Antibiotic-resistant pathogens and heavy metal-tolerant bacteria in Batissa violacea: A study from the Ba River, Fiji

Divya Darshika Mala; Ashneel Ajay Singh; Ramesh Subramani; Sathiyaraj Srinivasan; Taitusi Taufa; Ashok Kumar; Francis Mani

doi:10.1371/journal.pone.0359203

. 2026 Sep 25;21(9):e0359203. doi: 10.1371/journal.pone.0359203

Antibiotic-resistant pathogens and heavy metal-tolerant bacteria in Batissa violacea: A study from the Ba River, Fiji

Divya Darshika Mala ^1,^#, Ashneel Ajay Singh ^1,^*,^#, Ramesh Subramani ^1,^†,^#, Sathiyaraj Srinivasan ^2,^‡, Taitusi Taufa ^1,^‡, Ashok Kumar ^1,^‡, Francis Mani ^1,^#

Editor: Md Rajib Sharker³

PMCID: PMC13614535 PMID: 42789548

Abstract

The Ba River in Fiji is a critical livelihood source for bivalve harvesters, yet increasing anthropogenic activities threaten the safety of its aquatic food sources. This study comprehensively examines the microbial communities associated with freshwater bivalves (Batissa violacea) and river sediments, focusing on antibiotic resistance and heavy metal (HM) tolerance. Samples from soft tissues, gills, and sediments were subjected to Most Probable Number (MPN) tests, antibiotic susceptibility assays, HM tolerance analysis, and 16S rRNA gene sequencing to identify microbial taxa and their functional characteristics. Several pathogenic bacteria were isolated and identified, including Vibrio cholerae, Vibrio parahaemolyticus, Salmonella spp., and thermotolerant Escherichia coli. Most isolates exhibited multidrug resistance, particularly against rifampicin, vancomycin, penicillin, streptomycin, and tetracycline, posing potential risks to public health and food safety. Conversely, HM tolerance analysis revealed limited microbial resistance to zinc, copper, cadmium, chromium, and lead, predominantly at concentrations of 1 mM. The presence of these antibiotic-resistant and HM-tolerant microbes underscores the critical interplay between environmental contamination and microbial evolution, presenting challenges for both ecosystem health and human consumption safety. The findings highlight the urgent need for integrated environmental management and interventions to mitigate microbial contamination in aquatic systems.

Importance

The Ba River in Fiji is a vital resource for communities dependent on “kai” (freshwater bivalve) harvesting. However, industrial, agricultural, and domestic waste discharge increasingly contaminate the river, raising concerns about the safety of its aquatic resources. This study investigated the microbial communities associated with these bivalves and the river sediments, specifically examining their resistance to antibiotics and tolerance to heavy metals. The findings revealed the presence of several pathogenic bacteria, including Vibrio and Salmonella species, a significant proportion of which exhibited resistance to commonly used antibiotics. While some microbial tolerance to heavy metals such as copper and lead was observed, it remained generally limited. These results suggest that environmental pollution is likely contributing to the spread of antibiotic-resistant and potentially harmful microorganisms, thereby posing a risk to the ecological health of the river, the bivalve populations, and the well-being of the local communities that rely upon them.

Introduction

In Pacific Island countries (PICs), where seafood is foundational to both diet and culture, bivalves represent a primary food source, especially in Fiji. While bivalve production has grown substantially [1], aquatic environments are increasingly strained by anthropogenic pollution [2]. Rising faecal contamination, in particular, poses a serious threat to food safety [3,4]. As filter feeders, bivalves process vast quantities of water, leading to bioaccumulation of faecal pathogens [5], such as Escherichia coli, Faecal Streptococci, and Klebsiella spp., which can cause acute intestinal illnesses [6]. Consequently, E. coli and faecal coliforms serve as standard indicators for sanitary quality seafood and water [7,8]. Given that bivalves are traditionally consumed raw or lightly cooked with viscera intact, they represent a high-risk vector for outbreaks of typhoid fever, cholera, and hepatitis [9], often linked to Vibrio species [10,11]. Beyond microbial threats, bivalve safety is further undermined by chemical pollutants, specifically heavy metals. While naturally present in trace amounts, metal concentrations have surged due to mining, agricultural runoff, and industrial waste discharge [12,13]. These metals persist in the environment and bioaccumulate within the food chain and concentrate in bivalve tissues, posing long-term health risks to human consumers [14–17]. Interestingly, several bacteria have acquired metal resistance genes (MRGs) to survive heavy metal exposure, allowing them to tolerate and even flourish in these toxic conditions [18]. Similarly, antimicrobial resistance (AMR) is driven by the extensive use and misuse of antibiotics, leading to the rise of microbes that are resistant to current prescribed antibiotics [19]. Recent studies reveal a compelling correlation between metal tolerance and antibiotic resistance through a process known as co-selection [20,21]. This is attributed to the fact that the metal resistance genes (MRGs) and the antibiotic-resistant genes (ARGs) are often located on the same mobile genetic elements (plasmids, integrons, and transposons), so heavy metal pressure can drive the persistence and horizontal transfer of AMR, even in the absence of antibiotics [21,22]. This phenomenon significantly accelerates the spread of multi-drug resistance pathogens in contaminated aquatic environments, presenting a complex and escalating challenge to global public health.

Batissa violacea, known locally as “kai”, is Fiji`s only known freshwater bivalve. Harvested from the major rivers, it serves as a crucial protein source, a rich supplier of essential minerals (including calcium, potassium, zinc, and iron) [23], and a vital economic asset for local communities [24]. The freshwater kai fishery is a key contributor to Fijian households and the local economy, with annual market sales reaching an estimated 2,526 tonnes, generating approximately FJD $2.2 million [25]. Despite its socio-economic importance, research on the microbial safety of freshwater bivalves in the Pacific region, particularly in Fiji, remains significantly limited. This study addresses this critical data gap by investigating the microbial communities associated with Batissa violacea and its surrounding sediments in the Ba River. By integrating traditional culture-based methods with high-resolution 16S rRNA gene sequencing, this research ensures precise taxonomic identification of the resident bacteria. Furthermore, by comparing bacterial concentrations across the bivalve`s soft tissues, gills, and river sediments, this study offers a comprehensive understanding of the contamination pathway. Finally, we evaluate the antibiotic resistance and heavy metal tolerance profiles of the isolated strains, highlighting the potential public health risks for local communities that rely on these bivalves as a primary food source.

Materials and methods

Sample collection

Sites.

This study was conducted along the Ba River, located in the Western Division on the main Island of Viti Levu, Fiji (Table 1). The river flows through Ba town and has a total length of approximately 22 km and a maximum water depth of 8 m [26]. Traditional local protocol (sevusevu) was followed to obtain sampling permission from local communities that own and manage the river. Three sites were selected for sample collection (Fig 1). Site 1 was situated 1.8 km upstream from Site 2 and was located behind the Rarawai sugar mill. This site was selected to assess the impact of industrial waste deposition. Site 2, located under the Yalalevu Bridge, was chosen due to its proximity to Ba town and being a common place for harvesting B. violacea (kai). Site 3 was situated 4.8 km upstream from Site 1 at the Vaqia River, selected as a control or pristine environment due to its distance from urban and industrial influences. The samples were collected from three distinct sites to capture environmental variability associated with upstream, downstream, and effluent-impacted conditions.

Table 1. Physiochemical properties and sediment and water samples from different sites and location description. TL – Top left, TR – Top right, C – Center, BL – Bottom left, BR – Bottom right.

Site	Position	GPS	Elevation (m)	Sediment		Water		Site Description
Site	Position	GPS	Elevation (m)	Temp (°C)	pH	Temp (°C)	pH	Site Description
1	TL	17^o3235.8 S, 177^o4053.0 E	6	26.1	6.88	26.2	7.11	Metals deposited at the river bank Sugar mill waste pipe located at the mouth of the river bank Black peat soil
	TR	17^o3235.7 S, 177^o4053.0 E	7	26.8	6.73	26.2	7.11
	C	17^o3235.9 S, 177^o4053.1 E	4	26.2	6.84	26.2	7.11
	BL	17^o3235.8 S, 177^o5053.9 E	6	27.2	6.90	26.2	7.11
	BR	17^o3238.8 S, 177^o4053.1 E	10	24.4	6.81	26.2	7.11
2	TL	17^o3212.3 S, 177^o4055.9 E	5	27.0	7.16	26.6	7.11	Waste deposits such as old tyres, Styrofoam boxes and plastic bags near the river bank Black silt soil
	TR	17^o3212.7 S, 177^o4055.5 E	5	27.0	7.16	26.6	7.11
	C	17^o3212.3 S, 177^o4056.0 E	4	27.3	6.92	26.6	7.21
	BL	17^o3212.4 S, 177^o4055.9 E	4	27.0	6.95	26.6	7.17
	BR	17^o3212.4 S, 177^o4056.0 E	4	27.0	7.07	26.5	7.2
3	TL	17^o3438.7 S, 177^o4127.9 E	3	27.6	7.26	26.2	7.29	Second most common bivalve collection site in Ba Black silt soil
	TR	17^o3238.7 S, 177^o4127.8 E	5	26.08	7.05	25.9	7.34
	C	17^o3438.7 S, 177^o4127.8 E	2	26.2	7.09	25.9	7.18
	BL	17^o3438.7 S, 177^o4127.9 E	4	26.0	7.26	26.9	7.16
	BR	17 ^o3438.7 S, 1774127.8 E	1	26.6	6.98	26.0	7.38

Open in a new tab

Fig 1 — Site 1 is behind the Rarawai Sugar Mill and near Ba town, Site 2 is further downstream, and Site 3 is a supposedly pristine site, upstream of Rarawai mill and Ba town. (*Photo credit: Divya Darshika Mala*).

Sampling.

A total of 90 bivalve samples (30 bivalves per site) and 15 sediment samples (5 pool samples per site) were collected. This sample size allowed the detection of consistent microbial patterns across sites while minimizing sampling bias. All samples were transported to the laboratory in an ice box within 5 hrs of collection and preserved at −20 ˚C until required. All aseptic techniques were strictly followed during the entire sample collection to prevent cross contamination. Sediment samples were collected using 10 m × 10 m quadrat. About 100 g of sediment sample was collected from the four corners and the centre using a grab sampler. The samples from each site were pooled for microbiological study [27]. Physical parameters, including pH and temperature of both water and sediment samples were measured with standard procedure and recorded in situ for each respective site (Table 1).

Bacteriological study

Aerobic bacteria.

Bivalve samples (n = 10) of similar size (5–9 cm shell length) were aseptically dissected to extract soft tissues and gills. A 10 g of each tissue sample (soft tissue and gill) was homogenized in 90 mL of sterilized phosphate buffer (PB; pH 7.0) using a homogenizer (BioLab, New Zealand), resulting in a 10 ⁻ ¹ dilution. The homogenate was serially diluted up to 10 ⁻ ⁷ using 9 mL of sterile PB. From each dilution, 100 µL was plated on plate count agar (PCA; Difco, USA) using the spread plate method and incubated at 37 °C for 24–48 hrs. For sediment samples, 10 g of each pooled sediment was mixed with 90 mL of sterilized distilled water to create a 10 ⁻ ¹ dilution, which was then serially diluted up to 10 ⁻ ⁷ using 9 mL of sterile distilled water. From each dilution, 1 mL aliquot was plated onto the nutrient agar (NA; Difco, USA) using the pour plate method. All Petri dishes were incubated at 37 °C for 24–48 hrs. The results obtained were expressed as the number of colony-forming units per gram (CFU/g) of the sample [7]. A total of 117 distinct colonies were isolated from the soft tissues, gills, and sediments based on their unique morphological characteristics. All colonies were purified on nutrient agar (NA; Difco, USA) and stored on sterile NA slants at −8°C for subsequent analysis.

Isolation of bacterial pathogens

Serially diluted suspensions derived from bivalve tissue and sediment samples were utilized to isolate specific human pathogenic bacteria. Seven selective media were employed to enumerate and tentatively identify Vibrio spp., Salmonella spp., Shigella spp., Streptococcus spp., Klebsiella spp., coliforms, and faecal coliforms. The media included Thiosulfate-Citrate-Bile Salts-Sucrose (TCBS) agar, Xylose Lysine Deoxycholate (XLD) agar, KF Streptococcal agar, MacConkey agar, M-Endo agar, Eosin Methylene Blue (EMB) agar, and m-Faecal Coliform (MFC) agar. Pathogens isolated from these primary cultures were further subjected to Gram staining and microscopic observation following the methodology outlined by Smith and Hussey [28].

Coliform count

Bivalve tissue homogenate was used for coliform enumeration. A 1 mL sample was inoculated into a 10 mL sterile Lauryl Tryptose Broth (LTB) fitted with an inverted Durham tube. The tube was incubated at 37 °C for 24 hrs and checked for gas production (presumptive test). Tubes that showed gas production (positive result) were inoculated (1 mL) into 10 mL of Brilliant Green Lactose Broth (BGLB) and incubated at 37 °C for 24 hrs (confirmatory test). The gas-positive tubes were recorded to determine the Most Portable Number (MNP) index using a standardized MPN table [29]. The positive BGLB tubes were streaked onto EMB agar plates and incubated at 37 °C and 44.5 °C for 24–48 hrs to distinguish the E. coli from the thermo-tolerant E. coli. All bacteria analyses were conducted in triplicate, the mean values were calculated and used for statistical analysis.

DNA extraction and 16s rRNA gene PCR sequencing

Thirty aerobic bacterial isolates were selected for 16S rRNA gene PCR sequencing. Further, bacteria were exclusively selected to facilitate functional studies such as testing antibiotic resistance or tolerance to heavy metals. DNA was extracted from the bacterial isolates following the MicroGEM bacterial extraction kit protocol (https://microgembio.com/product/prepgem-bacteria-dna-extraction-kit/). The 16S rRNA gene was amplified using universal primers 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (CGGTTACCTTGTTACGACTT). Purified PCR products were sequenced using the ABI Prism Sequencer 3730 (Applied Biosystems, USA). Chimera analysis of the 16S rRNA gene sequences was performed using Bellerophon software. The sequences were then compared against the eubacteria RefSeq Genome database using BLASTn to identify closely related type strains. Multiple sequence alignment was carried out with MUSCLE, as previously described by Pipite [30].

Heavy metal tolerance test

All isolated heterotrophic bacterial strains were evaluated for heavy metal tolerance using the agar dilution method. This established approach allows for the simultaneous evaluation of multiple isolates against defined concentrations of antibiotics or heavy metals under controlled conditions. Each strain was individually inoculated into 10 mL of sterile nutrient agar medium supplemented with varying concentrations (1 mM, 3 mM, 5 mM, and 10 mM) of selected heavy metals. Due to Site 1’s proximity to a known effluent discharge from the sugar mill, it is likely to experience elevated levels of pollutants, including heavy metals. In this regard, the selected concentration range of heavy metals (1–10 mM) was used to assess bacterial tolerance and adaptive responses to metal stress. Zn, Cu, Cd, Cr and Pb were chosen for analysis because these metals were found at high concentrations in bivalve soft tissues from Ba River. The cultures were incubated at 37 °C for 24–28 hrs. Each Petri plate was divided into six sections, and 10 µL of each bacterial strain was spot inoculated onto the agar surface. Control plates with streaked bacterial strains and no heavy metals were prepared for comparison. All experiments were conducted in triplicate to ensure reproducibility.

Antibiotics sensitivity test

The panel of antibiotics (streptomycin, penicillin, vancomycin, rifampicin, and tetracycline) was selected to represent a range of mechanisms of action, including inhibition of cell wall synthesis, protein synthesis, and RNA transcription, allowing for a comprehensive assessment of bacterial susceptibility and resistance pattern [31]. Isolated bacterial strains were individually inoculated into 10 mL of sterile nutrient agar medium, supplemented with concentrations of 25 µg, 50 µg, 75 µg, and 100 µg of each antibiotic. The cultures were incubated at 37 °C for 24–28 hrs. Each Petri plate was divided into six sections, and 10 µL of each bacterial strain was spot-inoculated onto the agar surface. The control plates without the antibiotics, were streaked with bacterial strains and incubated under the same conditions at 37 °C for 24–48 hrs for comparison.

Statistical analysis

Microbial samples were analysed using single factor ANOVA. Significant results were subjected to Tukey HSD post hoc pairwise comparison test. Experimental data were collected in triplicates. All data were subjected to exploratory analysis to identify any irregularities and bias including outliers. Variables were then subjected to normality and homogeneity of variance assumptions tests as conditions for using one way ANOVA. Alpha level of p < 0.05 was selected to determine acceptable significance. Statistical analysis was performed using R version 4.3.2 [32].

Results

The socioeconomic livelihoods of communities around the Ba watershed in Fiji are significantly dependent on its water and food resources, particularly the harvesting of kai bivalves for consumption and sale. Due to increasing concerns regarding the degradation of these aquatic resources, this study conducted a thorough examination of the microbial communities associated with the bivalves and river sediments. The investigation focused on microbial characterization, antibiotic sensitivity and tolerance, and heavy metal tolerance.

Isolation and enumeration of aerobic bacteria from soft tissues, gills and sediments

The aerobic bacteria were isolated from soft tissues, gills, and sediments. In bivalves, the maximum bacterial load was observed in the soft tissues (ranging from 7.9 × 10³ cfu/g to 2.2 × 10⁴ cfu/g), followed by the gills (3.4 × 10³ cfu/g–1.4 × 10⁴ cfu/g). Conversely, sediments recorded the lowest bacterial count (2.6 × 10⁴ cfu/g to 2.9 × 10⁴ cfu/g) across all sites. Statistical analysis indicated significant differences (p < 0.05, F–value = 1.95) in bacterial load among the soft tissues, gills, and sediments at each site (Fig 2). Site 1 appeared to be most heavily contaminated, exhibiting the highest aerobic bacterial loads compared to Sites 2 and 3. Site 3 showed higher bacterial loads in soft tissues and sediments than Site 2. However, these results may vary based on the season, sampling location, and bivalves’ species.

Fig 2 — Different lowercase letters (a-f) denote significant differences between total microbial abundance in soft tissues, gills and sediments at 3 sites (ANOVA with Tukey HSD pairwise comparisons, p < 0.05). Vertical bars represent ± S.E. of the mean.

Human pathogenic bacteria

Vibrio spp. isolation and enumeration in bivalves’ soft tissues, gills and sediments

Among the soft tissues, gills, and sediments, soft tissues recorded the highest bacterial load of Vibrio spp. at Site 1 (4.0 × 10³ cfu/g). While Vibrio spp. was present in the soft tissues and sediments, no growth was observed in the gill samples. Statistical analysis showed no significant difference (p > 0.05) in Vibrio spp. bacterial loads amongst various sites (Fig 3).

Fig 3 — S1 – Site 1, S2 – Site 2, S3 – Site 3 along the Ba river in Fiji. Values are presented as means ± standard deviation of triplicate samples.

Faecal Streptococcus isolation and enumeration in bivalves’ soft tissues, gills and sediments

Faecal Streptococcus was most prevalent in the soft tissues across all sites, with loads ranging from 1.0 × 10² cfu/g to 2.7 × 10⁴ cfu/g. In contrast, gills and sediments recorded lower bacterial loads of 7.0 × 10² cfu/g and 5.0 × 10² cfu/g, respectively. These results indicate that bivalves from Site 1 were heavily contaminated with faecal matter, exhibiting the highest load of faecal Streptococcus, followed by Sites 2 and 3. Statistical analysis confirmed a significant difference (p < 0.05, F–value = 186.9) in the bacterial loads of soft tissues across the different sites (Fig 3).

Faecal coliforms isolation and enumeration in bivalves’ soft tissues, gills and sediments

Notably, the presence of faecal coliforms in both bivalves and sediments of the Ba River further confirms faecal contamination in the aquatic environments. Statistical analysis showed a significant difference (p < 0.05, F–value = 13.34) in the faecal coliform bacterial loads across different sampling sites.

Escherichia coli isolation and enumeration in bivalves’ soft tissues, gills and sediments

The maximum E. coli populations were observed in the soft tissues (4.0 × 10² cfu/g), sediments (2.7 × 10² cfu/g), and gills (1.7 × 10² cfu/g). Despite these findings, statistical analysis indicated no significant difference (p > 0.05) in the bacterial load at different sampling sites (refer to Fig 3).

Coliforms isolation and enumeration in bivalves’ soft tissues, gills and sediments

Coliform levels were analysed in the soft tissues, gills and sediments of the Ba River. Soft tissues recorded the highest coliform count (2.9 × 10⁴ cfu/g), while the lowest count was recorded in the gills (1.2 × 10⁴ cfu/g). Statistical analysis showed no significant difference in coliform levels between the study sites (p > 0.05).

Salmonella spp. and Shigella spp. isolation and enumeration in bivalves’ soft tissues, gills and sediments

Salmonella spp. and Shigella spp. were detected in the soft tissues, gills, and sediments. The soft tissues exhibited the highest microbial load, followed by the sediments, while the lowest load was observed in the gills.

Klebsiella spp. isolation and enumeration in bivalves’ Soft tissues, gills and sediments

The results demonstrated that soft tissues contained a higher bacterial load of Klebsiella spp. (9.9 × 10⁴ cfu/g) compared to the gills (2.8 × 10³ cfu/g) and sediments (1.1 × 10⁴ cfu/g). However, statistical analysis showed no significant difference in bacterial load among these three samples at any sites (p > 0.05) (Fig 3).

Enumeration of coliforms using most probable number method

The Most Probable Number (MPN) method was conducted in three stages: the presumptive, confirmatory, and complete tests. Initially, the presumptive test was carried out on the soft tissues, gills, and sediments. All five tubes for each sample type showed positive results and were subsequently selected for confirmatory testing. The confirmatory test also resulted in five positive tubes for all samples, confirming the presence of coliforms (Table 2). These results were compared against the Food and Drug Administration’s Bacterial Analytical Manual [33] standards, confirming that the soft tissues, gills and sediments contained more than 1600 MPN of coliforms per 100 g. The completed MPN test identified the presence of thermotolerant E. coli in soft tissues and sediments across all sites. While gills from Site 1 showed no presence of thermotolerant E. coli, the remaining two sites reported positive results for the bacteria in gill samples.

Table 2. Complete MPN test for soft tissues, gills and sediments.

	S1			S2			S3
	Single Strand		Double Strand (10 ml)	Single Strand		Double Strand (10 ml)	Single Strand		Double Strand (10 ml)
	0.1 ml	1ml	Double Strand (10 ml)	0.1 ml	1ml	Double Strand (10 ml)	0.1 ml	1ml	Double Strand (10 ml)
ST	+	+	+	+	+	+	–	+	+
G	–	–	–	+	+	+	–	+	+
S	+	+	+	+	+	+	+	+	+

Open in a new tab

* + Growth at 44.5 °C; – No growth at 44.5 °C

Isolation of selected bacterial strains

Nutrient Agar media was used to isolate bacterial strains via the streak plate method [34]. A total of 117 colonies were selected from the soft tissues, gills and sediments; of these, 53 were identified as aerobic bacteria and 64 as human pathogens. The identified pathogenic strains are detailed in Table 3. Thirty of the aerobic bacteria were selected for molecular analysis based on their unique morphological characteristics. Most colonies were circular, flat, mucoid, and possessed entire margins. In addition, all 117 colonies were subjected to heavy metal tolerance and antibiotic resistance testing.

Table 3. Human pathogen colonies in soft tissues, gills and sediments of bivalves from different sites.

Bacterial Strain	Colony Size	Color/ Pigment	Form	Margin	Elevation	Other Features	Name
S1ST022	Medium	Yellow	Circular	Entire	Raised	Mucoid	Coliforms
S1ST023	Medium	Red	Circular	Entire	Raised	Mucoid	Shigella spp.
S1ST024	Small	Red	Circular	Entire	Flat	Mucoid	Streptococcus spp.
S1ST025	Medium	Pale pink	Circular	Entire	Flat	Mucoid	Enterococcus spp.
S2ST026	Medium	Yellow	Circular	Entire	Raised	Mucoid	Coliforms
S2ST027	Medium	Red	Circular	Entire	Raised	Mucoid	Shigella spp.
S2ST028	Small	Red	Circular	Entire	Flat	Mucoid	Streptococcus spp.
S2ST029	Medium	Pink	Circular	Entire	Raised	Mucoid	Klebsiella spp.
S3ST030	Small	Yellow	Circular	Entire	Raised	Mucoid	Coliforms
S3ST031	Medium	Black	Circular	Entire	Flat	Mucoid	Salmonella spp.
S3ST032	Medium	Red	Circular	Entire	Raised	Mucoid	Shigella spp.
S3ST033	Small	Red	Circular	Entire	Flat	Mucoid	Streptococcus spp.
S3ST034	Minute	Pink	Circular	Entire	Raised	Mucoid	Coliforms
S3ST035	Minute	Pink	Circular	Entire	Flat	Mucoid	Coliforms
S3ST036	Medium	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST037	Small	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST038	Medium	Green	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST039	Small	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST040	Small	Green	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST041	Large	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST042	Small	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST043	Small	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST044	Small	Green	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3ST045	Medium	Green	Circular	Entire	Flat	Mucoid	Vibrio spp.
S1ST046	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli
S2ST047	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli
S3ST048	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli
S1G021	Small	Yellow	Circular	Entire	Raised	Mucoid	Coliforms
S1G022	Medium	Black	Circular	Entire	Flat	Mucoid	Salmonella spp.
S1G023	Pin point	Red	Circular	Entire	Raised	Mucoid	Shigella spp.
S1G024	Pin point	Pale pink	Circular	Entire	Flat	Mucoid	Enterococcus spp.
S1G025	Pin point	Colorless	Circular	Entire	Flat	Mucoid	Coliforms
S2G026	Medium	Red	Circular	Entire	Flat	Mucoid	Streptococcus spp.
S2G027	Pin point	Red	Circular	Entire	Raised	Mucoid	Shigella spp.
S2G028	Medium	Yellow	Circular	Entire	Raised	Mucoid	Coliforms
S3G029	Pin point	Red	Circular	Entire	Flat	Mucoid	Streptococcus spp.
S3G030	Pin point	Pale pink	Circular	Entire	Flat	Mucoid	Enterococcus spp.
S3G031	Medium	Black	Circular	Entire	Flat	Mucoid	Coliforms
S3G032	Medium	Red	Circular	Entire	Flat	Mucoid	Streptococcus spp.
S3G033	Pin point	Black	Circular	Entire	Flat	Mucoid	Coliforms
S1G034	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli
S2G035	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli
S3G036	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli
S1S022	Pin point	Red	Circular	Entire	Raised	Mucoid	Shigella spp.
S1S023	Small	Pink	Circular	Entire	Raised	Mucoid	Klebsiella spp.
S1S024	Medium	Pink	Circular	Entire	Raised	Mucoid	Coliforms
S1S026	Small	Pink	Circular	Entire	Raised	Mucoid	Coliforms
S1S027	Medium	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S1S028	Medium	Green	Circular	Entire	Flat	Mucoid	Vibrio spp.
S2S029	Small	Pink	Circular	Entire	Raised	Mucoid	Klebsiella spp.
S2S031	Small	Green	Circular	Entire	Flat	Metallic Sheen	E.coli
S2S032	Small	Pink	Circular	Entire	Raised	Mucoid	Coliforms
S2S033	Small	Green	Circular	Entire	Flat	Metallic Sheen	Coliforms
S2S034	Small	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3S035	Small	Green	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3S036	Pin point	Red	Circular	Entire	Raised	Mucoid	Shigella spp.
S3S037	Small	Pink	Circular	Entire	Raised	Mucoid	Klebsiella spp.
S3S038	Small	Green	Circular	Entire	Flat	Metallic Sheen	E.coli
S3S039	Small	Green	Circular	Entire	Flat	Metallic Sheen	Coliforms
S3S040	Small	Yellow	Circular	Entire	Flat	Mucoid	Vibrio spp.
S3S041	Small	Green	Circular	Entire	Flat	Mucoid	Vibrio spp.
S1S042	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli
S2S043	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli
S3S044	Small	Green	Circular	Entire	Flat	Metallic Sheen	Thermotolerant E.coli

Open in a new tab

* S1, S2, S3- Sites; ST- Soft Tissues; G- Gills; S- Sediments; 005, 006 etc. Strain number.

16S rRNA gene sequencing for aerobic bacteria

16s rRNA Gene sequencing was utilized to identify bacteria isolated from the soft tissues, gills, and sediments. Fig 4 shows the results of the 16s rRNA PCR sequencing for these strains. The sequencing focused specifically on the isolated bacterial cultures; of the 30 bacterial strains analysed, 23 distinct bacterial species were identified. Detailed descriptions of each identified strain are provided in Table 4.

Table 4. 16s rRNA bacterial strain description.

Bacteria	Description	Reference
*Rhodococcus hoagii*	Formely known as Rhodococcus equi, Gram positive bacteria, Soil dwelling actinomycete, grows well at temperatures ranging from 10° to 40° C, Human and animal pathogen (mostly horses and pigs), Causes pneumonia in foals, Affects immunosuppressed humans such as AIDS patient	[35,36]
*Curtobacterium citreum*	Aerobic, non-spore forming, Gram-positive bacillus, has been isolated from plants but not a plant pathogen, have not been any reports of human infections	[37]
*Leclercia adecarboxylata*	Gram negative rods, Distributed widely in food and water, a part of normal flora in the gut of animals and in the stool of humans, Extremely rare human pathogen, Most commonly affecting immune compromised individuals, such as cancer, leukemia, renal failure and cirrhosis, Susceptible to many anti-biotics but multidrug resistant strains have been reported recently	[38]
*Pseudomonas nitroreducens*	Gram-negative, rod-shaped soil bacteria, Psychrotrophic bacterium, Ability to synthesize polyhydroxybutyrate (PHB) and could be used to produce biodegradable plastic	[39]
*Bacillus toyonensis*	Gram positive bacteria, Bioflocculant producing bacteria, naturally occurring in soils, non-toxigenic and non-pathogenic, Optimum growth at 35 °C, Used as a probiotic in animal feed, Resistant to chloramphenicol and tetracycline	[40]
*Microbacterium laevaniformans*	Gram positive, Occur in raw sewage and in activated sludge, Tolerant to heavy metals (uranium, nickel, cobalt and cadmium)	[41]
*Acinetobacter kookii*	Gram negative, Novel bacteria isolated from soil, Grows over a broad range of temperatures (24–41 °C)	[42]
*Paenibacillus barcinonensis*	Isolated from a rice field, Gram positive, Growth occurs at temperatures in the range 10–40 °C and at pH 5–10.4	[43]
*Microbacterium natoriense*	Novel sp. isolated from soil in Natori, Japan, Gram-positive, rod-shaped bacteria, Optimum temperature for growth 30 °C, pH optimum for growth of 5–7, Produces D-aminoacylase (enzyme function in xenobiotic metabolism)	[44]
*Staphylococcus edaphicus*	Novel sp. isolated in Antarctica, Gram positive, spherical or irregular cocci bacteria, Growth temperature ranging from 10 °C- 42 °C, Antimicrobial resistance genes were found in the genome	[45]
*Streptomyces katrae*	Isolated from soil in India, Gram-positive filamentous bacteria, Highly sensitive to amikacin, ampicillin, ciprofloxacin, erythromycin, gentamicin, imipenem, norfloxacin, tetracycline, and vancomycin. Resistance towards chloramphenicol, cephalothin, cephoxitin, co-trimoxazole, oxacillin, penicillin, piperacillin, and rifamycin	[46]
*Paenibacillus cucumis*	Novel sp. isolated from a cucumber plant, Gram-positive, rod-shaped bacteria, Optimum temperature for growth is 28–30 °C	[47]
*Rhizobium pusense*	Novel sp. isolated from the rhizosphere of chickpea, Gram-negative, rod-shaped bacteria, Able to grow at 16–41 °C, Main human pathogen within Rhizobium sp.	[48]
*Bacillus thuringiensis*	Gram-positive, rod-shaped bacteria, Natural occurring, soil borne bacteria, Used commercially to control insects important to agriculture and public health, Insecticidal genes from Bacillus thuringiensis have been incorporated into several major crops, rendering them insect resistant, Susceptible to streptomycin, chloramphenicol, rifampicin, neomycin, lincomycin, monomycin, kanamycin, and resistant to ampicillin and polymyxin, Resistant to tetracycline	[49]
*Sphingobacterium multivorum*	Gram negative bacteria, Isolated from soil, plants, food and water sources and hospitals, Rarely cause disease in humans, Infection has primarily been reported in immunocompromised patient such as patients with diabetes mellitus, end-stage renal disease patients who are undergoing hemodialysis, patients with malignant cancer who are undergoing chemotherapy, chronic alcoholic liver disease, HIV patients, or cystic fibrosis patients, Bacteremia and acute meningitis also caused by this bacterium, Susceptible to trimethoprim sulfamethoxazole and ciprofloxacin but resistant to aminoglycosides, One reported case showed that the organism was resistant to ampicillin	[50]
*Microbacterium paraoxydans*	Novel sp. isolated from the fish Nile tilapia in Mexico, causes disease in fish, Gram positive bacteria, grow aerobically at 20, 37, and 40°C, Causes bacteremia in immunocompromised patients	[51]
*Bacillus cereus*	Gram positive, toxin-producing bacteria, Commonly found in the environment (soil, vegetation and can be present in foods), Associated with food poisoning, Increasingly reported to be a cause of serious and potentially fatal non gastrointestinal tract infections, Produces tissue destructive exoenzymes, Resistant to penicillin and susceptible to clindamycin, vancomycin, gentamicin, chloramphenicol, and erythromycin	[52]
*Exiguobacterium profundum*	novel sp. moderately thermophilic, lactic acid-producing bacterium isolated from a deep-sea hydrothermal vent, Gram positive bacteria, Grows optimally at 45°C	[53]
*Exiguobacterium indicum*	novel sp.a psychrophilic bacteria isolated from the Hamta glacier of the Himalayan mountain ranges of India, Gram positive, rod-shaped bacteria, Grows at 5–30 °C, Resistant to norfloxacin, cotrimoxazole, clindamycin, doxycycline, sulfamethoxazole, amoxicillin, amikacin, nalidixic acid, nitrofurantoin and colistin, Sensitive to tobramycin, lomefloxacin, roxithromycin, ciprofloxacin, penicillin, cefoperazone, vancomycin, cefuroxime, lincomycin, cefotaxime, cefazolin, kanamycin, novobiocin, chloramphenicol, ampicillin, tetracycline, streptomycin, erythromycin, bacitracin, gentamicin G, polymyxin B, oleandomycin, spectinomycin, rifampicin and carbenicillin.	[54]
*Bacillus aryabhattai*	Novel sp., First isolated and identified from cryotubes used to collect air samples, Dweller of the East Kolkata Wetlands, but its source is not proved, A plant growth promoting rhizobacterium, Gram positive bacteria	[55]
*Bacillus pseudomycoides*	Novel sp., Gram positive bacteria, Optimum growth temperature is 28°C	[56]
*Pseudomonas stutzeri*	Widely distributed in the environment, Human Pathogen, proposed as a model organism for denitrification studies, Participate in the degradation of pollutants or interact with toxic metals, Infection has been reported in association with bacteremia/septicemia, bone infection, eye infection, skin infection, urinary tract infection and ventriculitis	[57]
*Fictibacillus enclensis*	Novel sp. isolated from marine sediment, Gram positive bacteria	[58]

Open in a new tab

Heavy metal tolerance test of bacteria isolated from Fijian bivalves and sediments

Heavy metal tolerance tests were conducted for aerobic bacteria and human pathogens isolated from Fijian bivalves’ soft tissues, gills, and river sediments. A total of 20 aerobic bacteria and 27 human pathogens from the soft tissues were evaluated (S1 Table). Among the 20 aerobic bacteria, strains S3ST013, S3ST018, S3ST019, and S3ST021 were tolerant to 1 mM Zn; however, the remaining strains were sensitive at 1mM, and all strains were sensitive at concentrations of 3 mM, 5 mM, and 10 mM. At 1 mM Cu, only strains SIST002, S2ST011, and S3ST021 were sensitive, while the rest were tolerant. All aerobic strains exhibited sensitivity to Cu at 3 mM, 5 mM, and 10 mM. Furthermore, all strains were sensitive to Cd at all tested concentrations. Regarding Cr and Pb, all strains except SIST002 and S2ST011 were tolerant at 1 mM, but all became sensitive at 5 mM and 10 mM. Of the 27 human pathogen strains, Vibrio spp. (S3ST041) exhibited tolerance to Zn at all concentrations, while the remaining strains were sensitive at 5 mM and 10 mM. At 1 mM Cu, all strains were tolerant except for S3ST031; however, all strains were sensitive at 5 mM and 10mM. All pathogen strains were sensitive to Cd across all concentrations. At 1 mM Cr and Pb, all strains were tolerant except for S3ST031. While a few strains maintained tolerance at 3 mM and 5 mM Cr, all strains were sensitive to Pb at 3 mM and above (S1 Table).

Out of 33 bacterial strains isolated and purified from the gills, 17 were identified as aerobic bacteria and 16 as human pathogens (S2 Table). Most aerobic isolates showed tolerance to Zn up to 1 mM, and few exhibited up to 3 mM. In contrast, only four aerobic isolates tolerated 1 mM Cu, while strain S1G002 exhibited partial tolerance. All aerobic strains were sensitive to Zn at ≥ 5 mM, to Cu at ≥ 3 mM, and to Cd across all tested concentrations. However, these isolates exhibited elevated tolerance to Cr and Pb, with growth observed at concentrations up to 5 mM (S2 Table). Among the human pathogens, 10 strains tolerated Zn and Cu at 1 mM, with a few maintaining tolerances up to 3 mM. Similar to soft tissues, all pathogen strains were highly susceptible to Cd at all concentrations. Most pathogens tolerated Cr up to 3 mM, and seven strains maintained tolerance up to 5 mM. Furthermore, human pathogens showed strong tolerance to Pb, with the majority of stains surviving at concentrations up to 5 mM. Critically, no bacterial isolates from the gills survived at the maximum concentrations of 10 mM for any tested heavy metal (S2 Table). Overall, soft tissue isolates demonstrated low heavy metal tolerance, primarily restricted to ≤ 1 mM. Similarly, gill-associated bacteria displayed weak tolerance to Zn, Cu, and Cd, but exhibited distinctly higher tolerance profiles for Cr and Pb.

A total of 37 bacterial strains; compromising 16 aerobic bacteria and 21 human pathogens, were isolated from the river sediments for heavy metal tolerance testing (S3 Table). Most aerobic isolates showed tolerance to Zn, Cu, Cr, and Pb at 1 mM; to Cu, Cr, and Pb at 3 mM; and to Cr and Pb at 5 mM. Only a few aerobic strains tolerated 3 mM Zn, and all were universally susceptible to Cd. Among the 21human pathogens, all strains exhibited tolerance to 1 mM Cu, Cr, Pb, whereas Klebsiella spp. (S1S023) was uniquely sensitive to 1 mM Zn. The majority of pathogen strains maintained tolerance to Zn, Cu, Cr, and Pb at 3 mM, displayed tolerance to Cr and Pb at 5 mM, and were partially tolerant to 5 mM Cu. Notably, several pathogens strains (Coliforms S1S026, S2S032, S3S039 and E. coli S3S038) demonstrated extreme tolerance to 10 mM Cr, and the Coliforms S3S039 strain tolerated 10 mM Pb. Additionally, two strains; S1S027 (Vibrio spp.) and S2S033 (Klebsiella spp.) displayed tolerance to 1 mM Cd, while all remaining pathogen isolates were susceptible to Cd (S3 Table).

Antibiotic resistance test of bacteria isolated from Fijian bivalves and sediments

Bacterial resistance profiles across various antibiotics concentrations were evaluated (S4-S6 Table). The aerobic bacterial strains Leclercia adecarboxylata S1ST003 and Pseudomonas nitroreducens S1ST004 exhibited complete resistance to all tested concentrations of rifampicin, vancomycin, and penicillin. Similarly, strain S3ST019 demonstrated resistance across all tested concentrations of rifampicin, penicillin, streptomycin, and tetracycline. Strains S1ST003, S1ST004, S3ST015, and S3ST019 displayed multidrug resistant (MDR) phenotypes at various antibiotic concentrations, even though most aerobic isolates were susceptible to penicillin, streptomycin, and tetracycline.

Among the human pathogens, most strains exhibited resistance to rifampicin, penicillin, and vancomycin at 100 µg/L, as well as to streptomycin and tetracycline at the same concentration. However, variation was observed with streptomycin: three pathogen strains were resistant at 100 µg/l, several were partially resistant at 75 µg/l, and the remaining strains were only resistant at 25 µg/l. For tetracycline, only four strains maintained resistance at 100 µg/l, while the others displayed resistance at lower thresholds (75, 50, and 25 µg/l) or were entirely susceptible. Thermotolerant E. coli showed robust resistance to rifampicin, penicillin, and streptomycin at all tested concentrations. Overall, most human pathogenic strains displayed multidrug resistant activities at various concentrations across multiple antibiotics.

In summary, the majority of aerobic bacteria isolated from soft tissues remained susceptible to broad-spectrum antibiotic such as rifampicin, vancomycin, streptomycin, and tetracycline, suggesting these as viable treatment options. In contrast, many of human pathogens resisted these broad-spectrum agents; while they were universally resistant to rifampicin and vancomycin, they retained susceptibility to streptomycin and tetracycline. Finally, the narrow-spectrum antibiotic penicillin was ineffective against the tested human pathogens (S4 Table).

Compared to soft tissue isolates, gill-associated bacteria showed greater antibiotic resistance. Most aerobic strains resisted up to 100 μg/L of vancomycin, penicillin, and streptomycin, while displaying resistance thresholds at 25, 50, or 75 µg/l for rifampicin and streptomycin. Strains S1G005, S2G007, S2G008, S3G013, S3G014, S3G016, and S3G019, exhibited multidrug resistant (MDR) phenotypes at various antibiotic concentrations. Similarly, human pathogens isolated from the gills demonstrated widespread resistance to rifampicin, vancomycin, and penicillin at 100 µg/l, whereas their resistance thresholds for streptomycin and tetracycline varied among 25, 50, or 75 µg/l. The majority of these pathogens resisted at least four antibiotics, with Coliform strain S3G033 exhibiting complete resistance to all tested concentrations of all antibiotics. Overall, the human pathogen strains showed more robust multidrug resistant profiles against various antibiotics than the aerobic bacterial strains (S5 Table).

Aerobic bacteria isolated river sediments demonstrated lower overall resistance to broad-spectrum antibiotics such as rifampicin, vancomycin, streptomycin, and tetracycline. Furthermore, only a minority of these strains exhibited resistance to the narrow-spectrum antibiotic penicillin. A notable exception was S3S018 strain, which displayed complete resistance to vancomycin, penicillin, streptomycin, and tetracycline across all tested concentrations. Along with S3S018, strains S1S001 and S2S016 displayed distinct multidrug resistance (MDR) phenotypes at various antibiotic concentrations. In contrast, human pathogens from the sediments exhibited higher resistance profiles for rifampicin, vancomycin, and penicillin. While the majority of these pathogenic strains remained susceptible to streptomycin and tetracycline, a small subset displayed resistance to both agents. Overall, most human pathogen strains demonstrated robust multidrug resistance activities across different antibiotic classes (S6 Table). Conclusively, sediment-derived aerobic bacteria were predominantly susceptible to the tested antibiotics, whereas the human pathogens showed significantly greater resistance.

Numerous bacterial strains isolated from soft tissues, gills, and sediments exhibited multidrug resistance (MDR) phenotypes across the tested matrices (Table 5). Specifically, seven strains from soft tissues, comprising two aerobic isolates and five human pathogens, demonstrated pan-resistance to all five antibiotics (rifampicin, vancomycin, penicillin, streptomycin, and tetracycline). Similarly, seven gill-associated strains exhibited resistance to all five agents, which included three aerobic strains and four human pathogens. Within the sediment samples, eight strains demonstrated complete resistance across all five antibiotic classes, consisting of two aerobic isolates and six human pathogens.

Table 5. Antibiotic resistant bacterial strains from fijian bivalves and sediments. Highlighted strains are resistant to all five antibiotics. S1 – Site 1, S2 – Site 2, S3 – Site 3.

Antibiotics used in this study	Antibiotic’s mode of action on bacteria	Resistant strains isolated from this study
Antibiotics used in this study	Antibiotic’s mode of action on bacteria	Soft Tissues	Gills	Sediments
Rifampicin	Inhibition of RNA synthesis	S1ST003, S1ST004, S3ST015, S3ST018, S3ST019, S1ST022, S1ST023, S1ST024, S1ST025, S2ST026, S2ST027, S2ST028, S2ST029, S3ST030, S3ST032, S3ST033, S3ST034, S3ST036, S3ST039, S3ST041, S1ST046, S2ST047, S3ST048	S1G003,S1G005, S2G007,S2G008, S2G009,S3G013. S3G014,S3G018, S3G019,S1G022, S1G024,S2G026, S2G027,S2G028, S3G029,S3G030, S3G031,S3G032, S3G033,S1G034, S2G035, S3G036	S2S016,S3S018, S1S022,S1S023, S1S024,S1S026, S1S027,S2S029, S2S031,S2S032, S2S033,S3S036, S3S037,S3S038, S3S039,S1S042, S2S043, S3S044
Vancomycin	Inhibition of cell wall synthesis	S1ST003, S1ST004, S3ST015, S3ST018, S3ST021, S1ST022, S1ST023, S1ST024, S1ST025, S2ST026, S2ST027, S2ST028, S2ST029, S3ST030, S3ST032, S3ST033, S3ST034, S3ST036, S3ST037, S3ST039, S3ST041, S1ST046, S2ST047, S3ST048	S1G001,S1G002, S1G005,S2G007, S2G008,S2G009, S3G012,S3G013, S3G014,S3G016, S3G018,S3G019, S3G020,S1G022, S1G024,S1G025, S2G026,S2G027, S2G028,S3G029, S3G030,S3G031, S3G032,S3G033, S1G034,S2G035, S3G036	S1S005,S1S006, S2S016,S3S018, S3S019,S1S022, S1S023,S1S024, S1S026,S1S027, S1S028,S2S029, S2S031,S2S032, S2S033,S2S034, S3S035,S3S036, S3S037,S3S038, S3S039,S1S042, S2S043, S3S044
Penicillin	Inhibition of cell wall synthesis	S1ST003,S1ST004, S2ST006,S3ST018, S3ST019,S1ST022, S1ST023,S1ST024, S1ST025,S2ST026, S2ST027,S2ST028, S2ST029,S3ST030, S3ST031,S3ST032, S3ST033,S3ST034, S3ST035,S3ST036, S3ST038,S3ST039, S3ST040,S3ST041, S1ST046,S2ST047, S3ST048	S1G005,S2G007, S2G008,S2G009, S3G012,S3G013, S3G014,S3G016, S3G020,S1G022, S1G024,S2G026, S2G027,S2G028, S3G029,S3G030, S3G031,S3G032, S3G033,S1G034, S2G035, S3G036	S1S001,S1S002, S1S008,S1S009, S1S010,S1S012, S2S016,S3S018, S3S020,S1S022, S1S023,S1S024, S1S026,S1S027, S1S028,S2S029, S2S031,S2S032, S2S033,S2S034, S3S035,S3S036, S3S037,S3S038, S3S039,S3S040, S1S042,S2S043, S3S044
Streptomycin	Inhibition of protein synthesis	S1ST004,S2ST008, S3ST015,S3ST017, S3ST018,S3ST019, S2ST026,S2ST027, S3ST031,S3ST034, S3ST035,S3ST036, S3ST037,S3ST038, S3ST039,S3ST040, S3ST041,S3ST042, S3ST043,S3ST044, S3ST045,S1ST046, S2ST047, S3ST048	S1G002,S1G003, S1G004,S2G008, S2G009,S3G012, S3G013,S3G014, S3G016,S3G019, S3G020,S1G022, S1G024,S1G025, S2G026,S3G029, S3G030,S3G032, S3G033	S1S003,S2S013, S23015,S2S016, S3S018,S1S022, S1S027,S2S032, S3S036,S3S037, S3S038,S3S039, S3S040
Tetracyclin	Inhibition of protein synthesis	S1ST003,S1ST004, S2ST009,S2ST010, S3ST018,S3ST019, S3ST021,S1ST022, S1ST023,S2ST027, S2ST029,S3ST030, S3ST041,S1ST046, S2ST047, S3ST048	S2G008,S3G012, S3G013,S3G014, S3G016,S3G018, S3G019,S1G022, S2G027,S2G028, S3G029,S3G030, S3G031, S3G033	S1S001,S1S007, S1S010,S1S012, S2S016,S3S018, S1S022,S1S027, S2S031,S2S032, S2S033,S3S036, S3S038, S3S039

Open in a new tab

Discussion

In the Pacific Islands, coastal and freshwater resources support the sustenance and socioeconomic livelihoods of numerous local communities [59,60]. However, anthropogenic disturbances and ecosystem alterations in aquatic environments have increased over the years, potentially elevating environmental contamination. Current understanding of contamination levels and food safety regarding freshwater resources remains limited, particularly concerning pathogenic contaminants, pathogen diversity, and antibiotic and heavy metal resistance. Local communities along the Ba River in Fiji continue to consume and utilize resources from the river for the daily needs [61,62] without prior knowledge of the associated potential health risks. In this study, analysis of Ba River sediments and the bivalve B. violacea revealed that the highest total aerobic bacterial count occurred in sediments, followed by soft tissues and gills. Site 1 was the most heavily polluted by microorganisms. Elevated aerobic bacterial loads in waters and bivalves typically indicate contamination from anthropogenic developments. For instance, Bainivalu [63] noted elevated levels of total aerobic bacteria in water samples collected at the Fiji Sugar Corporation (FSC) sugar mill outfall along Qawa River, Labasa, Fiji, identifying the sugar mill effluent as the source of the high heterotrophic load. This aligns with our findings, where the highest aerobic bacterial count was recorded at Site 1, located behind the Rarawai Sugar Mill. Sugar mill effluent plays a key role in increasing bacterial populations in the aquatic environments as it is rich in organic matter, serving as an ideal nutrient source for bacteria. Additionally, Hatha [64] and Singh [65] attributed prominent aerobic bacterial loads in bivalves from the Suva market, Fiji, to contaminated source waters. Our results, however, showed a much higher aerobic bacterial load in sediments than in the bivalves.

Faecal coliforms are well-documented contaminants in seafood and aquatic environments, and bivalves are known to bioaccumulate these bacteria. Although our study revealed low levels of faecal coliforms in both bivalves and sediments, this finding diverges from previous studies that typically reported higher concentrations [7,66–69]. This discrepancy may be attributed to regular dredging activities within the Ba River [70]. Dredging operations can remove the surface layer of sediments, which typically harbours significantly higher concentrations of faecal coliforms than deeper layers [69]. The removal of this contaminated surface layer may explain the lower faecal coliform levels observed in our study. Conversely, Hatha [64] reported coliform levels in bivalves from the Suva market that were comparable to our findings. Coliform contamination in bivalves has been widely documented across Fiji, Korea, Brazil and Philippines [65,70–72]. While most strains of E. coli are harmless, certain strains cause serious foodborne illnesses, primarily transmitted to humans through the ingestion of contaminated foods, such as raw or undercooked ground meat products, raw milk, and raw vegetables and sprouts [73]. Our results showed that E. coli was present at low concentrations in both bivalve and sediment samples. Notably, however, thermotolerant E. coli was detected in soft tissues and sediments across all sampling sites, likely due to an influx of untreated sewage into the river.

Interestingly, human pathogens were also present in the bivalves and sediments. Vibrio spp. is a bacterial group responsible for most human diseases associated with aquatic environments and seafood consumption, with V. cholerae, V. parahaemolyticus, V. vulnificus and V. alginolyticus being the most common pathogenic species [74]. These bacteria are transmitted to humans through the ingestion of contaminated water or raw and undercooked seafood [75]. Our findings indicated that bivalves from Site 1 and sediments from all three sites contained Vibrio spp. Similarly, previous studies have reported the presence of Vibrio spp. in bivalves and river sediments [64,76,77] demonstrating that Vibrio spp. are persistent in aquatic environments and can accumulate through the food chain.

Faecal Streptococcus, which resides in the intestines of humans and warm-blooded animals [78], was detected in bivalves from all three locations. Site 1 showed a significantly higher concentration, strongly suggesting targeted faecal contamination. Previous works have similarly documented faecal streptococci in bivalves from the River Blackwater Estuary, UK [79] Ashtamudi Lake, India [7], and Izmir Bay, Turkey [80]. Furthermore, major foodborne pathogens such as Salmonella spp. and Shigella spp. were detected in bivalves and sediments across all three sites. Salmonella spp. and Shigella spp. impact millions of people annually, leading to acute gastrointestinal illness [81] characterized by headaches, fever, cough, nausea, vomiting, constipation, abdominal pain, chills, rose spots, bloody and mucoid stools, and diarrhoea [1]. Jeamsripong [82] reported their occurrence in oysters from the Phang Nga Estuary, Thailand, while Collin [83] identified them in clams collected from Maputo Bay, Mozambique. Additionally, Patel and Payne [84] detected these pathogens in sediments from St. John’s Harbour, indicating their potential for ingestion by bivalves residing in contaminated environments.

This study also revealed that Klebsiella spp. exhibited a comparable abundance across all three sampling sites, with bivalves demonstrating significantly higher bacterial loads than the surrounding sediments. Klebsiella spp. are well-documented opportunistic pathogens capable of causing severe human infections, including pneumonia, bacteraemia, wound/surgical site infections, meningitis, and urinary tract infections [85]. The elevated Klebsiella spp. loads in these bivalves suggest localised faecal contamination of the coastal environment. Previous research has confirmed the presence of K. pneumoniae in bivalve mollusks, highlighting its widespread distribution in aquatic environments [85–87]. These findings underscore the potential public health risks associated with consuming contaminated seafood.

Bacteria identification via 16s rRNA gene sequencing revealed a diverse microbial community, including Rhodococcus hoagie, Curtobacterium citreum, Leclercia adecarboxylata, Pseudomonas nitroreducens, Pseudomonas stutzeri, and several Bacillus species (B. toyonensis, B. thuringiensis, B. cereus, B. aryabhattai, and B. pseudomycoides). Other identified species included Microbacterium laevaniformans, M. natoriense, M. paraoxydans, Acinetobacter kookii, Paenibacillus barcinonensis, P. cucumis, Staphylococcus edaphicus, Streptomyces katrae, Rhizobium pusense, Sphingobacterium multivorum, Exiguobacterium profundum, Exiguobacterium indicum, and Fictibacillus enclensis. that the spatial distribution of these was noteworthy: Rhodococcus, Curtobacterium, and Paenibacillus were unique to soft tissues, while Staphylococcus, Streptomyces, Rhizobium, and Sphingobacterium were found exclusively in the gills. Exigubacterium and Fictibacillus were restricted to sediments. Conversely, Leclercia, Pseudomonas, Microbacteria, and Acinetobacter were present in both soft tissues and gills, whereas Bacillus was ubiquitous across all samples. Interestingly, existing literature has not yet confirmed the presence of several of these specific bacteria in bivalves. Of the 23 identified species, six are known human pathogens, eight are multidrug-resistant (MRD), nine are novel species, and four have applications in agriculture, livestock, or aquaculture. These finding mirror research by Rout [88], who identified Pseudomonadota, Actinomycetota, Bacteroidota, and Bacillota as the dominant phyla in the Ganges River. The presence of these pathogens in the Ba River suggests significant anthropogenic contamination, likely stemming from human and animal faecal matter, household effluents, and agriculture or industrial runoff. Consequently, local populations consuming resources from the Ba River face unquantified health risks.

The sequencing results further reinforce the evidence of anthropogenic impact, particularly through the prevalence of MDR bacteria. In this study, 15 strains; seven from tissues/gills and eight from sediments; exhibited resistance to all five tested antibiotics. Notably, several human pathogens, including Shigella spp., Vibrio spp., thermotolerant E. coli, Salmonella spp., faecal Streptococcus, and Enterococcus spp., displayed MDR properties. These findings align with previous studies on mussels and mollusks where resistance to streptomycin, vancomycin, and tetracycline was documented [89,90]. The presence of MDR bacteria in bivalves and sediments is a serious public concern, as it facilitates the spread of antibiotic-resistance genes (ARGs) within the aquatic ecosystem as Rout [91] and Rout [92] reported, the distribution of ARGs is non-uniform and influenced by a complex interplay of environmental conditions and local antibiotic usage.

Natural detoxification is essential for regulating heavy metal concentrations in aquatic environments. Heavy metal-tolerant bacteria can persist in contaminated sites and may play a vital role in bioremediation [93–96]. This study that while most isolates tolerated Cu and Pb up to 1 mM and Cr up to 3 mM, tolerance to Zn was generally limited. A notable exception was strain S3ST41 (Vibrio spp.), which tolerated all tested Zn concentrations. While most isolates were susceptible to Cd, strains S1S027 (Vibrio spp.) and S2S033 (Klebsiella spp.), exhibited tolerance to 1 mM. Interestingly, gill-associated bacteria displayed higher tolerance to Cr and Pb, while human pathogens showed a broader range of resistance, surviving elevated concentrations of multiple metals.

To mitigate health risks, consumers should ensure bivalves are through cooked and avoid raw consumption. Implementing depuration systems, such as the closed circulatory sand biofilter demonstrated by Singh [65] and Singh [97], can effectively reduce bacterial loads to safe levels. Given the projected rise in antibiotic resistance, exploring alternative treatments is critical. Fijian ethnomedicine and traditional herbal remedies represent a promising frontier for novel antimicrobial chemical entities [98,99]. Furthermore, future studies should investigate seasonal variations to better understand how environmental changes influence contamination patterns.

Conclusion

This study highlights that Site 1, located behind the Rarawai sugar mill, is heavily contaminated. The microbial load was highest in soft tissues, followed by sediments, and gills. The presence of pathogens such as Vibrio spp., faecal Streptococcus, and thermotolerant E. coli is particularly concerning.. Furthermore, human pathogens exhibited significantly higher tolerance to both heavy metals and antibiotics than aerobic bacteria. While their metal tolerance suggests potential bioremediation, their MDR status poses a severe challenge for clinical treatment. Therefore, stringent depuration and high temperature cooking are essential to ensure the safety of bivalves harvested from these waters.

Supporting information

S1 Table. Heavy Metal Tolerance of Bacteria from Soft Tissues.

(DOCX)

pone.0359203.s001.docx^{(51KB, docx)}

S2 Table. Heavy Metal Tolerance of Bacteria from Gills.

(DOCX)

pone.0359203.s002.docx^{(46.3KB, docx)}

S3 Table. Heavy Metal Tolerance of Bacteria from Sediments.

(DOCX)

pone.0359203.s003.docx^{(47.6KB, docx)}

S4 Table. Antibiotic Resistance Test of Bacteria from Soft Tissues.

(DOCX)

pone.0359203.s004.docx^{(48.8KB, docx)}

S5 Table. Antibiotic Resistant Test of Bacteria from Gills.

(DOCX)

pone.0359203.s005.docx^{(45.3KB, docx)}

S6 Table. Antibiotic Resistant Test of Bacteria from Sediments.

(DOCX)

pone.0359203.s006.docx^{(46.6KB, docx)}

Acknowledgments

The authors would like to express their sincere gratitude to the technical and support staff of the Biology, Chemistry, and Marine Studies sections at the University of the South Pacific, including Dinesh Kumar, Shelvin Prasad, Siva Padayachi, Timaima Waqainabete, Thomas Tunidau, and Laura Williams. Special thanks are also extended to Darshana Lal and Nirma Nadan for their invaluable laboratory assistance and consistent motivation.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was funded as a research project by the University of the South Pacific. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Lee R, Lovatelli A, Ababouch L. Bivalve depuration: fundamental and practical aspects. 511. FAO. 2008. [Google Scholar]
2.Lin L, Yang H, Xu X. Effects of water pollution on human health and disease heterogeneity: A review. Front Environ Sci. 2022;10. doi: 10.3389/fenvs.2022.880246 [DOI] [Google Scholar]
3.Li Q, Zhu K, Liu L, Sun X. Pollution-induced food safety problem in China: Trends and policies. Frontiers in Nutrition. 2021;8. doi: 10.3389/fnut.2021.703832 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Behera BK, Patra B, Chakraborty HJ, Rout AK, Dixit S, Rai A, et al. Bacteriophages diversity in India’s major river Ganga: a repository to regulate pathogenic bacteria in the aquatic environment. Environ Sci Pollut Res Int. 2023;30(12):34101–14. doi: 10.1007/s11356-022-24637-7 [DOI] [PubMed] [Google Scholar]
5.Mitra S, Chakraborty AJ, Tareq AM, Emran TB, Nainu F, Khusro A, et al. Impact of heavy metals on the environment and human health: Novel therapeutic insights to counter the toxicity. Journal of King Saud University - Science. 2022;34(3):101865. doi: 10.1016/j.jksus.2022.101865 [DOI] [Google Scholar]
6.Gerba CP. Assessment of enteric pathogen shedding by bathers during recreational activity and its impact on water quality. Quantitative Microbiology. 2000;2(1):55–68. doi: 10.1023/a:1010000230103 [DOI] [Google Scholar]
7.Chinnadurai S, Mohamed KS, Sharma J, Venkatesan V, Kripa V. Assessment of bio-accumulation of bacteria in oysters from shellfish growing waters in Ashtamudi Lake (Kerala, India): A RAMSAR wetland. Regional Studies in Marine Science. 2016;7:118–22. doi: 10.1016/j.rsma.2016.05.016 [DOI] [Google Scholar]
8.Kelechi OJ, Nnawuike AJ, Kelechi IS, Emmanuel EJ, Odinaka NP. Assessment of microbial load in water and sediments of rivers Otamiri and Nworie in Owerri, South Eastern Nigeria. IJPR. 2021;:27–39. doi: 10.9734/ijpr/2021/v6i330163 [DOI] [Google Scholar]
9.Gyawali P, Hewitt J. Faecal contamination in bivalve molluscan shellfish: Can the application of the microbial source tracking method minimise public health risks?. Current Opinion in Environmental Science & Health. 2020;16:14–21. doi: 10.1016/j.coesh.2020.02.005 [DOI] [Google Scholar]
10.Gradoville MR, Crump BC, Häse CC, White AE. Environmental controls of oyster-pathogenic Vibrio spp. in Oregon estuaries and a shellfish hatchery. Appl Environ Microbiol. 2018;84(9). doi: 10.1128/AEM.02156-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Singh AA, Maharaj A, Singh A, Bi F, Dutt V, Padayachi SBR, et al. Bacterial and parasitic contamination in blood cockles (Anadara antiquata Linnaeus, 1758), and effect of depuration on bacterial load using simple bio-filter in closed circulatory system. IFRJ. 2025;32(1):216–25. doi: 10.47836/ifrj.32.1.16 [DOI] [Google Scholar]
12.Akhtar N, Syakir Ishak MI, Bhawani SA, Umar K. Various natural and anthropogenic factors responsible for water quality degradation: A review. Water. 2021;13(19):2660. doi: 10.3390/w13192660 [DOI] [Google Scholar]
13.Zhou L, Appiah R, Boadi EB, Ayamba EC, Larnyo E, Antwi HA. The impact of human activities on river pollution and health-related quality of life: Evidence from Ghana. Sustainability. 2022;14(20):13120. doi: 10.3390/su142013120 [DOI] [Google Scholar]
14.Zafar S, Aqil F, Ahmad I. Metal tolerance and biosorption potential of filamentous fungi isolated from metal contaminated agricultural soil. Bioresour Technol. 2007;98(13):2557–61. doi: 10.1016/j.biortech.2006.09.051 [DOI] [PubMed] [Google Scholar]
15.Paul D. Research on heavy metal pollution of river Ganga: A review. Annals of Agrarian Science. 2017;15(2):278–86. doi: 10.1016/j.aasci.2017.04.001 [DOI] [Google Scholar]
16.Boboria D, Maata M, Mani FS. Metal pollution in sediments and bivalves in Marovo Lagoon, Solomon Islands. Mar Pollut Bull. 2021;164:112026. doi: 10.1016/j.marpolbul.2021.112026 [DOI] [PubMed] [Google Scholar]
17.El Nemr A, El-Said GF, Ragab S, Khaled A, El-Sikaily A. The distribution, contamination and risk assessment of heavy metals in sediment and shellfish from the Red Sea coast, Egypt. Chemosphere. 2016;165:369–80. doi: 10.1016/j.chemosphere.2016.09.048 [DOI] [PubMed] [Google Scholar]
18.Staley C, Johnson D, Gould TJ, Wang P, Phillips J, Cotner JB, et al. Frequencies of heavy metal resistance are associated with land cover type in the Upper Mississippi River. Sci Total Environ. 2015;511:461–8. doi: 10.1016/j.scitotenv.2014.12.069 [DOI] [PubMed] [Google Scholar]
19.Das BK, Behera BK, Chakraborty HJ, Paria P, Gangopadhyay A, Rout AK, et al. Metagenomic study focusing on antibiotic resistance genes from the sediments of River Yamuna. Gene. 2020;758:144951. doi: 10.1016/j.gene.2020.144951 [DOI] [PubMed] [Google Scholar]
20.Stepanauskas R, Glenn TC, Jagoe CH, Tuckfield RC, Lindell AH, McArthur JV. Elevated microbial tolerance to metals and antibiotics in metal-contaminated industrial environments. Environ Sci Technol. 2005;39(10):3671–8. doi: 10.1021/es048468f [DOI] [PubMed] [Google Scholar]
21.Zhao Y, Cocerva T, Cox S, Tardif S, Su J-Q, Zhu Y-G, et al. Evidence for co-selection of antibiotic resistance genes and mobile genetic elements in metal polluted urban soils. Sci Total Environ. 2019;656:512–20. doi: 10.1016/j.scitotenv.2018.11.372 [DOI] [PubMed] [Google Scholar]
22.Gillieatt BF, Coleman NV. Unravelling the mechanisms of antibiotic and heavy metal resistance co-selection in environmental bacteria. FEMS Microbiol Rev. 2024;48(4):fuae017. doi: 10.1093/femsre/fuae017 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Yulianto B, Oetari PS, Februhardi S, Putranto TWC, Soegianto A. Heavy metals (Cd, Pb, Cu, Zn) concentrations in edible bivalves harvested from Northern Coast of Central Java, Indonesia. In: IOP Conference Series: Earth and Environmental Science, 2019. 012005. 10.1088/1755-1315/259/1/012005 [DOI]
24.Ledua E, Matoto SV, Sesewa A, Korovulavula J. Freshwater clam resource assessment of the Ba River, BPD, 5. Suva: South Pacific Commission. 1996. [Google Scholar]
25.Department of Fisheries. Department of Fisheries Annual Report. Suva, Fiji: Department of Fisheries, Ministry of Agriculture, Fisheries and Forestry. 2005. [Google Scholar]
26.Anderson E, Cakausese N, Fagan LL. Effects of multiple resource use of water quality in the Ba River and estuary, Fiji. South Pacific Journal of Natural Science. 1999;18:60–7. [Google Scholar]
27.Tripathi BM, Song W, Slik JWF, Sukri RS, Jaafar S, Dong K, et al. Distinctive tropical forest variants have unique soil microbial communities, but not always low microbial diversity. Frontiers in Microbiology. 2016;7. doi: 10.3389/fmicb.2016.00376 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Smith A, Hussey M. American Society for Microbiology: Gram Stain Protocols. www.asmscience.org. 2020.
29.Sparling GP, West AW. A direct extraction method to estimate soil microbial C: calibration in situ using microbial respiration and 14C labelled cells. Soil Biology and Biochemistry. 1988;20(3):337–43. doi: 10.1016/0038-0717(88)90014-4 [DOI] [Google Scholar]
30.Pipite A, Siro G, Subramani R, Srinivasan S. Microbiological analysis, antimicrobial activity, heavy-metals content and physico-chemical properties of Fijian mud pool samples. Sci Total Environ. 2023;854:158725. doi: 10.1016/j.scitotenv.2022.158725 [DOI] [PubMed] [Google Scholar]
31.Walsh C. Antibiotics: actions, origins, resistance. 1st ed. ASM Press: American Society for Microbiology (ASM). 2003. [Google Scholar]
32.R Core Team. R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing. 2023. [Google Scholar]
33.FDA. Fish and Fisheries Products Hazards and Controls Guidance. USA: Department of Health and Human Services. 2001. [Google Scholar]
34.Katz DS. The streak plate protocol. Microbe Library. 2016;:1–14. [Google Scholar]
35.Pal M, Rahman MT. Rhodococcus equi: An emerging zoonotic pathogen. AVAS Ann Veterin Animal Sci. 2004;2:3–10. [Google Scholar]
36.von Bargen K, Haas A. Molecular and infection biology of the horse pathogen Rhodococcus equi. FEMS Microbiol Rev. 2009;33(5):870–91. doi: 10.1111/j.1574-6976.2009.00181.x [DOI] [PubMed] [Google Scholar]
37.Bourles A, Guentas L, Chalkiadakis E, Majorel C, Juillot F, Cavaloc Y, et al. New Caledonian ultramafic conditions structure the features of Curtobacterium citreum strains that play a role in plant adaptation. Can J Microbiol. 2019;65(12):880–94. doi: 10.1139/cjm-2019-0283 [DOI] [PubMed] [Google Scholar]
38.Matsuura H, Sugiyama S. Sepsis and Leclercia adecarboxylata. QJM: Int J Med. 2018;111(10):733–4. doi: 10.1093/qjmed/hcy131 [DOI] [PubMed] [Google Scholar]
39.Patel DD, Bhaskaran L. Study on paraffin wax degrading ability of Pseudomonas nitroreducens isolated from oil wells of Gujarat, India. Petroleum Sci Technol. 2018;36(8):583–90. doi: 10.1080/10916466.2018.1437634 [DOI] [Google Scholar]
40.Jiménez G, Urdiain M, Cifuentes A, López-López A, Blanch AR, Tamames J, et al. Description of Bacillus toyonensis sp. nov., a novel species of the Bacillus cereus group, and pairwise genome comparisons of the species of the group by means of ANI calculations. Syst Appl Microbiol. 2013;36(6):383–91. doi: 10.1016/j.syapm.2013.04.008 [DOI] [PubMed] [Google Scholar]
41.Brown SD, Palumbo AV, Panikov N, Ariyawansa T, Klingeman DM, Johnson CM, et al. Draft genome sequence for Microbacterium laevaniformans strain OR221, a bacterium tolerant to metals, nitrate, and low pH. J Bacteriol. 2012;194(12):3279–80. doi: 10.1128/JB.00474-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Choi JY, Ko G, Jheong W, Huys G, Seifert H, Dijkshoorn L, et al. Acinetobacter kookii sp. nov., isolated from soil. Int J Syst Evol Microbiol. 2013;63(Pt 12):4402–6. doi: 10.1099/ijs.0.047969-0 [DOI] [PubMed] [Google Scholar]
43.Sánchez MM, Fritze D, Blanco A, Spröer C, Tindall BJ, Schumann P, et al. Paenibacillus barcinonensis sp. nov., a xylanase-producing bacterium isolated from a rice field in the Ebro River delta. Int J Syst Evol Microbiol. 2005;55(Pt 2):935–9. doi: 10.1099/ijs.0.63383-0 [DOI] [PubMed] [Google Scholar]
44.Liu J, Nakayama T, Hemmi H, Asano Y, Tsuruoka N, Shimomura K, et al. Microbacterium natoriense sp. nov., a novel D-aminoacylase-producing bacterium isolated from soil in Natori, Japan. Int J Syst Evol Microbiol. 2005;55(Pt 2):661–5. doi: 10.1099/ijs.0.63265-0 [DOI] [PubMed] [Google Scholar]
45.Pantůček R, Sedláček I, Indráková A, Vrbovská V, Mašlaňová I, Kovařovic V, et al. Staphylococcus edaphicus sp. nov., isolated in Antarctica, harbors the mecC gene and genomic islands with a suspected role in adaptation to extreme environments. Appl Environ Microbiol. 2018;84(2). doi: 10.1128/AEM.01746-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Nonthakaew N, Panbangred W, Songnuan W, Intra B. Plant growth-promoting properties of Streptomyces spp. isolates and their impact on mung bean plantlets’ rhizosphere microbiome. Front Microbiol. 2022;13:967415. doi: 10.3389/fmicb.2022.967415 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Ahn J-H, Kim B, Kim B-Y, Kim S-J, Song J, Kwon S-W, et al. Paenibacillus cucumis sp. nov. isolated from greenhouse soil. J Microbiol. 2014;52(6):460–4. doi: 10.1007/s12275-014-4071-7 [DOI] [PubMed] [Google Scholar]
48.Aujoulat F, Marchandin H, Zorgniotti I, Masnou A, Jumas-Bilak E. Rhizobium pusense is the main human pathogen in the genus Agrobacterium/Rhizobium. Clinical Microbiol Infection. 2015;21(5):472.e1-472.e5. doi: 10.1016/j.cmi.2014.12.005 [DOI] [PubMed] [Google Scholar]
49.Bautista JR, Teves FG. Antibiotic susceptibility testing of isolated Bacillus thuringiensis from three soil types around Iligan City, Philippines. African J Microbiol Res. 2013;7(8):678–82. doi: 10.5897/AJMR12.2153 [DOI] [Google Scholar]
50.Barahona F, Slim J. Sphingobacterium multivorum: Case report and literature review. New Microbes and New Infections. 2015;7:33–6. doi: 10.1016/j.nmni.2015.04.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Soto-Rodriguez SA, Cabanillas-Ramos J, Alcaraz U, Gomez-Gil B, Romalde JL. Identification and virulence of Aeromonas dhakensis, Pseudomonas mosselii and Microbacterium paraoxydans isolated from Nile tilapia, Oreochromis niloticus, cultivated in Mexico. J Appl Microbiol. 2013;115(3):654–62. doi: 10.1111/jam.12280 [DOI] [PubMed] [Google Scholar]
52.Shawish R, Tarabees R. Prevalence and antimicrobial resistance of Bacillus cereus isolated from beef products in Egypt. Open Vet J. 2017;7(4):337–41. doi: 10.4314/ovj.v7i4.9 [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Crapart S, Fardeau M-L, Cayol J-L, Thomas P, Sery C, Ollivier B, et al. Exiguobacterium profundum sp. nov., a moderately thermophilic, lactic acid-producing bacterium isolated from a deep-sea hydrothermal vent. Int J Syst Evol Microbiol. 2007;57(Pt 2):287–92. doi: 10.1099/ijs.0.64639-0 [DOI] [PubMed] [Google Scholar]
54.Chaturvedi P, Shivaji S. Exiguobacterium indicum sp. nov., a psychrophilic bacterium from the Hamta glacier of the Himalayan mountain ranges of India. Int J Syst Evol Microbiol. 2006;56(Pt 12):2765–70. doi: 10.1099/ijs.0.64508-0 [DOI] [PubMed] [Google Scholar]
55.Xu H, Gao J, Portieles R, Du L, Gao X, Borras-Hidalgo O. Endophytic bacterium Bacillus aryabhattai induces novel transcriptomic changes to stimulate plant growth. PLoS One. 2022;17(8):e0272500. doi: 10.1371/journal.pone.0272500 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Nakamura LK. Bacillus pseudomycoides sp. nov. Int J Syst Bacteriol. 1998;48 Pt 3:1031–5. doi: 10.1099/00207713-48-3-1031 [DOI] [PubMed] [Google Scholar]
57.Park SW, Back JH, Lee SW, Song JH, Shin CH, Kim GE, et al. Successful antibiotic treatment of Pseudomonas stutzeri-induced peritonitis without peritoneal dialysis catheter removal in continuous ambulatory peritoneal dialysis. Kidney Res Clin Pract. 2013;32(2):81–3. doi: 10.1016/j.krcp.2013.04.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Dastager SG, Mawlankar R, Srinivasan K, Tang S-K, Lee J-C, Ramana VV, et al. Fictibacillus enclensis sp. nov., isolated from marine sediment. Antonie Van Leeuwenhoek. 2014;105(3):461–9. doi: 10.1007/s10482-013-0097-9 [DOI] [PubMed] [Google Scholar]
59.Bell JD, Kronen M, Vunisea A, Nash WJ, Keeble G, Demmke A, et al. Planning the use of fish for food security in the Pacific. Marine Policy. 2009;33(1):64–76. doi: 10.1016/j.marpol.2008.04.002 [DOI] [Google Scholar]
60.Gillett RD. Tuna: a key economic resource in the Pacific Islands. Asian Development Bank and the Forum Fisheries Agency. 2001. [Google Scholar]
61.Nawai J, Gusyev MA, Hasegawa A, Takeuchi K, Nawai J, Gusyev MA. Flood and drought assessment with dam infrastructure: A case study of the Ba River basin, Fiji. In: MODSIM2015, 21st International Congress on Modelling and Simulation, 2015.
62.Yila O, Weber E, Neef A. The role of social capital in post-flood response and recovery among downstream communities of the Ba River, Western Viti Levu, Fiji Islands. Risks and conflicts: Local responses to natural disasters. Emerald Group Publishing Limited. 2013. p. 79–107. 10.1108/S2040-7262(2013)0000014010 [DOI] [Google Scholar]
63.Bainivalu A. The microbial profiling of the Qawa River using molecular methods. Suva: The University of the South Pacific. 2016. [Google Scholar]
64.Hatha AAM, Christi KS, Singh R, Kumar S. Bacteriology of the fresh water bivalve clam Batissa violacea (Kai) sold in the Suva market. The South Pacific Journal of Natural and Applied Sciences. 2005;23(1):48–50. doi: 10.1071/sp05009 [DOI] [Google Scholar]
65.Singh AA, Ram R, Kumar SV, Aashna S, Verma S, Naaz ZT, et al. Depuration of a Freshwater Clam (Batissa Violacea) from Rewa River in Fiji Using a Bio-Filter Set-Up in Closed and Open Water Circulatory System. Nova Biotechnol Chim. 2021;:e824. doi: 10.36547/nbc.824 [DOI] [Google Scholar]
66.Chinnadurai S, Mohamed KS, Venkatesan V, Sharma J, Kripa V. Depuration of bacterial populations in the Indian backwater oyster Crassostrea madrasensis (Preston, 1916): effects on surface and bottom held oysters. Journal of Shellfish Research. 2014;33(2):409–14. doi: 10.2983/035.033.0209 [DOI] [Google Scholar]
67.Hassan F, Geethalakshmi V, Jeeva JC, Babu MR. Combined effect of lime (Citrus aurantitolia) and drying on reducing bacteria of public health significance in Edible Oyster (Crassostrea madrasensis). J Food Sci Technol. 2013;50(1):203–7. doi: 10.1007/s13197-011-0550-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Wheeler Alm E, Burke J, Spain A. Fecal indicator bacteria are abundant in wet sand at freshwater beaches. Water Res. 2003;37(16):3978–82. doi: 10.1016/S0043-1354(03)00301-4 [DOI] [PubMed] [Google Scholar]
69.Ferguson CM, Coote BG, Ashbolt NJ, Stevenson IM. Relationships between indicators, pathogens and water quality in an estuarine system. Water Research. 1996;30(9):2045–54. doi: 10.1016/0043-1354(96)00079-6 [DOI] [Google Scholar]
70.Pachepsky YA, Guber AK, Shelton DR, McCarty GW. Size distributions of manure particles released under simulated rainfall. J Environ Manage. 2009;90(3):1365–9. doi: 10.1016/j.jenvman.2008.08.001 [DOI] [PubMed] [Google Scholar]
71.Lima-Filho JV, Interaminense JA, Batista JE, Vaz RV, Ventura RF, Oliveira IB, et al. Coliform risk assessment through use of the clam Anomalocardia brasiliana as animal sentinel for shellfish harvesting areas in Brazil’s northeast. J Food Sci Technol. 2015;52(8):5364–9. doi: 10.1007/s13197-015-1744-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Bougeard M, Le Saux J-C, Pérenne N, Baffaut C, Robin M, Pommepuy M. Modeling of Escherichia coli Fluxes on a Catchment and the Impact on Coastal Water and Shellfish Quality1. JAWRA Journal of the American Water Resources Association. 2011;47(2):350–66. doi: 10.1111/j.1752-1688.2010.00520.x [DOI] [Google Scholar]
73.Tenaillon O, Skurnik D, Picard B, Denamur E. The population genetics of commensal Escherichia coli. Nat Rev Microbiol. 2010;8(3):207–17. doi: 10.1038/nrmicro2298 [DOI] [PubMed] [Google Scholar]
74.Baker-Austin C, Oliver JD, Alam M, Ali A, Waldor MK, Qadri F. Vibrio spp. infections. Nature Reviews Disease Primers. 2018;4(1):1–19. doi: 10.1038/s41572-018-0005-8 [DOI] [PubMed] [Google Scholar]
75.Altekruse SF, Bishop RD, Baldy LM, Thompson SG, Wilson SA, Ray BJ, et al. Vibrio gastroenteritis in the US Gulf of Mexico region: the role of raw oysters. Epidemiol Infect. 2000;124(3):489–95. doi: 10.1017/s0950268899003714 [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Mok JS, Ryu A, Kwon JY, Kim B, Park K. Distribution of Vibrio species isolated from bivalves and bivalve culture environments along the Gyeongnam coast in Korea: Virulence and antimicrobial resistance of Vibrio parahaemolyticus isolates. Food Control. 2019;106:106697. doi: 10.1016/j.foodcont.2019.06.023 [DOI] [Google Scholar]
77.Abia ALK, Ubomba-Jaswa E, Momba MNB. Riverbed Sediments as Reservoirs of Multiple Vibrio cholerae Virulence-Associated Genes: A Potential Trigger for Cholera Outbreaks in Developing Countries. J Environ Public Health. 2017;2017:5646480. doi: 10.1155/2017/5646480 [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Chhatwal GS, Graham R. Streptococcal Diseases. In: International Encyclopedia of Public Health. Elsevier; 2017. p. 87–97. 10.1016/B978-0-12-803678-5.00434-3 [DOI] [Google Scholar]
79.Florini S, Shahsavari E, Ngo T, Aburto-Medina A, Smith DJ, Ball AS. Factors Influencing the Concentration of Fecal Coliforms in Oysters in the River Blackwater Estuary, UK. Water. 2020;12(4):1086. doi: 10.3390/w12041086 [DOI] [Google Scholar]
80.Kucuksezgin F, Kacar A, Kucuksezgin G, Uluturhan E. Monitoring metal contamination levels and fecal pollution in clam (Tapes decussatus) collected from Izmir Bay (Turkey). Environ Monit Assess. 2010;162(1–4):407–15. doi: 10.1007/s10661-009-0805-0 [DOI] [PubMed] [Google Scholar]
81.WHO. A report about food safety. 2026. https://www.who.int/news-room/fact-sheets/detail/food-safety
82.Jeamsripong S, Chuanchuen R, Atwill ER. Assessment of Bacterial Accumulation and Environmental Factors in Sentinel Oysters and Estuarine Water Quality from the Phang Nga Estuary Area in Thailand. Int J Environ Res Public Health. 2018;15(9):1970. doi: 10.3390/ijerph15091970 [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Collin B, Rehnstam-Holm AS, Hernroth B. Faecal contaminants in edible bivalves from Maputo Bay, Mozambique: seasonal distribution, pathogenesis and antibiotic resistance. The Open Nutrition Journal. 2008;2(1):86–93. doi: 10.2174/1874288200802010086 [DOI] [Google Scholar]
84.Patel TR, Payne J. Microbiological analysis of sediment and water – column samples from St. John’s harbour and antibiotic resistance of the isolates. St. John’s Harbour: ACAP Inc. 2004. [Google Scholar]
85.Barati A, Ghaderpour A, Chew LL, Bong CW, Thong KL, Chong VC, et al. Isolation and Characterization of Aquatic-Borne Klebsiella pneumoniae from Tropical Estuaries in Malaysia. Int J Environ Res Public Health. 2016;13(4):426. doi: 10.3390/ijerph13040426 [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Håkonsholm F, Hetland MAK, Svanevik CS, Sundsfjord A, Lunestad BT, Marathe NP. Antibiotic Sensitivity Screening of Klebsiella spp. and Raoultella spp. Isolated from Marine Bivalve Molluscs Reveal Presence of CTX-M-Producing K. pneumoniae. Microorganisms. 2020;8(12):1909. doi: 10.3390/microorganisms8121909 [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Grevskott DH, Svanevik CS, Wester AL, Lunestad BT. The species accuracy of the Most Probable Number (MPN) European Union reference method for enumeration of Escherichia coli in marine bivalves. J Microbiol Methods. 2016;131:73–7. doi: 10.1016/j.mimet.2016.10.006 [DOI] [PubMed] [Google Scholar]
88.Rout AK, Dixit S, Tripathy PS, Rout SS, Parida SN, Parida PK, et al. Metagenomic landscape of sediments of river Ganga reveals microbial diversity, potential plastic and xenobiotic degradation enzymes. J Hazard Mater. 2024;471:134377. doi: 10.1016/j.jhazmat.2024.134377 [DOI] [PubMed] [Google Scholar]
89.Bighiu MA, Norman Haldén A, Goedkoop W, Ottoson J. Assessing microbial contamination and antibiotic resistant bacteria using zebra mussels (Dreissena polymorpha). Sci Total Environ. 2019;650(Pt 2):2141–9. doi: 10.1016/j.scitotenv.2018.09.314 [DOI] [PubMed] [Google Scholar]
90.Grevskott DH, Svanevik CS, Sunde M, Wester AL, Lunestad BT. Marine bivalve mollusks as possible indicators of multidrug-resistant Escherichia coli and other species of the Enterobacteriaceae family. Frontiers in Microbiology. 2017. doi: 10.3389/fmicb.2017.00024 [DOI] [PMC free article] [PubMed] [Google Scholar]
91.Rout AK, Tripathy PS, Dixit S, Behera DU, Behera B, Das BK. Unveiling the microbiome landscape: A metagenomic study of bacterial diversity, antibiotic resistance, and virulence factors in the sediments of the River Ganga, India. Antibiotics. 2023;12(12):1735. doi: 10.3390/antibiotics12121735 [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Rout AK, Rout SS, Panda A, Tripathy PS, Kumar N, Parida SN, et al. Potential applications and future prospects of metagenomics in aquatic ecosystems. Gene. 2025;967:149720. doi: 10.1016/j.gene.2025.149720 [DOI] [PubMed] [Google Scholar]
93.Gillard B, Chatzievangelou D, Thomsen L, Ullrich MS. Heavy-metal-resistant microorganisms in deep-sea sediments disturbed by mining activity: An application toward the development of experimental in vitro systems. Front Mar Sci. 2019;6. doi: 10.3389/fmars.2019.00462 [DOI] [Google Scholar]
94.Afzal AM, Rasool MH, Waseem M, Aslam B. Assessment of heavy metal tolerance and biosorptive potential of Klebsiella variicola isolated from industrial effluents. AMB Express. 2017;7(1):184. doi: 10.1186/s13568-017-0482-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
95.Mustapha MU, Halimoon N. Screening and isolation of heavy metal tolerant bacteria in industrial effluent. Procedia Environmental Sciences. 2015;30:33–7. doi: 10.1016/j.proenv.2015.10.006 [DOI] [Google Scholar]
96.Gupta K, Chatterjee C, Gupta B. Isolation and characterization of heavy metal tolerant Gram-positive bacteria with bioremedial properties from municipal waste rich soil of Kestopur canal (Kolkata), West Bengal, India. Biologia. 2012;67(5):827–36. doi: 10.2478/s11756-012-0099-5 [DOI] [Google Scholar]
97.Singh AA, Mani S, Singh V, Prasad P, Kumar JA, Padayachi SBR, et al. Depuration Investigation on Parasites and Bacterial Loads in Freshwater Clam (Batissa violacea) and Oyster (Crassostrea gigas) Using a Sand Filter and UV Radiation. J Food Sci. 2026;91(8):e71396. doi: 10.1111/1750-3841.71396 [DOI] [PMC free article] [PubMed] [Google Scholar]
98.Naaz Z, Raj K, Singh K, Lata S, Singh A. Evaluating antimicrobial activity and total phenolic content of commonly used herbs and spices in Fiji. AJHNM. 2021;33(3). doi: 10.33235/ajhnm.33.3.108-117 [DOI] [Google Scholar]
99.Singh AA, Naaz ZT, Rakaseta E, Perera M, Singh V, Cheung W, et al. Antimicrobial activity of selected plant extracts against common food borne pathogenic bacteria. Food and Humanity. 2023;1:64–70. doi: 10.1016/j.foohum.2023.04.002 [DOI] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0359203.r001

Decision Letter 0

Md Rajib Sharker

31 Mar 2026

PONE-D-26-07821

Antibiotic-Resistant Pathogens and Heavy Metal-Tolerant Bacteria in Batissa violacea: A Study from the Ba River, Fiji

PLOS One

Dear Dr. Singh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The manuscript is well organized and written. I strongly encourage authors to address the concerned issues of this manuscript. The manuscript need major amendments before publication.

Please submit your revised manuscript by May 14 2026 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

As the corresponding author, your ORCID iD is verified in the submission system and will appear in the published article. PLOS supports the use of ORCID, and we encourage all coauthors to register for an ORCID iD and use it as well. Please encourage your coauthors to verify their ORCID iD within the submission system before final acceptance, as unverified ORCID iDs will not appear in the published article. Only the individual author can complete the verification step; PLOS staff cannot verify ORCID iDs on behalf of authors.

We look forward to receiving your revised manuscript.

Kind regards,

Md Rajib Sharker, Ph.D.

Academic Editor

PLOS One

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. "In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why.

3. Thank you for stating the following financial disclosure:

"This work was funded as a research project by the University of the South Pacific."

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

4. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

(1) You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

(2) If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

5. If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

Additional Editor Comments :

The manuscript is well organized and written. Also, the study objective is worth for publication. I strongly encourage authors to address the concerned issues of this manuscript. The manuscript need major amendments before publication.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #1: No

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #1: Yes

Reviewer #2: Yes

**********

Reviewer #1: The research addresses an important public health issue linking antibiotic resistance and heavy metal tolerance in aquatic environments. The manuscript is well-structured and provides comprehensive experimental approaches (MPN, culture, antibiotic testing, 16S rRNA). However, the manuscript requires clarification, deeper analysis, and improved scientific clarity before publication. The authors should consider the following points before finalizing the manuscript.

1. The study is relevant, but the novelty is not clearly mentioned. Authors should highlight how this work differs from previous studies in similar aquatic systems.

2. The sample size justification and replication strategy are insufficient. Include a sampling map with clearer labeling of sampling sites. The limitations of the study (e.g., culturable bacteria only) should be mentioned in the discussion section of the article.

3. The antibiotic susceptibility method (agar dilution) should be justified against standard methods (e.g., CLSI guidelines).

4. Results are mostly descriptive; quantitative comparisons and statistical interpretation should be required.

5. Figures and tables need clear labeling, units, and improved readability.

6. The authors should develop phylogenetic trees and a deeper discussion of microbial diversity is necessary.

7. The claim of multidrug resistance (MDR) needs a clearer definition (e.g., ≥3 antibiotic classes).

8. Results should be compared with regional/global AMR trends.

9. The ecological relevance of tested concentrations (1–10 mM) should be justified.

10. Discuss possible co-selection mechanisms between ARGs and MRGs more critically.

11. Several typographical errors need correction.

12. Standardize terms (e.g., Vibrio spp., E. coli, formatting inconsistencies).

13. Improve figure captions for better understanding.

Reviewer #2: The manuscript addresses an important topic; however, it requires substantial revision in terms of experimental clarity, statistical rigor, and interpretation of results. The current version is largely descriptive and lacks strong mechanistic insights.

Insufficient information on experimental protocols, sequencing depth, and data processing.

Statistical methods are not well described.

Lack of clarity on assumptions, replicates, and validation of results.

Conclusions are overstated relative to the data.

Weak correlations are interpreted as strong relationships.

Kindly insert the latest references and remove old references.

Kindly describe more in the discussion and introduction.

Cite a few important papers in the discussion and introduction, PMID: 40789383, 36508095, 38663298, 32683080, 38136769, 33178147, 5750913

Minor Concerns

Improve figure quality and legends.

Correct grammatical and typographical errors.

In the manuscript, some gaps/unnecessary spaces are present. Kindly correct them.

**********

what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #1: Yes: Dr. Sukumar Saha

Reviewer #2: Yes: Dr. Ajaya Kumar Rout

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

To ensure your figures meet our technical requirements, please review our figure guidelines: https://journals.plos.org/plosone/s/figures

You may also use PLOS’s free figure tool, NAAS, to help you prepare publication quality figures: https://journals.plos.org/plosone/s/figures#loc-tools-for-figure-preparation.

NAAS will assess whether your figures meet our technical requirements by comparing each figure against our figure specifications.

PLoS One. 2026 Sep 25;21(9):e0359203. doi: 10.1371/journal.pone.0359203.r002

Author response to Decision Letter 1

25 Aug 2026

A file bas been uploaded that shows details of responses to review comments.

Attachment

Submitted filename: Response to Reviewers.docx

pone.0359203.s007.docx^{(22.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0359203.r003

Decision Letter 1

Md Rajib Sharker

10 Sep 2026

Antibiotic-Resistant Pathogens and Heavy Metal-Tolerant Bacteria in Batissa violacea: A Study from the Ba River, Fiji

PONE-D-26-07821R1

Dear Dr. Singh

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact billing support.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Md Rajib Sharker, Ph.D.

Academic Editor

PLOS One

Additional Editor Comments (optional):

Authors properly address the all concerned issues. Hence, this manuscript can be accepted

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0359203.r004

Acceptance letter

Md Rajib Sharker

PONE-D-26-07821R1

PLOS One

Dear Dr. Singh,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS One. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

You will receive an invoice from PLOS for your publication fee after your manuscript has reached the completed accept phase. If you receive an email requesting payment before acceptance or for any other service, this may be a phishing scheme. Learn how to identify phishing emails and protect your accounts at https://explore.plos.org/phishing.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS One and supporting open access.

Kind regards,

PLOS One Editorial Office Staff

on behalf of

Dr. Md Rajib Sharker

Academic Editor

PLOS One

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Heavy Metal Tolerance of Bacteria from Soft Tissues.

(DOCX)

pone.0359203.s001.docx^{(51KB, docx)}

S2 Table. Heavy Metal Tolerance of Bacteria from Gills.

(DOCX)

pone.0359203.s002.docx^{(46.3KB, docx)}

S3 Table. Heavy Metal Tolerance of Bacteria from Sediments.

(DOCX)

pone.0359203.s003.docx^{(47.6KB, docx)}

S4 Table. Antibiotic Resistance Test of Bacteria from Soft Tissues.

(DOCX)

pone.0359203.s004.docx^{(48.8KB, docx)}

S5 Table. Antibiotic Resistant Test of Bacteria from Gills.

(DOCX)

pone.0359203.s005.docx^{(45.3KB, docx)}

S6 Table. Antibiotic Resistant Test of Bacteria from Sediments.

(DOCX)

pone.0359203.s006.docx^{(46.6KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0359203.s007.docx^{(22.5KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0359203.ref001] 1.Lee R, Lovatelli A, Ababouch L. Bivalve depuration: fundamental and practical aspects. 511. FAO. 2008. [Google Scholar]

[pone.0359203.ref002] 2.Lin L, Yang H, Xu X. Effects of water pollution on human health and disease heterogeneity: A review. Front Environ Sci. 2022;10. doi: 10.3389/fenvs.2022.880246 [DOI] [Google Scholar]

[pone.0359203.ref003] 3.Li Q, Zhu K, Liu L, Sun X. Pollution-induced food safety problem in China: Trends and policies. Frontiers in Nutrition. 2021;8. doi: 10.3389/fnut.2021.703832 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref004] 4.Behera BK, Patra B, Chakraborty HJ, Rout AK, Dixit S, Rai A, et al. Bacteriophages diversity in India’s major river Ganga: a repository to regulate pathogenic bacteria in the aquatic environment. Environ Sci Pollut Res Int. 2023;30(12):34101–14. doi: 10.1007/s11356-022-24637-7 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref005] 5.Mitra S, Chakraborty AJ, Tareq AM, Emran TB, Nainu F, Khusro A, et al. Impact of heavy metals on the environment and human health: Novel therapeutic insights to counter the toxicity. Journal of King Saud University - Science. 2022;34(3):101865. doi: 10.1016/j.jksus.2022.101865 [DOI] [Google Scholar]

[pone.0359203.ref006] 6.Gerba CP. Assessment of enteric pathogen shedding by bathers during recreational activity and its impact on water quality. Quantitative Microbiology. 2000;2(1):55–68. doi: 10.1023/a:1010000230103 [DOI] [Google Scholar]

[pone.0359203.ref007] 7.Chinnadurai S, Mohamed KS, Sharma J, Venkatesan V, Kripa V. Assessment of bio-accumulation of bacteria in oysters from shellfish growing waters in Ashtamudi Lake (Kerala, India): A RAMSAR wetland. Regional Studies in Marine Science. 2016;7:118–22. doi: 10.1016/j.rsma.2016.05.016 [DOI] [Google Scholar]

[pone.0359203.ref008] 8.Kelechi OJ, Nnawuike AJ, Kelechi IS, Emmanuel EJ, Odinaka NP. Assessment of microbial load in water and sediments of rivers Otamiri and Nworie in Owerri, South Eastern Nigeria. IJPR. 2021;:27–39. doi: 10.9734/ijpr/2021/v6i330163 [DOI] [Google Scholar]

[pone.0359203.ref009] 9.Gyawali P, Hewitt J. Faecal contamination in bivalve molluscan shellfish: Can the application of the microbial source tracking method minimise public health risks?. Current Opinion in Environmental Science & Health. 2020;16:14–21. doi: 10.1016/j.coesh.2020.02.005 [DOI] [Google Scholar]

[pone.0359203.ref010] 10.Gradoville MR, Crump BC, Häse CC, White AE. Environmental controls of oyster-pathogenic Vibrio spp. in Oregon estuaries and a shellfish hatchery. Appl Environ Microbiol. 2018;84(9). doi: 10.1128/AEM.02156-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref011] 11.Singh AA, Maharaj A, Singh A, Bi F, Dutt V, Padayachi SBR, et al. Bacterial and parasitic contamination in blood cockles (Anadara antiquata Linnaeus, 1758), and effect of depuration on bacterial load using simple bio-filter in closed circulatory system. IFRJ. 2025;32(1):216–25. doi: 10.47836/ifrj.32.1.16 [DOI] [Google Scholar]

[pone.0359203.ref012] 12.Akhtar N, Syakir Ishak MI, Bhawani SA, Umar K. Various natural and anthropogenic factors responsible for water quality degradation: A review. Water. 2021;13(19):2660. doi: 10.3390/w13192660 [DOI] [Google Scholar]

[pone.0359203.ref013] 13.Zhou L, Appiah R, Boadi EB, Ayamba EC, Larnyo E, Antwi HA. The impact of human activities on river pollution and health-related quality of life: Evidence from Ghana. Sustainability. 2022;14(20):13120. doi: 10.3390/su142013120 [DOI] [Google Scholar]

[pone.0359203.ref014] 14.Zafar S, Aqil F, Ahmad I. Metal tolerance and biosorption potential of filamentous fungi isolated from metal contaminated agricultural soil. Bioresour Technol. 2007;98(13):2557–61. doi: 10.1016/j.biortech.2006.09.051 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref015] 15.Paul D. Research on heavy metal pollution of river Ganga: A review. Annals of Agrarian Science. 2017;15(2):278–86. doi: 10.1016/j.aasci.2017.04.001 [DOI] [Google Scholar]

[pone.0359203.ref016] 16.Boboria D, Maata M, Mani FS. Metal pollution in sediments and bivalves in Marovo Lagoon, Solomon Islands. Mar Pollut Bull. 2021;164:112026. doi: 10.1016/j.marpolbul.2021.112026 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref017] 17.El Nemr A, El-Said GF, Ragab S, Khaled A, El-Sikaily A. The distribution, contamination and risk assessment of heavy metals in sediment and shellfish from the Red Sea coast, Egypt. Chemosphere. 2016;165:369–80. doi: 10.1016/j.chemosphere.2016.09.048 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref018] 18.Staley C, Johnson D, Gould TJ, Wang P, Phillips J, Cotner JB, et al. Frequencies of heavy metal resistance are associated with land cover type in the Upper Mississippi River. Sci Total Environ. 2015;511:461–8. doi: 10.1016/j.scitotenv.2014.12.069 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref019] 19.Das BK, Behera BK, Chakraborty HJ, Paria P, Gangopadhyay A, Rout AK, et al. Metagenomic study focusing on antibiotic resistance genes from the sediments of River Yamuna. Gene. 2020;758:144951. doi: 10.1016/j.gene.2020.144951 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref020] 20.Stepanauskas R, Glenn TC, Jagoe CH, Tuckfield RC, Lindell AH, McArthur JV. Elevated microbial tolerance to metals and antibiotics in metal-contaminated industrial environments. Environ Sci Technol. 2005;39(10):3671–8. doi: 10.1021/es048468f [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref021] 21.Zhao Y, Cocerva T, Cox S, Tardif S, Su J-Q, Zhu Y-G, et al. Evidence for co-selection of antibiotic resistance genes and mobile genetic elements in metal polluted urban soils. Sci Total Environ. 2019;656:512–20. doi: 10.1016/j.scitotenv.2018.11.372 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref022] 22.Gillieatt BF, Coleman NV. Unravelling the mechanisms of antibiotic and heavy metal resistance co-selection in environmental bacteria. FEMS Microbiol Rev. 2024;48(4):fuae017. doi: 10.1093/femsre/fuae017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref023] 23.Yulianto B, Oetari PS, Februhardi S, Putranto TWC, Soegianto A. Heavy metals (Cd, Pb, Cu, Zn) concentrations in edible bivalves harvested from Northern Coast of Central Java, Indonesia. In: IOP Conference Series: Earth and Environmental Science, 2019. 012005. 10.1088/1755-1315/259/1/012005 [DOI]

[pone.0359203.ref024] 24.Ledua E, Matoto SV, Sesewa A, Korovulavula J. Freshwater clam resource assessment of the Ba River, BPD, 5. Suva: South Pacific Commission. 1996. [Google Scholar]

[pone.0359203.ref025] 25.Department of Fisheries. Department of Fisheries Annual Report. Suva, Fiji: Department of Fisheries, Ministry of Agriculture, Fisheries and Forestry. 2005. [Google Scholar]

[pone.0359203.ref026] 26.Anderson E, Cakausese N, Fagan LL. Effects of multiple resource use of water quality in the Ba River and estuary, Fiji. South Pacific Journal of Natural Science. 1999;18:60–7. [Google Scholar]

[pone.0359203.ref027] 27.Tripathi BM, Song W, Slik JWF, Sukri RS, Jaafar S, Dong K, et al. Distinctive tropical forest variants have unique soil microbial communities, but not always low microbial diversity. Frontiers in Microbiology. 2016;7. doi: 10.3389/fmicb.2016.00376 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref028] 28.Smith A, Hussey M. American Society for Microbiology: Gram Stain Protocols. www.asmscience.org. 2020.

[pone.0359203.ref029] 29.Sparling GP, West AW. A direct extraction method to estimate soil microbial C: calibration in situ using microbial respiration and 14C labelled cells. Soil Biology and Biochemistry. 1988;20(3):337–43. doi: 10.1016/0038-0717(88)90014-4 [DOI] [Google Scholar]

[pone.0359203.ref030] 30.Pipite A, Siro G, Subramani R, Srinivasan S. Microbiological analysis, antimicrobial activity, heavy-metals content and physico-chemical properties of Fijian mud pool samples. Sci Total Environ. 2023;854:158725. doi: 10.1016/j.scitotenv.2022.158725 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref031] 31.Walsh C. Antibiotics: actions, origins, resistance. 1st ed. ASM Press: American Society for Microbiology (ASM). 2003. [Google Scholar]

[pone.0359203.ref032] 32.R Core Team. R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing. 2023. [Google Scholar]

[pone.0359203.ref033] 33.FDA. Fish and Fisheries Products Hazards and Controls Guidance. USA: Department of Health and Human Services. 2001. [Google Scholar]

[pone.0359203.ref034] 34.Katz DS. The streak plate protocol. Microbe Library. 2016;:1–14. [Google Scholar]

[pone.0359203.ref035] 35.Pal M, Rahman MT. Rhodococcus equi: An emerging zoonotic pathogen. AVAS Ann Veterin Animal Sci. 2004;2:3–10. [Google Scholar]

[pone.0359203.ref036] 36.von Bargen K, Haas A. Molecular and infection biology of the horse pathogen Rhodococcus equi. FEMS Microbiol Rev. 2009;33(5):870–91. doi: 10.1111/j.1574-6976.2009.00181.x [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref037] 37.Bourles A, Guentas L, Chalkiadakis E, Majorel C, Juillot F, Cavaloc Y, et al. New Caledonian ultramafic conditions structure the features of Curtobacterium citreum strains that play a role in plant adaptation. Can J Microbiol. 2019;65(12):880–94. doi: 10.1139/cjm-2019-0283 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref038] 38.Matsuura H, Sugiyama S. Sepsis and Leclercia adecarboxylata. QJM: Int J Med. 2018;111(10):733–4. doi: 10.1093/qjmed/hcy131 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref039] 39.Patel DD, Bhaskaran L. Study on paraffin wax degrading ability of Pseudomonas nitroreducens isolated from oil wells of Gujarat, India. Petroleum Sci Technol. 2018;36(8):583–90. doi: 10.1080/10916466.2018.1437634 [DOI] [Google Scholar]

[pone.0359203.ref040] 40.Jiménez G, Urdiain M, Cifuentes A, López-López A, Blanch AR, Tamames J, et al. Description of Bacillus toyonensis sp. nov., a novel species of the Bacillus cereus group, and pairwise genome comparisons of the species of the group by means of ANI calculations. Syst Appl Microbiol. 2013;36(6):383–91. doi: 10.1016/j.syapm.2013.04.008 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref041] 41.Brown SD, Palumbo AV, Panikov N, Ariyawansa T, Klingeman DM, Johnson CM, et al. Draft genome sequence for Microbacterium laevaniformans strain OR221, a bacterium tolerant to metals, nitrate, and low pH. J Bacteriol. 2012;194(12):3279–80. doi: 10.1128/JB.00474-12 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref042] 42.Choi JY, Ko G, Jheong W, Huys G, Seifert H, Dijkshoorn L, et al. Acinetobacter kookii sp. nov., isolated from soil. Int J Syst Evol Microbiol. 2013;63(Pt 12):4402–6. doi: 10.1099/ijs.0.047969-0 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref043] 43.Sánchez MM, Fritze D, Blanco A, Spröer C, Tindall BJ, Schumann P, et al. Paenibacillus barcinonensis sp. nov., a xylanase-producing bacterium isolated from a rice field in the Ebro River delta. Int J Syst Evol Microbiol. 2005;55(Pt 2):935–9. doi: 10.1099/ijs.0.63383-0 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref044] 44.Liu J, Nakayama T, Hemmi H, Asano Y, Tsuruoka N, Shimomura K, et al. Microbacterium natoriense sp. nov., a novel D-aminoacylase-producing bacterium isolated from soil in Natori, Japan. Int J Syst Evol Microbiol. 2005;55(Pt 2):661–5. doi: 10.1099/ijs.0.63265-0 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref045] 45.Pantůček R, Sedláček I, Indráková A, Vrbovská V, Mašlaňová I, Kovařovic V, et al. Staphylococcus edaphicus sp. nov., isolated in Antarctica, harbors the mecC gene and genomic islands with a suspected role in adaptation to extreme environments. Appl Environ Microbiol. 2018;84(2). doi: 10.1128/AEM.01746-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref046] 46.Nonthakaew N, Panbangred W, Songnuan W, Intra B. Plant growth-promoting properties of Streptomyces spp. isolates and their impact on mung bean plantlets’ rhizosphere microbiome. Front Microbiol. 2022;13:967415. doi: 10.3389/fmicb.2022.967415 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref047] 47.Ahn J-H, Kim B, Kim B-Y, Kim S-J, Song J, Kwon S-W, et al. Paenibacillus cucumis sp. nov. isolated from greenhouse soil. J Microbiol. 2014;52(6):460–4. doi: 10.1007/s12275-014-4071-7 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref048] 48.Aujoulat F, Marchandin H, Zorgniotti I, Masnou A, Jumas-Bilak E. Rhizobium pusense is the main human pathogen in the genus Agrobacterium/Rhizobium. Clinical Microbiol Infection. 2015;21(5):472.e1-472.e5. doi: 10.1016/j.cmi.2014.12.005 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref049] 49.Bautista JR, Teves FG. Antibiotic susceptibility testing of isolated Bacillus thuringiensis from three soil types around Iligan City, Philippines. African J Microbiol Res. 2013;7(8):678–82. doi: 10.5897/AJMR12.2153 [DOI] [Google Scholar]

[pone.0359203.ref050] 50.Barahona F, Slim J. Sphingobacterium multivorum: Case report and literature review. New Microbes and New Infections. 2015;7:33–6. doi: 10.1016/j.nmni.2015.04.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref051] 51.Soto-Rodriguez SA, Cabanillas-Ramos J, Alcaraz U, Gomez-Gil B, Romalde JL. Identification and virulence of Aeromonas dhakensis, Pseudomonas mosselii and Microbacterium paraoxydans isolated from Nile tilapia, Oreochromis niloticus, cultivated in Mexico. J Appl Microbiol. 2013;115(3):654–62. doi: 10.1111/jam.12280 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref052] 52.Shawish R, Tarabees R. Prevalence and antimicrobial resistance of Bacillus cereus isolated from beef products in Egypt. Open Vet J. 2017;7(4):337–41. doi: 10.4314/ovj.v7i4.9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref053] 53.Crapart S, Fardeau M-L, Cayol J-L, Thomas P, Sery C, Ollivier B, et al. Exiguobacterium profundum sp. nov., a moderately thermophilic, lactic acid-producing bacterium isolated from a deep-sea hydrothermal vent. Int J Syst Evol Microbiol. 2007;57(Pt 2):287–92. doi: 10.1099/ijs.0.64639-0 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref054] 54.Chaturvedi P, Shivaji S. Exiguobacterium indicum sp. nov., a psychrophilic bacterium from the Hamta glacier of the Himalayan mountain ranges of India. Int J Syst Evol Microbiol. 2006;56(Pt 12):2765–70. doi: 10.1099/ijs.0.64508-0 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref055] 55.Xu H, Gao J, Portieles R, Du L, Gao X, Borras-Hidalgo O. Endophytic bacterium Bacillus aryabhattai induces novel transcriptomic changes to stimulate plant growth. PLoS One. 2022;17(8):e0272500. doi: 10.1371/journal.pone.0272500 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref056] 56.Nakamura LK. Bacillus pseudomycoides sp. nov. Int J Syst Bacteriol. 1998;48 Pt 3:1031–5. doi: 10.1099/00207713-48-3-1031 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref057] 57.Park SW, Back JH, Lee SW, Song JH, Shin CH, Kim GE, et al. Successful antibiotic treatment of Pseudomonas stutzeri-induced peritonitis without peritoneal dialysis catheter removal in continuous ambulatory peritoneal dialysis. Kidney Res Clin Pract. 2013;32(2):81–3. doi: 10.1016/j.krcp.2013.04.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref058] 58.Dastager SG, Mawlankar R, Srinivasan K, Tang S-K, Lee J-C, Ramana VV, et al. Fictibacillus enclensis sp. nov., isolated from marine sediment. Antonie Van Leeuwenhoek. 2014;105(3):461–9. doi: 10.1007/s10482-013-0097-9 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref059] 59.Bell JD, Kronen M, Vunisea A, Nash WJ, Keeble G, Demmke A, et al. Planning the use of fish for food security in the Pacific. Marine Policy. 2009;33(1):64–76. doi: 10.1016/j.marpol.2008.04.002 [DOI] [Google Scholar]

[pone.0359203.ref060] 60.Gillett RD. Tuna: a key economic resource in the Pacific Islands. Asian Development Bank and the Forum Fisheries Agency. 2001. [Google Scholar]

[pone.0359203.ref061] 61.Nawai J, Gusyev MA, Hasegawa A, Takeuchi K, Nawai J, Gusyev MA. Flood and drought assessment with dam infrastructure: A case study of the Ba River basin, Fiji. In: MODSIM2015, 21st International Congress on Modelling and Simulation, 2015.

[pone.0359203.ref062] 62.Yila O, Weber E, Neef A. The role of social capital in post-flood response and recovery among downstream communities of the Ba River, Western Viti Levu, Fiji Islands. Risks and conflicts: Local responses to natural disasters. Emerald Group Publishing Limited. 2013. p. 79–107. 10.1108/S2040-7262(2013)0000014010 [DOI] [Google Scholar]

[pone.0359203.ref063] 63.Bainivalu A. The microbial profiling of the Qawa River using molecular methods. Suva: The University of the South Pacific. 2016. [Google Scholar]

[pone.0359203.ref064] 64.Hatha AAM, Christi KS, Singh R, Kumar S. Bacteriology of the fresh water bivalve clam Batissa violacea (Kai) sold in the Suva market. The South Pacific Journal of Natural and Applied Sciences. 2005;23(1):48–50. doi: 10.1071/sp05009 [DOI] [Google Scholar]

[pone.0359203.ref065] 65.Singh AA, Ram R, Kumar SV, Aashna S, Verma S, Naaz ZT, et al. Depuration of a Freshwater Clam (Batissa Violacea) from Rewa River in Fiji Using a Bio-Filter Set-Up in Closed and Open Water Circulatory System. Nova Biotechnol Chim. 2021;:e824. doi: 10.36547/nbc.824 [DOI] [Google Scholar]

[pone.0359203.ref066] 66.Chinnadurai S, Mohamed KS, Venkatesan V, Sharma J, Kripa V. Depuration of bacterial populations in the Indian backwater oyster Crassostrea madrasensis (Preston, 1916): effects on surface and bottom held oysters. Journal of Shellfish Research. 2014;33(2):409–14. doi: 10.2983/035.033.0209 [DOI] [Google Scholar]

[pone.0359203.ref067] 67.Hassan F, Geethalakshmi V, Jeeva JC, Babu MR. Combined effect of lime (Citrus aurantitolia) and drying on reducing bacteria of public health significance in Edible Oyster (Crassostrea madrasensis). J Food Sci Technol. 2013;50(1):203–7. doi: 10.1007/s13197-011-0550-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref068] 68.Wheeler Alm E, Burke J, Spain A. Fecal indicator bacteria are abundant in wet sand at freshwater beaches. Water Res. 2003;37(16):3978–82. doi: 10.1016/S0043-1354(03)00301-4 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref069] 69.Ferguson CM, Coote BG, Ashbolt NJ, Stevenson IM. Relationships between indicators, pathogens and water quality in an estuarine system. Water Research. 1996;30(9):2045–54. doi: 10.1016/0043-1354(96)00079-6 [DOI] [Google Scholar]

[pone.0359203.ref070] 70.Pachepsky YA, Guber AK, Shelton DR, McCarty GW. Size distributions of manure particles released under simulated rainfall. J Environ Manage. 2009;90(3):1365–9. doi: 10.1016/j.jenvman.2008.08.001 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref071] 71.Lima-Filho JV, Interaminense JA, Batista JE, Vaz RV, Ventura RF, Oliveira IB, et al. Coliform risk assessment through use of the clam Anomalocardia brasiliana as animal sentinel for shellfish harvesting areas in Brazil’s northeast. J Food Sci Technol. 2015;52(8):5364–9. doi: 10.1007/s13197-015-1744-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref072] 72.Bougeard M, Le Saux J-C, Pérenne N, Baffaut C, Robin M, Pommepuy M. Modeling of Escherichia coli Fluxes on a Catchment and the Impact on Coastal Water and Shellfish Quality1. JAWRA Journal of the American Water Resources Association. 2011;47(2):350–66. doi: 10.1111/j.1752-1688.2010.00520.x [DOI] [Google Scholar]

[pone.0359203.ref073] 73.Tenaillon O, Skurnik D, Picard B, Denamur E. The population genetics of commensal Escherichia coli. Nat Rev Microbiol. 2010;8(3):207–17. doi: 10.1038/nrmicro2298 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref074] 74.Baker-Austin C, Oliver JD, Alam M, Ali A, Waldor MK, Qadri F. Vibrio spp. infections. Nature Reviews Disease Primers. 2018;4(1):1–19. doi: 10.1038/s41572-018-0005-8 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref075] 75.Altekruse SF, Bishop RD, Baldy LM, Thompson SG, Wilson SA, Ray BJ, et al. Vibrio gastroenteritis in the US Gulf of Mexico region: the role of raw oysters. Epidemiol Infect. 2000;124(3):489–95. doi: 10.1017/s0950268899003714 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref076] 76.Mok JS, Ryu A, Kwon JY, Kim B, Park K. Distribution of Vibrio species isolated from bivalves and bivalve culture environments along the Gyeongnam coast in Korea: Virulence and antimicrobial resistance of Vibrio parahaemolyticus isolates. Food Control. 2019;106:106697. doi: 10.1016/j.foodcont.2019.06.023 [DOI] [Google Scholar]

[pone.0359203.ref077] 77.Abia ALK, Ubomba-Jaswa E, Momba MNB. Riverbed Sediments as Reservoirs of Multiple Vibrio cholerae Virulence-Associated Genes: A Potential Trigger for Cholera Outbreaks in Developing Countries. J Environ Public Health. 2017;2017:5646480. doi: 10.1155/2017/5646480 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref078] 78.Chhatwal GS, Graham R. Streptococcal Diseases. In: International Encyclopedia of Public Health. Elsevier; 2017. p. 87–97. 10.1016/B978-0-12-803678-5.00434-3 [DOI] [Google Scholar]

[pone.0359203.ref079] 79.Florini S, Shahsavari E, Ngo T, Aburto-Medina A, Smith DJ, Ball AS. Factors Influencing the Concentration of Fecal Coliforms in Oysters in the River Blackwater Estuary, UK. Water. 2020;12(4):1086. doi: 10.3390/w12041086 [DOI] [Google Scholar]

[pone.0359203.ref080] 80.Kucuksezgin F, Kacar A, Kucuksezgin G, Uluturhan E. Monitoring metal contamination levels and fecal pollution in clam (Tapes decussatus) collected from Izmir Bay (Turkey). Environ Monit Assess. 2010;162(1–4):407–15. doi: 10.1007/s10661-009-0805-0 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref081] 81.WHO. A report about food safety. 2026. https://www.who.int/news-room/fact-sheets/detail/food-safety

[pone.0359203.ref082] 82.Jeamsripong S, Chuanchuen R, Atwill ER. Assessment of Bacterial Accumulation and Environmental Factors in Sentinel Oysters and Estuarine Water Quality from the Phang Nga Estuary Area in Thailand. Int J Environ Res Public Health. 2018;15(9):1970. doi: 10.3390/ijerph15091970 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref083] 83.Collin B, Rehnstam-Holm AS, Hernroth B. Faecal contaminants in edible bivalves from Maputo Bay, Mozambique: seasonal distribution, pathogenesis and antibiotic resistance. The Open Nutrition Journal. 2008;2(1):86–93. doi: 10.2174/1874288200802010086 [DOI] [Google Scholar]

[pone.0359203.ref084] 84.Patel TR, Payne J. Microbiological analysis of sediment and water – column samples from St. John’s harbour and antibiotic resistance of the isolates. St. John’s Harbour: ACAP Inc. 2004. [Google Scholar]

[pone.0359203.ref085] 85.Barati A, Ghaderpour A, Chew LL, Bong CW, Thong KL, Chong VC, et al. Isolation and Characterization of Aquatic-Borne Klebsiella pneumoniae from Tropical Estuaries in Malaysia. Int J Environ Res Public Health. 2016;13(4):426. doi: 10.3390/ijerph13040426 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref086] 86.Håkonsholm F, Hetland MAK, Svanevik CS, Sundsfjord A, Lunestad BT, Marathe NP. Antibiotic Sensitivity Screening of Klebsiella spp. and Raoultella spp. Isolated from Marine Bivalve Molluscs Reveal Presence of CTX-M-Producing K. pneumoniae. Microorganisms. 2020;8(12):1909. doi: 10.3390/microorganisms8121909 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref087] 87.Grevskott DH, Svanevik CS, Wester AL, Lunestad BT. The species accuracy of the Most Probable Number (MPN) European Union reference method for enumeration of Escherichia coli in marine bivalves. J Microbiol Methods. 2016;131:73–7. doi: 10.1016/j.mimet.2016.10.006 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref088] 88.Rout AK, Dixit S, Tripathy PS, Rout SS, Parida SN, Parida PK, et al. Metagenomic landscape of sediments of river Ganga reveals microbial diversity, potential plastic and xenobiotic degradation enzymes. J Hazard Mater. 2024;471:134377. doi: 10.1016/j.jhazmat.2024.134377 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref089] 89.Bighiu MA, Norman Haldén A, Goedkoop W, Ottoson J. Assessing microbial contamination and antibiotic resistant bacteria using zebra mussels (Dreissena polymorpha). Sci Total Environ. 2019;650(Pt 2):2141–9. doi: 10.1016/j.scitotenv.2018.09.314 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref090] 90.Grevskott DH, Svanevik CS, Sunde M, Wester AL, Lunestad BT. Marine bivalve mollusks as possible indicators of multidrug-resistant Escherichia coli and other species of the Enterobacteriaceae family. Frontiers in Microbiology. 2017. doi: 10.3389/fmicb.2017.00024 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref091] 91.Rout AK, Tripathy PS, Dixit S, Behera DU, Behera B, Das BK. Unveiling the microbiome landscape: A metagenomic study of bacterial diversity, antibiotic resistance, and virulence factors in the sediments of the River Ganga, India. Antibiotics. 2023;12(12):1735. doi: 10.3390/antibiotics12121735 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref092] 92.Rout AK, Rout SS, Panda A, Tripathy PS, Kumar N, Parida SN, et al. Potential applications and future prospects of metagenomics in aquatic ecosystems. Gene. 2025;967:149720. doi: 10.1016/j.gene.2025.149720 [DOI] [PubMed] [Google Scholar]

[pone.0359203.ref093] 93.Gillard B, Chatzievangelou D, Thomsen L, Ullrich MS. Heavy-metal-resistant microorganisms in deep-sea sediments disturbed by mining activity: An application toward the development of experimental in vitro systems. Front Mar Sci. 2019;6. doi: 10.3389/fmars.2019.00462 [DOI] [Google Scholar]

[pone.0359203.ref094] 94.Afzal AM, Rasool MH, Waseem M, Aslam B. Assessment of heavy metal tolerance and biosorptive potential of Klebsiella variicola isolated from industrial effluents. AMB Express. 2017;7(1):184. doi: 10.1186/s13568-017-0482-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref095] 95.Mustapha MU, Halimoon N. Screening and isolation of heavy metal tolerant bacteria in industrial effluent. Procedia Environmental Sciences. 2015;30:33–7. doi: 10.1016/j.proenv.2015.10.006 [DOI] [Google Scholar]

[pone.0359203.ref096] 96.Gupta K, Chatterjee C, Gupta B. Isolation and characterization of heavy metal tolerant Gram-positive bacteria with bioremedial properties from municipal waste rich soil of Kestopur canal (Kolkata), West Bengal, India. Biologia. 2012;67(5):827–36. doi: 10.2478/s11756-012-0099-5 [DOI] [Google Scholar]

[pone.0359203.ref097] 97.Singh AA, Mani S, Singh V, Prasad P, Kumar JA, Padayachi SBR, et al. Depuration Investigation on Parasites and Bacterial Loads in Freshwater Clam (Batissa violacea) and Oyster (Crassostrea gigas) Using a Sand Filter and UV Radiation. J Food Sci. 2026;91(8):e71396. doi: 10.1111/1750-3841.71396 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0359203.ref098] 98.Naaz Z, Raj K, Singh K, Lata S, Singh A. Evaluating antimicrobial activity and total phenolic content of commonly used herbs and spices in Fiji. AJHNM. 2021;33(3). doi: 10.33235/ajhnm.33.3.108-117 [DOI] [Google Scholar]

[pone.0359203.ref099] 99.Singh AA, Naaz ZT, Rakaseta E, Perera M, Singh V, Cheung W, et al. Antimicrobial activity of selected plant extracts against common food borne pathogenic bacteria. Food and Humanity. 2023;1:64–70. doi: 10.1016/j.foohum.2023.04.002 [DOI] [Google Scholar]

PERMALINK

Antibiotic-resistant pathogens and heavy metal-tolerant bacteria in Batissa violacea: A study from the Ba River, Fiji

Divya Darshika Mala

Ashneel Ajay Singh

Ramesh Subramani

Sathiyaraj Srinivasan

Taitusi Taufa

Ashok Kumar

Francis Mani

Roles

Abstract

Importance

Introduction

Materials and methods

Sample collection

Sites.

Table 1. Physiochemical properties and sediment and water samples from different sites and location description. TL – Top left, TR – Top right, C – Center, BL – Bottom left, BR – Bottom right.

Fig 1. Map of sampling sites location for collection of bivalves (Batissa violacea) and sediment samples along the Ba River, situated in the Ba province in the north-eastern section of the main Island of Viti Levu in Fiji.

Sampling.

Bacteriological study

Aerobic bacteria.

Isolation of bacterial pathogens

Coliform count

DNA extraction and 16s rRNA gene PCR sequencing

Heavy metal tolerance test

Antibiotics sensitivity test

Statistical analysis

Results

Fig 2. Total aerobic bacteria load in soft tissues (ST) and gills (G) of bivalves (Batissa violacea) and sediments (S) at different sites along the Ba River in Fiji.

Human pathogenic bacteria

Fig 3. Various human pathogenic bacteria in soft tissues and gills of bivalves (Batissa violacea) and sediments from the three sites.

Enumeration of coliforms using most probable number method

Table 2. Complete MPN test for soft tissues, gills and sediments.

Isolation of selected bacterial strains

Table 3. Human pathogen colonies in soft tissues, gills and sediments of bivalves from different sites.

16S rRNA gene sequencing for aerobic bacteria

Fig 4. Bacteria identified by 16s rRNA gene sequencing of bivalve and sediment samples from different sites along the Ba in Fiji.

Table 4. 16s rRNA bacterial strain description.

Heavy metal tolerance test of bacteria isolated from Fijian bivalves and sediments

Antibiotic resistance test of bacteria isolated from Fijian bivalves and sediments

Table 5. Antibiotic resistant bacterial strains from fijian bivalves and sediments. Highlighted strains are resistant to all five antibiotics. S1 – Site 1, S2 – Site 2, S3 – Site 3.

Discussion

Conclusion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Md Rajib Sharker

Roles

Author response to Decision Letter 1

Decision Letter 1

Md Rajib Sharker

Roles

Acceptance letter

Md Rajib Sharker

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases