed using the Mann–Whitney U test. Multiple comparisons in E, G, and H were corrected using the Benjamini–Hochberg method, with padj < 0.05 representing statistical significance. Data were presented as the means ± standard error with individual data points superimposed. ECRS, eosinophilic chronic rhinosinusitis; OVA, ovalbumin; PBS, phosphate-buffered saline; PGCs, periglomerular cells; EPL external plexiform layer, GML glomerular layer, GRL granular layer, OB olfactory bulb, OE olfactory epithelium

Tape stripping was first performed 10 times on the ventral side of the right ear using cellophane tape. Subsequently, mice in the ECRS group were topically treated on the right ear once daily for 14 days with 2 nmol of calcipotriol (Bio-Techne, Tokyo, Japan) in 20 μL of absolute ethanol along with 100 μg of ovalbumin (OVA) (Merck, Darmstadt, Germany) in 20 μL of phosphate-buffered saline (PBS). Following the topical treatments, daily intranasal administration of 2400 μg of OVA in 20 μL of PBS was performed for 5 days. Mice in the control group received topical treatment with the vehicles only (20 μL of absolute ethanol and 20 μL of PBS) on the right ear for 14 days, followed by intranasal administration of 20 μL of PBS only for 5 days. All mice were sacrificed on day 19.

Fixation and tissue preparation

The mice were deeply anesthetized by intramuscular injection of ketamine and xylazine. They were fixed via transcardial perfusion with 20 mL of 10% neutral-buffered formalin, followed by decapitation. Following the removal of the mandibles, the remaining heads were post-fixed in 10% neutral buffered formalin for 1 week at room temperature (RT). The specimens were subsequently decalcified in Kalkitox (FUJIFILM Wako, Osaka, Japan) for 4 h at RT, washed, dehydrated using a graded ethanol series, and embedded in paraffin. Serial 4-μm-thick coronal sections were obtained at following two distinct levels: (1) the anterior border of the eyes (Fig. 1B) and (2) the center of the eyes (Fig. 1C). These sections were used to evaluate eosinophils and basophils in the OE and glial cells and PGCs in the OB, corresponding to levels (1) and (2), respectively. The prepared sections were mounted on MAS-coated slides (Matsunami Glass, Osaka, Japan) and subsequently subjected to immunostaining as described below.

Sirius red staining

To evaluate eosinophil infiltration in OE, Sirius Red staining was performed [16]. After deparaffinization and rehydration, the sections were incubated with 0.5% Sirius Red solution (FUJIFILM Wako, Osaka, Japan) dissolved in absolute ethanol for 1 h at RT, washed in acidified water (0.5% hydrogen chloride), counterstained with hematoxylin, dehydrated and mounted.

Immunohistochemistry

Primary antibodies were used to identify basophils, microglia/macrophages, microglia, astrocytes, tyrosine hydroxylase (TH), and calretinin (CR).

  • Basophils: anti-mast cell protease 8 (Mcpt8; rat monoclonal, clone TUG8; 1:200 dilution; Biolegend, CA, USA).

  • Microglia/macrophages: anti-ionized calcium-binding adaptor molecule 1 (Iba-1; goat polyclonal; 1:200 dilution; FUJIFILM Wako, Osaka, Japan).

  • Microglia: anti-transmembrane protein 119 (TMEM119; rabbit polyclonal; 1:100 dilution; Gene Tex, CA, USA).

  • Activated astrocytes: anti-glial fibrillary acidic protein (GFAP; rat monoclonal, clone 2.2B10; 1:200 dilution; Invitrogen, CA, USA).

  • TH: anti-TH (rabbit polyclonal; 1:100 dilution; Abcam, Tokyo, Japan).

  • CR: anti-CR (rabbit monoclonal, clone SP13; 1:200 dilution; Invitrogen, CA, USA).

All the primary antibodies were diluted using a ready-to-use antibody diluent (Agilent Technologies,CA, USA). Antigen retrieval was performed after deparaffinization and rehydration. The sections were subjected to heat-induced antigen retrieval. For Mcpt8, TH, and CR immunostaining, a citrate buffer solution pH 6.0 (S2369, Agilent Technologies, CA, USA) was used. For Iba-1 and GFAP immunostaining, a target retrieval solution pH 9.0 (S2368, Agilent Technologies, CA, USA) was used. For TMEM119 immunostaining, a modified citrate buffer solution pH 6.1 (S1699, Agilent Technologies, CA, USA) was used. Endogenous peroxidase activity was blocked by treatment with 3% hydrogen peroxidase (Nacalai Tesque, Kyoto, Japan) in distilled water for 10 min at RT. Next, the sections were incubated for 30 min in Serum-free protein block (Agilent Technologies, CA, USA) at RT to block nonspecific antibody binding and then incubated with the respective primary antibodies described above overnight at 4 °C. After several washes in PBS, sections were incubated for 30 min at RT with horseradish peroxidase conjugated with anti-rat, anti-rabbit, or anti-goat IgG antibodies (Simplestain MAX-PO [Rat], [R], or [G] Nichirei, Tokyo, Japan). After three washes in PBS, color development was achieved using diaminobenzidine (Simplestain DAB, Nichirei, Tokyo, Japan). After washing with distilled water, the sections were counterstained with hematoxylin, dehydrated, and mounted. Histological images of the specimens were obtained by fluorescence microscopy BZ9000 (Keyence, Osaka, Japan).

Histological analyses

To evaluate the degree of type 2 inflammation in the olfactory nasal mucosa, the numbers of infiltrated eosinophils and basophils were counted manually in sections cut at the level of the anterior boarder of the eyes. The number of each type of granulocyte per 500 μm length of the OE was counted in the following two areas: nasal septum and lateral region (Fig. 1B).

To determine the glial cells of the OB, the numbers of microglia/macrophages (Iba-1 + cells) and activated astrocytes (GFAP + cells) were counted in sections cut at the level of the center of the eyes (Fig. 1C). Each type of glial cell was counted in the area of rectangular combination and the total value was calculated as the cell count per 0.2 mm2. The number of glial cells per 0.2 mm2 of the OB was counted in the following three areas: the granule layer (GRL), external plexiform layer (EPL), and glomerular layer (GML) (Fig. 1C). The numbers of TH + and calretinin (CR) + PGCs per 500 μm length of the GML were also counted manually on the sections cut at the level of the center of the eyes (Fig. 1C). The following two areas were evaluated: medial and lateral (Fig. 1C).

Buried food test

Olfactory function was assessed using the Buried Food Test (BFT) performed according to the method described by Yang et al. [17], with minor modifications. A clean test cage (325 mm L × 235 mm W × 170 mm H) containing a 1.5 cm depth of clean bedding was prepared. The subject mouse was first introduced to the test cage for a 5-min acclimatization period and then returned to its home cage. Subsequently, one food pellet (Cyanide-free Mouse Feed, Oriental Yeast, Tokyo, Japan) was buried 1.5 cm beneath the bedding surface in a random corner of the test cage. The mouse was then placed in the center of the test cage, and the latency to locate the buried food was measured. If the mouse failed to locate the food within a maximum cutoff time of 240 s, the latency was recorded as 240 s.

RNA extraction

For RNA extraction, anesthetized mice were transcardially perfused with 10 mL saline and then decapitated. The OE and OB were micro-dissected, minced, and homogenized in TRIzol reagent (Invitrogen, CA, USA). Total RNA was extracted according to manufacturer's instructions.

Transcriptomic library preparation and bulk RNA-Seq

Transcriptomic library construction and bulk RNA-Seq were performed using three independent biological replicates for each group (n = 3 per group) by Rhelixa Corporation (Tokyo, Japan). RNA quality was determined using a Bioanalyzer. The RNA integrity number (RIN) of all samples was confirmed to be > 8.0. Isolation of mRNA and cDNA library preparation were carried out using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, E7490) and NEBNext Ultra RNA Library Prep Kit for Illumina (E7530), following the manufacturer’s instructions.

Bioinformatics and statistical analysis

Bioinformatics analysis was performed as follows.

The quality of the raw paired-end reads was assessed using FastQC (v0.11.7). Low-quality bases (Phred score < 20) and adapter sequences were trimmed using Trimmomatic (v0.38). The trimmed reads were aligned to the reference genome using the RNA-seq aligner, HISAT2 (v2.1.0). The resulting SAM files were converted into BAM files using Samtools (v1.9). The BAM files were then used to estimate the abundance of uniquely mapped reads using featureCounts (v1.6.3). Raw read counts were normalized to transcripts per million (TPM). The samples were hierarchically clustered based on the Euclidean distances of the normalized counts using the stats (v3.6.1) and gplots (v3.0.1.1) R packages. Principal component analysis (PCA) was performed on the normalized counts, and each sample was projected onto the 2D plane defined by the first and second principal components (PCs) using the same R packages. Pearson's correlation coefficients were calculated to assess the correlation between samples. Histograms and a pair plot of the normalized counts, as well as heatmaps generated from the Z-scores of the normalized counts, were created using the stats (v3.6.1) and gplots (v3.0.1.1) R packages.

Differential expression analysis was conducted using raw read counts and DESeq2 package (v1.24.0). Differentially expressed genes (DEGs) were identified using the following criteria: absolute log2 fold change (|log2 FC|> 1) and adjusted p-value < 0.05, calculated using the Benjamini-Hochberg (BH) method for false discovery rate (FDR) control.

Protein extraction and ELISA

The OE and OB tissues were resected and homogenized in 500 μL of CelLyticTM MT Cell Lysis Reagent (Sigma-Aldrich, MO, USA) with 5 μL of protease inhibitor cocktail (Sigma-Aldrich, MO, USA) and 120 U/mL of benzonase endonuclease (Sigma-Aldrich, MO, USA). The homogenates were centrifuged at 10,000 × g at RT for 5 min, following which the supernatants were obtained and stored frozen at − 80 °C before analysis. Blood samples (60 μl/mouse) were collected from the tail vein at day 19, and allowed to clot at RT for 30 min. Serum supernatant was obtained after centrifugation at 10,000 × g for 5 min at RT. The protein levels of IL-4, IL-5, IL-13, IL-1β, IL-6, and TNF-α in the samples were measured using the Mouse ELISA Kit (Invitrogen, Massachusetts, USA) according to the manufacturer’s instructions. The protein levels of major urinary protein (MUP)5, lipocalin (LCN)3, and LCN4 in the samples were measured using the Mouse ELISA Kit (Abbexa, Cambridge, UK) according to the manufacturer’s instructions. The absorbance at 450 nm was measured using Microplate Reader ChroMate (Awareness Technology, FL, USA).

Real-time quantitative polymerase chain reaction (qPCR) analysis

Total RNA extracted from the OE and OB was reverse-transcribed using the PrimeScript RT Master Mix (Takara Biotechnology, Shiga, Japan). Real-time quantitative polymerase chain reaction (qPCR) was carried out on an Applied Biosystems™ QuantStudio™ 7 Flex Real-Time PCR System. The primer sequences used for real-time qPCR are listed in Table 1. The gene expression levels were calculated as the difference between the cycle threshold (Ct) value of the target gene and the Ct value of Gapdh (ΔCt) using the comparative threshold cycle (2 − ΔΔCT) method (n = 5 per group).

Table 1.

Primer sequences of used for qPCR

Gene Forward primer (5’−3’) Reverse primer (5’−3’)
Il1b tccaggatgaggacatgagcac gaacgtcacacaccagcaggtta
Il6 ccacttcacaagtcggaggctta tgcaagtgcatcatcgttgttc
Tnfa actccaggcggtgcctatgt gtgagggtctgggccatagaa
Il4 acggagatggatgtgccaaac agcaccttggaagccctacaga
Il5 tgaggcttcctgtccctactcataa ttggaatagcatttccacagtaccc
Il13 cggcagcatggtatggagtg attgcaattggagatgttggtcag
Gapdh tgtgtccgtcgtggatctga ttgctgttgaagtcgcaggag
Open in a new tab

Statistical analysis

Statistical analyses were performed using SPSS statistical software (SPSS Inc, IL, USA). The Mann–Whitney U test was used to assess differences between the Control and ECRS groups as well as for comparison between the right and left sides, followed by BH correction. Data were presented as the means ± standard error with individual data points superimposed. Statistical significance was defined as an adjusted P-value (Padj) of < 0.05.

Results

Calcipotriol + OVA-treatment induces infiltration of eosinophils and basophils in the OE

First, we histologically confirmed the establishment of type 2 inflammation in the OE of calcipotriol- and OVA-treated mice. The eosinophil numbers in the nasal septum and lateral region (right side) were calculated and compared between the two groups. Representative images are shown in Fig. 1D. The eosinophil counts were significantly higher in the ECRS group than in the Control group in both areas (Fig. 1E). Basophil numbers were counted and compared. The basophil counts in each area were also significantly higher in the ECRS group compared with the Control group (Fig. 1F, G). We also quantified the protein levels of the proinflammatory cytokines in the OE. The levels of IL-1β, IL-6, IL-4, IL-5, and IL-13 in the OE were significantly elevated in the ECRS group compared with the control group (Fig. 1H). TNF-α in the OE was not detected by ELISA. To evaluate olfactory perceptual function, we performed the BFT. The latency to find the buried food was significantly longer in the ECRS group than in the Control group (Fig. 1I).

Microglia/macrophages increase in the OB of mice with ECRS

Next, we evaluated glial cells in the OB of mice with ECRS. Iba-1+ cells (microglia/macrophages) were counted in the GRL, EPL, and GML of the right and left OB sides and compared between the groups. Representative images are shown in Fig. 2A. The Iba-1+ cell count in each right-sided OB area was significantly higher in the ECRS group than in the Control group. Left–right comparison within the ECRS group revealed no significant differences in any of the layers (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

Microglia/macrophages increased in the OB of the ECRS model. A Immunostained sections, showing microglia/macrophages (red arrow) in the OB of the Control and ECRS groups (scale bar = 200 μm). B Comparison of Iba-1+ cell counts in the GML, GRL, and EPL between the groups. Statistical analysis was performed using the Mann–Whitney U test followed by Benjamini–Hochberg method, with padj < 0.05 representing statistical significance. Data were presented as the means ± standard error with individual data points superimposed. EPL, external plexiform layer; GML, glomerular layer; GRL, granule layer; OB olfactory bulb

Microglia increase in the GRL and EPL of the OB of mice with ECRS

We further evaluated the number of only resident microglia (TMEM119+ cells) in the OB. Representative images are shown in Fig. 3A. The TMEM119+ cell count in the GRL and EPL of each right-sided OB area was significantly higher in the ECRS group than in the Control group. In the GML, the density of TMEM119+ cells was remarkably low. Given that TMEM119 is a specific marker for resident microglia, the majority of Iba-1+ cells observed in the GML were likely to be macrophages. Left–right comparison within the ECRS group revealed no significant differences in any of the layers (Fig. 3B).

Fig. 3.

Fig. 3

Open in a new tab

Microglia increased in the OB of the ECRS model. A Immunostained sections, showing microglia (red arrow) in the OB of the Control and ECRS groups (scale bar = 200 μm). B Comparison of TMEM119+ cell counts in the GML, GRL, and EPL between the groups. Statistical analysis was performed using the Mann–Whitney U test. Multiple comparisons in B were corrected using the Benjamini–Hochberg method, with padj < 0.05 representing statistical significance. Data were presented as the means ± standard error with individual data points superimposed. EPL external plexiform layer, GML glomerular layer, GRL granule layer, OB olfactory bulb

Proinflammatory cytokines are elevated in the OB of mice with ECRS

Additionally, we analyzed the expression of proinflammatory cytokine genes in the OB using qPCR. The expression levels of Il1b and Il5 were significantly higher in the ECRS group than those in the Control group. No significant difference was observed for Il6, Tnfa, Il4, and Il13 (Fig. 4A). Protein levels of proinflammatory cytokines in the OB were quantified using ELISA. The levels of IL-1β, IL-6, and IL-4 in the OB were significantly elevated in the ECRS group compared to the control group. In contrast, TNF-α, IL-5, and IL-13 were not detectable in either the ECRS or control groups (Fig. 4B). To assess the systemic inflammatory status of the ECRS model, serum cytokine levels were also measured. However, none of the targeted cytokines (IL-1β, IL-6, TNF-α, IL-4, IL-5, and IL-13) were detected in the serum of either group, with all values remaining below the detection limit.

Fig. 4.

Fig. 4

Open in a new tab

A Gene expression levels of proinflammatory cytokines in OB. B Protein expression levels of proinflammatory cytokines in OB. Statistical analysis was performed using the Mann–Whitney U test followed by Benjamini–Hochberg method, with padj < 0.05 representing statistical significance. Data were presented as the means ± standard error with individual data points superimposed. OB olfactory bulb

Activated astrocytes increase in the GML of the OB of mice with ECRS

We also evaluated the number of GFAP+ cells (activated astrocytes) in OB. The GFAP+ cell numbers in the GRL, EPL, and GML of the right and left OB sides were calculated and compared (Fig. 5A). The GFAP+ cell count in the GML of the right OB was significantly higher in the ECRS group than in the Control group. No significant differences were observed in the EPL or GRL between the two groups. The left–right comparison of GFAP+ cell counts within the ECRS group also showed no significant difference in any layer (Fig. 5B).

Fig. 5.

Fig. 5

Open in a new tab

Activated astrocytes increased in the glomerular layer of the OB of the ECRS model. A Immunostained sections, showing astrocytes (red arrow) in the OB of the Control and ECRS groups. Scale bar = 100 μm. B Comparison of GFAP+ cell counts in the GML, GRL, and EPL between the groups. Statistical analysis was performed using the Mann–Whitney U test. Multiple comparisons in B were corrected using the Benjamini–Hochberg method, with padj < 0.05 representing statistical significance. Data were presented as the means ± standard error with individual data points superimposed. EPL external plexiform layer, GML glomerular layer, GRL granule layer, OB olfactory bulb

TH-positive PGCs decrease in the OB of mice with ECRS

Furthermore, we evaluated two types of PGCs in the GML of OB. The number of TH+ cell in the two areas (medial and lateral) of the GML (right and left sides) were calculated and compared (Fig. 6A). The TH+ cell counts in the medial and lateral areas on the right side of the GML was significantly lower in the ECRS group than in the Control group. Left–right comparison of TH+ cells within the ECRS group revealed no significant differences in any area (Fig. 6B). The CR-positive cells were counted and compared; however, no significant differences were observed in any area (Fig. 6C, D).

Fig. 6.

Fig. 6

Open in a new tab

TH+ cells and calretinin + cells in the GML of the OB. A Immunostained sections, showing TH+ cells (arrow head) in the OB of the Control and ECRS groups. Scale bar = 200 μm. B Comparison of TH+ cell counts in the GML between the groups. C Immunostained sections showing calretinin+ cells (arrowhead) in the OB of the Control and ECRS groups. Scale bar = 200 μm. D Comparison of the calretinin+ cell counts in the GML between the groups. Statistical analysis was performed using the Mann–Whitney U test. Multiple comparisons in B were corrected using the Benjamini–Hochberg method, with padj < 0.05 representing statistical significance. Data were presented as the means ± standard error with individual data points superimposed. GML, glomerular layer; TH, tyrosine hydroxlylase; OB, olfactory bulb

Fluctuated lipocalin family gene expression in the OB and OE of mice with ECRS model

To determine the effect of sinonasal type 2 inflammation on the olfactory system, we performed bulk RNA-Seq. The analysis revealed a clear separation between the ECRS and Control groups. Using the cutoff criteria (log2 [fold change] > 1, base mean > 50, and adjusted p-value < 0.05), 24 differentially expressed genes (DEGs) were identified in the OB (4 upregulated and 20 downregulated), and 44 DEGs were identified in the OE (11 upregulated and 33 downregulated). A heatmap of these DEGs is shown in Fig. 7A, B. Notably, many genes encoding lipocalin family proteins (Lcn2, Lcn3, Lcn4, Lcn11, Mup4, Mup5, Obp1a, Obp1b, Obp2a, Obp2b) were included. Gene expression levels of Lcn3, Lcn4 and Mup5 were significantly reduced in the ECRS group in both the OB and OE (Fig. 7C).

Fig. 7.

Fig. 7

Open in a new tab

Differentially expressed gene analysis. A Heatmap of differentially expressed genes in the OB of the Control and ECRS mice. Blue and red indicate the low and high expression levels, respectively. B Heatmap of differentially expressed genes in the OE of the Control and ECRS mice. Blue and red indicate the low and high expression levels, respectively. C Genes that showed a significant decrease in both OB and OE. OB, olfactory bulb; OE, olfactory epithelium

Altered lipocalin family protein expression in the OB and OE

The lipocalin family genes that were significantly decreased in both OB and OE were Mup5, Lcn3, and Lcn4. Therefore, we quantified the protein levels of these molecules in OB and OE using ELISA. In the OB, LCN3 levels tended to be higher in the ECRS group than in the Control group, although this difference did not reach statistical significance. In the OE, the levels of MUP5 and LCN4 were significantly lower in the ECRS group than in the Control group, whereas LCN3 levels in the OE were significantly elevated in the ECRS group (Fig. 8A, B).

Fig. 8.

Fig. 8

Open in a new tab

Protein expression levels of lipocalin family molecules in the OB and OE. A Protein expression of MUP5, LCN3, and LCN4 in the OB. B Protein expression of MUP5, LCN3, and LCN4 in the OE. Statistical analysis was performed using the Mann–Whitney U test. Multiple comparisons were corrected using the Benjamini–Hochberg method, with padj < 0.05 representing statistical significance. Data were presented as the means ± standard error with individual data points superimposed. LCN, lipocalin: MUP, major urinary protein; OB, olfactory bulb; OE, olfactory epithelium

Discussion

In the present study, we revealed that microglia/macrophages and astrocytes in the OB increased in a murine model of ECRS. We also observed a concurrent decrease in the number of TH+ PGCs in the GML of the OB of the ECRS model. Furthermore, using bulk RNA-Seq and ELISA, we confirmed significant fluctuations in the gene and protein expression levels of the lipocalin family molecules LCN3, LCN4, and MUP5 in both the OE and OB of ECRS mice. To our knowledge, this is the first report demonstrating changes in PGCs and activated astrocytes in the OB and lipocalin family molecules in the OE of mice with ECRS.

Glial cells are crucial components of the OB and are involved in the maintenance of neuronal homeostasis [18]. Microglial cells, the immune cells of the central nervous system (CNS), are responsible for recognizing and scavenging dead cells and pathogens [19]. Under normal conditions, microglial cells remain in a resting phenotype and play roles in neuronal activities such as synaptogenesis, neurogenesis, and release of neurotrophic factors [20]. However, when the neuronal system is injured and the microenvironmental homeostasis is disturbed, microglial cells shift into an active phenotype and secrete proinflammatory cytokines [21]. Proinflammatory cytokines, such as interleukin (IL)−1β and tumor necrosis factor (TNF)-α, are known to exert harmful effects on neuronal cell survival and inhibit neurite outgrowth [22]. These cytokines also lead to microglial activation and reduce neurogenesis [22].

In the present study, mice with ECRS exhibited a higher density of microglia/macrophages and increased levels of proinflammatory cytokines in the OB compared to controls. We previously hypothesized that elevated levels of proinflammatory cytokines in the nasal cavity could be transmitted to the OB via the olfactory nerve, inducing microglial activation and proliferation [9]. Our results revealed that protein expression level of IL-1β is elevated in the OE, which is consistent with the hypothesis [9], albeit the degree of elevation is mild. Although several reports have described the impact of bacterial or viral sinonasal inflammation on OB [6–10], discussion of OB changes associated with type 2 inflammation remains limited [13–15]. Huang et al. [13] showed that the expression levels of Iba1, Il1b, and Tnfa were elevated in a murine ECRS model using OVA and Aspergillus proteases. Zhang et al. [14] reported that Iba1+ cells, IL-1β and TNF-α were increased in the OB of mice with ECRS induced by papain. Zhang et al. [15] reported that microglia and proinflammatory cytokines were increased in the OB of rat with ECRS induced by OVA and Aspergillus proteases. They also revealed reduced OB volume accompanied by thinning of the olfactory neuron layer and the glomerular layer. Our results align with these previous reports. Furthermore, this is the first study to demonstrate a reduction in TH+ PGCs and an increase in activated astrocytes in the OB, as well as a decrease in lipocalin family molecules in the OE, in mice with ECRS.

A few reports have discussed the role of type 2 cytokines in the CNS [23, 24], although there have been no reports on the role of the cytokines in the OB. IL-4 and IL-13 exert both neuroprotective and neurotoxic effects [23]. These cytokines can reduce inflammation by inducing M2 polarization of microglia, while they had cytotoxic effect on dopaminergic neurons expressing IL-13Rα when reactive oxygen species are produced in the model of Parkinson disease [23]. The role of IL-5 in the CNS is characterized in the spinal cord injury model [24, 25]. After spinal cord injury, IL-5 upregulates the expression of calcitonin gene-related peptides and contributes to urinary dysfunction [24, 25]. In our study, an increase in the gene expression of Il5 and the protein level of IL-4 was observed in the OB of the ECRS model; however, no significant changes in the expression of IL-13 were observed. Further investigations are needed to determine the role of type 2 cytokines in OB.

Astrocytes were also increased in the GML of the OB in our murine ECRS model. In the OB, astrocytes coordinate neuronal metabolism and blood flow in response to the neural activity [26]. They also control the survival of adult-born neurons [27]. In contrast, astrocytes are activated by microglia-derived factors and induce neuroinflammation [18, 28]. They may also play a role in OB inflammation in ECRS mice.

It was revealed that TH+ PGCs were decreased in the GML of the OB of mice with ECRS. PGCs are interneurons located in the GML of the OB that regulate the transmission of olfactory information. PGCs can be divided into two subtypes based on their synaptic connectivity to olfactory nerve axons. TH+ PGCs have synaptic connections with the olfactory nerves and are classified as type 1, whereas CR+ PGCs are classified as type 2 and have no synaptic connections to the olfactory nerves [29]. TH+ PGCs are dopaminergic neurons that play a role in the inhibitory regulation of olfactory input [30] and decrease when olfactory input is blocked [11]. Given our previous finding of olfactory epithelial damage in this ECRS model [12], the TH+ PGC reduction likely reflects this decreased olfactory input. Conversely, CR+ PGCs, which lack synaptic connections to the olfactory nerves [29], showed no significant changes. CR+ PGCs are anaxonic neurons [31] and have been proposed to improve signal-to-noise ratios by filtering random excitatory stimuli [32]. Since CR+ PGCs are less well understood than TH+ PGCs, further investigation is warranted [31].

We observed that the basal expression levels of lipocalin family genes are relatively high in both OB and OE, with most genes showing a decrease in the ECRS model compared to the controls. Lipocalin is characterized by a barrel-shaped tertiary structure containing a ligand-binding site that enables the transport of water-insoluble molecules [33]. In the olfactory system, LCNs assist olfactory signal transduction by binding to water-insoluble odor molecules [33]. Nakamura et al. [34] found that applying recombinant LCN1 to the olfactory epithelium of Cynops pyrrhogaster amplified olfactory receptor responses to odorants. Ijichi et al. [35] reported that LCN15 localizes to the Bowman’s glands in the human olfactory cleft mucosa and is concentrated in the olfactory mucus; its concentration is lower in patients with olfactory dysfunction. Furthermore, Chapman et al. [36] demonstrated LCN15 potentiates the human odorant receptor OR51E1 in response to isovaleric acid. Although the role of MUPs in olfactory signal transduction has not yet been studied, their combination in mouse urine contributes to individual recognition [37]. While the impact of Type 2 inflammation on LCN production remains unexplored, IL-4 and IL-13 have been reported to modulate exocrine secretions from the olfactory mucosa [38, 39]. Given that LCNs are secreted by Bowman’s glands [35], their levels may be altered under Type 2 inflammatory conditions.

Although RNA-Seq predicted decreased protein levels of most lipocalin family members in mice with ECRS, subsequent ELISA revealed an increase in the level of some molecules. Such discrepancies between mRNA and protein expression are often observed and attributable to various factors [40]. Our results can be attributed to the following reasons. Because LCNs can bind a broad spectrum of ligands and are involved in the regulation of the immune system [33], they may increase when the tissue is injured. Subsequently, because of the buffering mechanisms regulating the production and degradation of proteins and their stability compared with RNA, only the RNA expression level may decrease [40]. Increased LCNs can be stored within Bowman's glands for a certain period. However, if chronic inflammation causes prolonged damage to Bowman's gland tissue, LCNs may eventually decrease. No previous studies have investigated the role of LCNs in the OB. Although we observed a reduction in RNA expression levels of LCNs in the OB of our ECRS model, we detected no significant changes at the protein level. Consequently, the functional relevance of these reduced LCN transcripts in the OB to olfactory dysfunction remains unclear and warrants further investigation.

The current study has several limitations. First, the observed changes in the OB may not be specific to sinonasal type 2 inflammation, as increases in Iba-1+ cells and decreases in TH+ PGCs in the OB have been confirmed in LPS-induced rhinosinusitis, a model of type 1 inflammation [7]. Furthermore, the precise mechanism by which sinonasal inflammation is transmitted to the OB remains to be fully elucidated. Given that systemic type 2 cytokine levels did not increase in the present model, it is suggested that the inflammatory signal may be transmitted locally. However, this study could not rigorously demonstrate the specific pathway—as suggested in previous reports [41, 42]—wherein cytokines ascend to the central nervous system via the nerves. Secondly, basic information regarding the function of LCNs in the olfactory system is extremely limited. Therefore, the interpretation of the significance of our results requires a great deal of additional information. The LCNs showing variation in our experiment were not LCN15, which is decreased in patients with olfactory dysfunction [35]. This suggests that the LCNs which are crucial for the transduction of olfactory signals differ across species. Thirdly, the long-term effects of chronic type 2 inflammation on the OB have not been fully elucidated. While the ECRS model used in this study was established over a relatively short period of 19 days, understanding the impact of persistent, long-term sinonasal type 2 inflammation on the central nervous system is a critical issue in clinical practice. Yet, it remains important to note that ECRS not only causes physical obstruction of the olfactory cleft but also induces various biochemical changes that affect olfactory signal transduction in the OB. This is because predicting the treatment efficacy for olfactory dysfunction and planning surgical or medical treatment accordingly are difficult for ECRS [43].

In conclusion, we demonstrated various changes in the OB and OE of ECRS mice. These changes are likely to represent mechanisms contributing to the molecular pathology of sensorineural and central olfactory dysfunction associated with ECRS, and thus constitute crucial information for the future development of optimal management strategies for olfactory dysfunction in ECRS.

Acknowledgements

The authors would like to thank Koichi Miyazawa for animal care. The authors are also grateful to Atsuko Tsuyuzaki for their technical assistance.

Abbreviations

BFT

Buried food test

CNS

Central nervous system

CR

Calretinin

CRSwNP

Chronic rhinosinusitis with nasal polyp

ECRS

Eosinophilic chronic rhinosinusitis

ELISA

Enzyme-linked immunosorbent assay

EPL

External plexiform layer

GFAP

Glial fibrillary acidic protein

GML

Glomerular layer

GRL

Granular layer

Iba-1

Ionized calcium-binding adapter molecule 1

IL

Interleukin

LCN

Lipocalin

LPS

Lipopolysaccharides

mcpt8

Mast cell protease 8

MUP

Major urinary protein

OB

Olfactory bulb

OE

Olfactory epithelium

OVA

Ovalbumin

PBS

Phosphate-buffered saline

PGC

Periglomerular cell

qPCR

Quantitative polymerase chain reaction

RNA-Seq

RNA sequencing analysis

RT

Room temperature

TH

Tyrosine hydroxylase

TNF

Tumor necrosis factor

Authors’ contributions

RK, HN, KH, KO, MKU, SU, KK conducted the experiment. RK designed studies, interpreted the results, and wrote the article. KK made helpful revisions of the manuscript.

Funding

This work was supported by JSPS KAKENHI Grant Numbers 22K16905, 20K09749.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

All procedures were approved by the University of Tokyo Animal Care Committee and conducted in accordance with the University's guidelines for the handling and care of laboratory animals.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Denney L, Ho LP. The role of respiratory epithelium in host defence against influenza virus infection. Biomed J. 2018;41(4):218–33. 10.1016/j.bj.2018.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Otten JJ, Fokkens WJ, Reitsma S. Olfactory dysfunction in chronic rhinosinusitis with nasal polyps: effect of treatment with emphasis on biological therapy. Curr Allergy Asthma Rep. 2024;25(1):6. 10.1007/s11882-024-01187-1. [DOI] [PubMed] [Google Scholar]
  • 3.Patel RM, Pinto JM. Olfaction: anatomy, physiology, and disease. Clin Anat. 2014;27(1):54–60. 10.1002/ca.22338. [DOI] [PubMed] [Google Scholar]
  • 4.Rombaux P, Huart C, Levie P, Cingi C, Hummel T. Olfaction in chronic rhinosinusitis. Curr Allergy Asthma Rep. 2016;16(5):41. 10.1007/s11882-016-0617-6. [DOI] [PubMed] [Google Scholar]
  • 5.Shehata EM, Tomoum MO, Amer MA, Alarabawy RA, Eltomey MA. Olfactory bulb neuroplasticity: a prospective cohort study in patients with chronic rhinosinusitis with nasal polyps. Clin Otolaryngol. 2018;43(6):1528–34. 10.1111/coa.13202. [DOI] [PubMed] [Google Scholar]
  • 6.Herbert RP, Harris J, Chong KP, Chapman J, West AK, Chuah MI. Cytokines and olfactory bulb microglia in response to bacterial challenge in the compromised primary olfactory pathway. J Neuroinflammation. 2012;9:109. 10.1186/1742-2094-9-109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hasegawa-Ishii S, Shimada A, Imamura F. Lipopolysaccharide-initiated persistent rhinitis causes gliosis and synaptic loss in the olfactory bulb. Sci Rep. 2017;7(1):11605. 10.1038/s41598-017-10229-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hasegawa-Ishii S, Shimada A, Imamura F. Neuroplastic changes in the olfactory bulb associated with nasal infammation in mice. J Allergy Clin Immunol. 2019;143(3):978-89.e3. 10.1016/j.jaci.2018.09.028. [DOI] [PubMed] [Google Scholar]
  • 9.Kagoya R, Toma-Hirano M, Yamagishi J, Matsumoto N, Kondo K, Ito K. Immunological status of the olfactory bulb in a murine model of Toll-like receptor 3-mediated upper respiratory tract inflammation. J Neuroinflammation. 2022;19(1):13. 10.1186/s12974-022-02378-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kishimoto-Urata M, Urata S, Kagoya R, Imamura F, Nagayama S, Reyna RA, et al. Prolonged and extended impacts of SARS-CoV-2 on the olfactory neurocircuit. Sci Rep. 2022;12:5728. 10.1038/s41598-022-09731-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cho JY, Min N, Franzen L, Baker H. Rapid down-regulation of tyrosine hydroxylase expression in the olfactory bulb of naris-occluded adult rats. J Comp Neurol. 1996;369(2):264–76. 10.1002/(SICI)1096-9861(19960527)369:2<264::AID-CNE7>3.0.CO;2-1. [DOI] [PubMed]
  • 12.Kagoya R, Kondo K, Kishimoto-Urata M, Shimizu Y, Kikuta S, Yamasoba T. A murine model of eosinophilic chronic rhinosinusitis using the topical application of a vitamin D3 analog. Allergy. 2021;76(5):1432–42. 10.1111/all.14627. [DOI] [PubMed] [Google Scholar]
  • 13.Huang WH, Hung YW, Hung W, Lan MY, Yeh CF. Murine model of eosinophilic chronic rhinosinusitis with nasal polyposis inducing neuroinflammation and olfactory dysfunction. J Allergy Clin Immunol. 2024;154(2):325-39.e3. 10.1016/j.jaci.2024.02.021. [DOI] [PubMed] [Google Scholar]
  • 14.Zhang X, Wu W, Zhao H, Li C, Qi L, Wu C, et al. A long-term mixed eosinophilic and neutrophilic chronic rhinosinusitis C57BL/6 mouse model with neuroinflammation, olfactory dysfunction and anxiety-like behaviors. Brain Behav Immun. 2025;128:654–72. 10.1016/j.bbi.2025.05.001. [DOI] [PubMed] [Google Scholar]
  • 15.Zhang Z, Du Y, Xiong S, Cao W, Jiang H, Wang J, et al. Neuroinflammation and neural activity in the olfactory bulb drives olfactory dysfunction in a rat model of eosinophilic chronic rhinosinusitis. Rhinology. 2026;64(1):101–12. 10.4193/Rhin25.164. [DOI] [PubMed] [Google Scholar]
  • 16.Meyerholz DK, Griffin MA, Castilow EM, Varga SM. Comparison of Histochemical Methods for Murine Eosinophil Detection in an RSV Vaccine-enhanced Inflammation Model. Toxicol Pathol. 2009;37(2):249–55. 10.1177/0192623308329342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yang M, Crawley JN. Simple behavioral assessment of mouse olfaction. Curr Protoc Neurosci. 2009;8:8–24. 10.1002/0471142301.ns0824s48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Xie L, Zhang N, Zhang Q, Li C, Sandhu AF, Iii GW, et al. Inflammatory factors and amyloid beta-induced microglial polarization promote inflammatory crosstalk with astrocytes. Aging (Albany NY). 2020;12:22538–49. 10.18632/aging.103663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ajami B, Bennett JL, Krieger C, Tetzlaff W, Rossi FM. Local self-renewal can sustain CNS microglia maintenance and function throughout adult life. Nat Neurosci. 2007;10(12):1538–43. 10.1038/nn2014. [DOI] [PubMed] [Google Scholar]
  • 20.Ferrini F, De Koninck Y. Microglia control neuronal network excitability via BDNF signaling. Neural Plast. 2013;2013:429815. 10.1155/2013/429815. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lehnardt S. Innate immunity and neuroinflammation in the CNS: the role of microglia in Toll-like receptor-mediated neuronal injury. Glia. 2010;58:253–63. 10.1002/glia.20928. [DOI] [PubMed] [Google Scholar]
  • 22.Wang J, Liu J, Zhou R, Ding X, Zhang Q, Zhang C, et al. Zika virus infected primary microglia impairs NPCs proliferation and differentiation. Biochem Biophys Res Commun. 2018;497(2):619–25. 10.1016/j.bbrc.2018.02.118. [DOI] [PubMed] [Google Scholar]
  • 23.Mori S, Maher P, Conti B. Neuroimmunology of the Interleukins 13 and 4. Brain Sci. 2016;6(2):18. 10.3390/brainsci6020018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mamuladze T, Kipnis J. Type 2 immunity in the brain and brain borders. Cell Mol Immunol. 2023;20(11):1290–9. 10.1038/s41423-023-01043-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Gadani SP, Smirnov I, Wiltbank AT, Overall CC, Kipnis J. Characterization of meningeal type 2 innate lymphocytes and their response to CNS injury. J Exp Med. 2016;214(2):285–96. 10.1084/jem.20161982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gengatharan A, Bammann RR, Saghatelyan A. The Role of Astrocytes in the Generation, Migration, and Integration of New Neurons in the Adult Olfactory Bulb. Front Neurosci. 2016;10:149. 10.3389/fnins.2016.00149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Khodosevich K, Lazarini F, von Engelhardt J, Kaneko H, Lledo PM, Monyer H. Connective tissue growth factor regulates interneuron survival and information processing in the olfactory bulb. Neuron. 2013;79(6):1136–51. 10.1016/j.neuron.2013.07.011. [DOI] [PubMed] [Google Scholar]
  • 28.Jha MK, Jo M, Kim JH, Suk K. Microglia-astrocyte crosstalk: an intimate molecular conversation. Neuroscientist. 2019;25(3):227–40. 10.1177/1073858418783959. [DOI] [PubMed] [Google Scholar]
  • 29.Kubo A, Sujino M, Masumoto KH, Fujioka A, Terashima T, Shigeyoshi Y, et al. Profiles of periglomerular cells in the olfactory bulb of prokineticin type 2 receptor-deficient mice. Acta Histochem Cytochem. 2017;50(2):95–104. 10.1267/ahc.17001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kosaka T, Pignatelli A, Kosaka K. Heterogeneity of tyrosine hydroxylase expressing neurons in the main olfactory bulb of the mouse. Neurosci Res. 2020;157:15–33. 10.1016/j.neures.2019.10.004. [DOI] [PubMed] [Google Scholar]
  • 31.Capsoni S, FogliIseppe A, Casciano F, Pignatelli A. Unraveling the Role of Dopaminergic and Calretinin Interneurons in the Olfactory Bulb. Front Neural Circuits. 2021;15:718221. 10.3389/fncir.2021.718221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.FogliIseppe A, Pignatelli A, Belluzzi O. Calretinin-Periglomerular Interneurons in mice olfactory bulb: cells of few words. Front Cell Neurosci. 2016;10:231. 10.3389/fncel.2016.00231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Stopková R, Otčenášková T, Matějková T, Kuntová B, Stopka P. Biological roles of lipocalins in chemical communication, reproduction, and regulation of microbiota. Front Physiol. 2021;12:740006. 10.3389/fphys.2021.740006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Nakamura T, Noumi Y, Yamakawa H, Nakamura A, Wen D, Li X, et al. Enhancement of the olfactory response by lipocalin Cp-Lip1 in newt olfactory receptor cells: an electrophysiological study. Chem Senses. 2019;44(7):523–33. 10.1093/chemse/bjz048. [DOI] [PubMed] [Google Scholar]
  • 35.Ijichi C, Kondo K, Kobayashi M, Shirasawa A, Shimbo K, Nakata K, et al. Lipocalin 15 in the olfactory mucus is a biomarker for Bowman’s gland activity. Sci Rep. 2022;12(1):9984. 10.1038/s41598-022-13464-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Chapman S, Kondo K, Ihara S, Ijichi C, Sato K, Touhara K. Fibronectin in the olfactory mucus increases sensitivity of olfactory receptor response to odorants. Sci Adv. 2025;11(20):eadu7271. 10.1126/sciadv.adu7271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Roberts SA, Prescott MC, Davidson AJ, McLean L, Beynon RJ, Hurst JL. Individual odour signatures that mice learn are shaped by involatile major urinary proteins (MUPs). BMC Biol. 2018;16(1):48. 10.1186/s12915-018-0512-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Miao C, Yu L, Guo L, Liang C, Jiang H. The role of interleukin-4 in olfactory epithelial cells: a preliminary in vitro study. Curr Neurovasc Res. 2025;22(3):245–54. 10.2174/0115672026420545250911091301. [DOI] [PubMed] [Google Scholar]
  • 39.Saraswathula A, Liu MM, Kulaga H, Lane AP. Chronic interleukin-13 expression in mouse olfactory mucosa results in regional aneuronal epithelium. Int Forum Allergy Rhinol. 2023;13(3):230–41. 10.1002/alr.23073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Buccitelli C, Selbach M. mRNAs, proteins and the emerging principles of gene expression control. Nat Rev Genet. 2020;21(10):630–44. 10.1038/s41576-020-0258-4. [DOI] [PubMed] [Google Scholar]
  • 41.Konsman JP, Luheshi GN, Bluthe RM, Dantzer R. The vagus nerve mediates behavioural depression, but not fever, in response to peripheral immune signals; a functional anatomical analysis. Eur J Neurosci. 2000;12:4434–46. 10.1046/j.0953-816x.2000.01319.x. [DOI] [PubMed] [Google Scholar]
  • 42.Romeo HE, Tio DL, Rahman SU, Chiappelli F, Taylor AN. The glossopharyngeal nerve as a novel pathway in immuneto-brain communication: relevance to neuroimmune surveillance of the oral cavity. J Neuroimmunol. 2001;115:91–100. 10.1016/s0165-5728(01)00270-3. [DOI] [PubMed] [Google Scholar]
  • 43.Chen JY, Wang X, Luo X, Jian F, Zhou W, Xiao Z, et al. Predictive model for postoperative unrecovered olfactory function in CRSwNP patients with olfactory disorder. Rhinology. 2024;62(6):689–99. 10.4193/Rhin23.475. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

No datasets were generated or analysed during the current study.

Articles from Journal of Neuroinflammation are provided here courtesy of BMC

RESOURCES