Rice bran protein peptide PVLWGVPKG alleviate gastric mucosal damage induced by Helicobacter pylori infection

Abstract

The aim of this study was to investigate the effect of PVLWGVPKG (PV9) on gastric mucosa cell damage induced by Helicobacter pylori infection. PV9 intervention could significantly reduce the number of Helicobacter pylori adhering to GES-1 cells (p <0.05). Molecular docking showed that PV9 and its degraded fragments could bind to Helicobacter pylori adhesins, and hydrogen bonds might be the main driving force. Dot blot assays confirmed the binding between PV9 and adhesins SabA and BabA in vitro. The protective mechanism of PV9 against Helicobacter pylori infection-induced GES-1 damage cells was analyzed. It was found that PV9 could accelerate the clearance of reactive oxygen species, reduce mitochondrial membrane potential, improve cell cycle arrest, and prevent apoptosis. In addition, PV9 can also significantly improve the antioxidant capacity of cells (SOD, GSH-Px, and CAT), reducing the content of pro-inflammatory factors (IL-1β, IL-6, IL-8, IL-18, and TNF-α) and increasing the content of anti-inflammatory factors (IL-10). The results of qRT-PCR showed that PV9 could protect GES-1 cells by regulating the expression of apoptotic factors. Moreover, the TLR4/MyD88/NF-κB signaling pathways may play a significant role in this process. This study provides a new idea for antagonizing Helicobacter pylori infection with active peptide components.

Introduction

Helicobacter pylori (H. pylori) is a spiral-shaped Gram-negative bacterium with a body length of about 2–4 μm, a little aerobic, and harsh growth conditions¹. It is reported that the global infection rate of H. pylori is about 50%, and the infection situation of H. pylori is greatly affected by social and economic development, cultural and educational level, diet culture, ethnic factors, and geographical region. There is a large difference in infection rates between different regions. Almost all infected people will be accompanied by different degrees of gastric diseases, and the continuous colonization of H. pylori in the stomach is the main pathogenic factor leading to chronic gastritis and peptic ulcer, and is also closely associated with the occurrence of gastric cancer and gastric muco-associated lymphoid tissue lymphoma^2,3. As a result, H. pylori has been classified as a Group I carcinogen by the International Agency for Research on Cancer (IARC)⁴. At present, the common methods for clinical eradication of H. pylori are triple therapy using two antibiotics combined with a proton pump or quadruple therapy supplemented with bismuth eradication therapy on the basis of triple therapy⁵. Although eradication treatment is effective, antibiotic resistance to H. pylori is increasing globally⁶. Therefore, finding other ways to antagonize H. pylori infection is crucial.

The blood group antigen-binding adhesin (BabA) and sialic acid-binding adhesin (SabA) carried by H. pylori itself can help it to adhere to GES-1 cells. During the growth of H. pylori, it can encode the production of cytotoxin-associated protein A (CagA) through its own cytotoxin-associated gene pathogenic island (CagPAI) and enter GES-1 cells through the type IV secretion system (T4SS). Another virulence factor produced by H. pylori, vacuolar cytotoxin A (VacA), can induce vacuolation in GES-1 cells upon contact with GES-1 cells^7,8. When the two virulence factors enter GES-1 cells, they trigger the recognition of the immune system in the body, induce the accumulation of ROS in the body, disrupt the mitochondrial function, and cause oxidative stress damage in the body^9,10. At the same time, lipopolysaccharide and virulence factors secreted by H. pylori can induce Toll-like receptor 4 (TLR4) and pathogen-associated molecular pattern receptor (PAMP) on the cell membrane to bind, recognize H. pylori infection, and activate and recruit myeloid differentiation factor 88 (MyD88) in the cells. Nuclear factor-κB (NF-κB) is activated by the activated MyD88 signaling pathway, releasing the active subunit p65 (NF-κB p65)¹¹. Activated NF-κB enters the nucleus from the cytoplasm and mediates the production and release of various inflammatory factors in the nucleus. At the same time, the expression of intracellular anti-apoptotic factors is down-regulated, which interferes with the normal process of the cell cycle and promotes cell apoptosis^12,13.

At present, the study of foodborne active peptides has attracted more and more attention. More and more studies have shown that food-borne active peptides have a variety of physiological regulatory functions^14–16. Our previous study found that rice bran protein hydrolysate prepared under specific conditions can significantly inhibit the adhesion of H. pylori to GES-1 cells, and the single peptide PVLWGVPKG (PV9) was obtained from rice bran protein hydrolysate¹⁷. However, whether PV9 can protect against gastric mucosa damage induced by H. pylori infection remains unclear. The aim of this study was to investigate the effect of active peptide PVLWGVPKG (PV9) on gastric mucosa cell damage induced by Helicobacter pylori infection. Firstly, the anti-adhesion effect of PV9 was analyzed in vitro, and the binding effect between PV9 and adhesin was analyzed by molecular docking technology. A model of H. pylori infection GES-1 cell damage was established, and the protective mechanism of PV9 against H. pylori infection-induced gastric mucosa damage was analyzed from the perspectives of mitochondrial damage, apoptosis, oxidative stress, and inflammation.

Results

PV9 had no effect on the growth of GES-1 cells

Our previous study found that rice bran protein hydrolysate prepared under specific conditions can significantly inhibit the adhesion of H. pylori to GES-1 cells, and the single peptide PVLWGVPKG (PV9) was obtained from rice bran protein hydrolysate¹⁷. However, whether PV9 can protect against gastric mucosa damage induced by H. pylori infection remains unclear. We first determined cell viability, analyzing the effects of different concentrations and times on the growth of GES-1 cells was analyzed by measuring the cell survival rate, so as to determine the optimal concentration range and time of PV9. As shown in Fig. 1, under different treatment times, PV9 from 10 to 100 μg/mL showed no effect on the growth of GES-1 cells, and the cell survival rate showed no significant change. Specifically, PV9 was continuously co-cultured with cells for 24 h, and the cell survival rate at 50 μg/mL reached 105.50 ± 1.81%, indicating a moderate promotion of cell growth. When the concentration was increased to 100 μg/mL, the survival rate was 100.29 ± 1.29%, which remained statistically equivalent to the control group (p > 0.05). Based on the experimental range selected for this study, PV9 does not exert cytotoxic effects on cells. Accordingly, a concentration range of 10-50 µg/mL and an action time of 24 hours were selected as the parameters for subsequent experiments.

Fig. 1. Cell survival rate at different concentrations of rice bran protein peptide PV9 and at different times.

Different lowercase letters represent significantly different (p < 0.05).

Dynamic changes of PV9 in GES-1 cells

Cells secrete a variety of hydrolases during culture, including proteases and peptidases. In this study, after PV9 was added to GES-1 cells, it was necessary to culture for 24 h and then add H. pylori for infection treatment. During the 24 h intervention of the peptide, whether PV9 will degrade and into which components, we do not know. Therefore, LC-MS/MS was used to determine the dynamic change of PV9 in culture medium under different culture time conditions.

As can be seen from Fig. 2H, the content of PV9 in the culture medium gradually decreased with the extension of culture time. Within 0–12 h, the content of PV9 (PVLWGVPKG) had no significant change. When cultured for 24 h, the content of PV9 in the culture medium remained 56.21%. The change of PV9 was further analyzed by mass spectrometry, and partial degradation of PV9 was found. Five peptide components (Fig. 2B–G), including VP, WG, VL, PVL, and WGVP, were detected in the culture medium, indicating that protease and peptidase secreted by GES-1 cells could partially degrade PV9, but the degradation degree was not serious. According to the results of mass spectrometry, PV9 may be degraded into two important parts of PVL and WGVP under the action of enzymes and then further decomposed into VL, WG, and VP. It is worth noting that no KG peptide segment or peptide segment containing KG components was found in the mass spectrometry analysis, and we concluded that it may be completely decomposed into Lys and Gly under the action of enzymes. At the same time, we found mass spectrum peaks of Lys and Gly in the mass spectrometry results, confirming our hypothesis.

Fig. 2. Analysis of the dynamic changes of PV9 in the GES-1 cells.

A: liquid chromatogram, B-G: mass spectrogram, H: analysis of PV9 degradation. Different lowercase letters represent significantly different (p < 0.05).

Quantitative analysis of these components showed that the sum of degraded and non-degraded components was still less than the initial peptide content, indicating that some of the peptide components may be completely absorbed by cells, or some of the degraded small peptide components may be absorbed by cells. These small peptide components, after degradation, may also play a key role in improving the antioxidant capacity of cells and maintaining cell homeostasis. In summary, PV9 showed dynamic changes during the intervention, and the changes of this peptide component may be related to the antagonism of H. pylori infection. After adding H. pylori, complete PV9 in the culture medium can bind to H. pylori, significantly reducing the number of H. pylori attached to the cell surface, which is directly related to the antagonism of PV9 against the cell damage induced by H. pylori infection.

PV9 and its degraded fragments can bind closely to the active center of H. pylori adhesins and inhibit their adhesion

At present, the study of H. pylori surface adhesins is still challenging. The purification of its surface adhesins, such as BabA and SabA, is difficult, costly, and time-consuming. Therefore, no commercially available adhesion proteins have been found. The use of molecular docking technology can effectively help us solve this problem, and through the visualization of molecular docking results, we can more intuitively clarify the binding ability, interaction mode, and related active binding sites between peptides and adhesins.

The binding force energy calculation after docking is composed of van der Waals force, hydrogen bond, hydrophobic interaction, ligand conformation state, and electrostatic interaction between acceptor and ligand complexes¹⁸. The strength of binding capacity between receptor and ligand is usually indicated by binding capacity <-5.0 kcal/mol. The lower the binding energy, the closer the intermolecular conformation binding is¹⁹. By establishing an effective docking between two adhesins, the interaction between PV9 and its degradation fragments (VP, WG, VL, PVL, WGVP) and the two adhesins was analyzed. As shown in Table 1, the binding free energies of PV9 and its degradation fragments with BabA and SabA are both less than −5.0 kcal/mol, which proves that PV9 and its degradation fragments have high affinity for these two adhesins. Figure 3A–F and Fig. 4A–F show the molecular docking results of PV9 and its degradation fragments with BabA and SabA, respectively. Figure 3A shows that PV9 forms hydrogen bonds with Gly191*, Asn194*, Ser198, Gln200, Gln207, Ser244*, and Thr246* of the adhesin BabA. It forms van der Waals forces with Cys189*, Ser190, Asp192, Gly193, Asn195, Ser199, Val201, Asn206*, Val231, and Tyr245, and hydrophobic interactions with Lys208. The above binding sites were compared with the reported active sites of adhesin BabA (Cys189, Gly191, Asn194, Asn206, Asp233, Ser234, Ser244, and Thr246)²⁰. It was found that PV9 targets six of these active residues in the molecular docking results of PV9 and adhesin SabA shown in Fig. 4A. It can be found that PV9 forms hydrogen bonds with Trp97*, Lys152*, Glu156, Ser165, Asn334, Pro335, and Gln338 of SabA. It forms van der Waals forces with Ser98, Gly102, Asn103, Gln123, Gln159*, Ala160, Thr163, Asn164, and Thr333, and hydrophobic interactions with Leu94, Ala155, Lys168, Pro332, Tyr336, and Arg337. The above binding sites were compared with the reported active sites of adhesin SabA (Ser80, Pro81, Trp97, Tyr148, Lys152, Gln159, and Gln162)²¹, and PV9 could bind to three of the active sites. The PV9 fragment derivatives could also bind to some active sites. The docking results of PV9 fragment derivatives (VP, WG, VL, PVL, and WGVP) with two adhesins (Fig. 3B–F and Fig. 4B–F) all conformed to the interaction paradigm of PV9 and adhesin protein binding, that is, hydrogen bonds and van der Waals forces were the main binding drivers, while hydrophobic interactions contributed to the stability of the complex. Therefore, PV9 and its degradation fragments can jointly drive the binding to the active sites of adhesins by forming intermolecular forces such as hydrogen bonds and van der Waals forces, thus forming an effective network. As an intermolecular interaction with slightly stronger energy than van der Waals forces, hydrogen bonds play a greater role in the binding process. PV9 functions as an analog of the GES-1 cell surface receptor, participating in binding of the active site of adhesion protein, reducing the adhesion of Helicobacter pylori and inhibiting its binding with the GES-1 cell surface receptor, so that it cannot produce colonization effect, thereby reducing the damage to GES-1 cells. Although PV9 undergoes a certain degree of degradation, the molecular docking results indicate that the degradation fragments of PV9 may also inhibit the adhesion of Helicobacter pylori. Li et al.²² and Dang et al.²³ also found that the binding between active peptide and adhesin mainly depended on the number of hydrogen bonds and the number of binding sites, and the number of formations of the two binding conditions was positively correlated with the binding ability of active peptide and adhesin.

Table 2.

Primer information of qRT-PCR experiment

Gene	Forward primer (5’- > 3’)	Reverse primer (5’- > 3’)
GAPDH	CCACATCGCTCAGACACCAT	GGCAACAATATCCACTTTACCAGAG
Bcl-2	CATGTGTGTGGAGAGCGTCAA	GCCGGTTCAGGTACTCAGTCA
Bcl-xl	TCCTTGTCTACGCTTTCCACG	GGTCGCATTGTGGCCTTT
Bax	ATGGGCTGGACATTGG	GGGACATCAGTCGCTTCAG
Bad	CCAGAGTTTGAGCCGAGTGA	GATGATGCTTGCCGGAGCC
TLR4	GAGGATGATGCCAGGATGATGTC	GCCAAGTCTCCACGCAGG
MyD88	TCTCTCCAGGTGCCCATCA	GGCGAGTCCAGAACCAAGAT
NF-κB	CCTGGGTATACTTCATGTGAC	TCCAGGATTATAGCCCCTT
NF-κB p65	AACCTGGGAATCCAGTGTGTG	CCCACGCTGCTCTTCTTGGAA

Fig. 3. Molecular docking results of rice bran protein peptide PV9 and adhesin SabA (3D and 2D).

A PV9, B VP, C WG, D VL, E PVL, F WGVP.

Fig. 4. Molecular docking results of rice bran protein peptide PV9 and adhesin BabA (3D and 2D).

A PV9, B VP, C WG, D VL, E PVL, F WGVP.

The binding effect between PV9 and H. pylori was further confirmed by anti-adhesive tests in vitro. PV9 was added to GES-1 cells after co-incubation with H. pylori. The adhesive ability of H. pylori to GES-1 cells was analyzed by measuring the number of H. pylori that adhered to the cell surface. The results showed that PV9 intervention could significantly reduce the number of H. pylori adhering to the surface of GES-1 cells (p <0.05), and its anti-adhesive activity was 59.64 ± 2.00%, which was significantly higher than that of corn active peptide PY5 (40.75 ± 0.72%, 4 mg/mL)²⁴, wheat germ active peptide Pep4 (36.30 ± 2.00%, 10 mg/mL)²⁵. The results of binding molecular docking showed that PV9 could form 10 hydrogen bonds with BabA and 11 hydrogen bonds with SabA. Compared with the results of the other two active peptide molecules from different sources, it was found that corn active peptide PY5 formed 2 hydrogen bonds and 7 hydrogen bonds with two kinds of adhesins, and wheat germ active peptide Pep4 formed 2 hydrogen bonds and 7 hydrogen bonds with two kinds of adhesins, respectively, and the number of hydrogen bonds formed was less than that of PV9, which was consistent with the results of the anti-adhesive activity in vitro. At the same time, the analysis of the results of the anti-adhesive test reconfirmed that the number of hydrogen bonds formed by PV9 and adhesin has an important effect on its antagonistic activity against H. pylori. Furthermore, the results of the anti-adhesive activity also indicate that PV9 may bind to the adhesin proteins.

PV9 can bind to the adhesins SabA and BabA

In order to further confirm the binding effect between PV9 and adhesin proteins, a dot blot assay was employed to verify this. Previous studies have demonstrated that SabA and BabA specifically bind to Sialyl-Lewis^x and Lewis^b receptors of gastric mucosal epithelial cell surfaces, respectively²⁶. However, due to the commercial unavailability of SabA and BabA, the corresponding receptor substances were chosen for investigation. The commercially acquired receptors, Sialyl-Lewis^x-HSA and Lewis^b-HSA, are both stabilized compounds bound to human serum albumin (HSA). Therefore, HSA was utilized as a negative control in this study.

Under normal circumstances, H. pylori could bind to the immobilized receptors on the PVDF membrane when it was placed in the FITC-labeled H. pylori suspension. A fluorescent imager was used to see this binding. If PV9 can bind to H. pylori, after incubation with PV9, the binding sites on the surface adhesin proteins will be occupied. Since the PV9 occupies the adhesin binding sites, H. pylori cannot bind to the receptors on the PVDF membrane, resulting in a decrease in the number of H. pylori adhering to the membrane. Consequently, by observing whether the imprints on the membrane decrease, the binding status of PV9 with adhesin proteins can be reflected.

As shown in Fig. 5, the control group showed obvious imprints on the PVDF membrane, indicating that H. pylori can bind to the receptors Sialyl-Lewis^x and Lewis^b. No binding was observed on the negative control HSA, indicating that H. pylori does not bind to HSA. This rules out the possibility of HSA binding to the receptor. Compared with the control group, after PV9 was incubated with H. pylori, the imprints on the membrane significantly decreased, and the number of H. pylori adhering to the membrane decreased. This result confirms that PV9 can bind to the adhesins SabA and BabA on the surface of H. pylori, thereby inhibiting the binding between H. pylori and its receptors Sialyl-Lewis^x and Lewis^b. This result is consistent with the molecular docking. In our follow-up research, we plan to construct an adhesin expression vector, obtain adhesin recombinant protein, and further analyze the interaction mechanism between PV9 and adhesins.

Fig. 5. Combined analysis of PV9 with adhesins.

The subjects were divided into a control group and an experimental group. The vertical column indicates A Sialyl-Lewis^x-HSA, B Lewis^b-HSA, C HSA.

PV9 can significantly reduce the intracellular ROS content

ROS, also known as reactive oxygen species, includes superoxide anion (O₂-·), hydrogen peroxide (H₂O₂), and hydroxyl radical (·OH) and is a class of oxygen-containing molecules with high chemical activity. Under normal circumstances, a small amount of ROS is produced during aerobic respiration through mitochondria. At low concentrations, ROS can not only participate in cell growth, differentiation, migration, and apoptosis as a signal molecule but also participate in the body’s immune system as an immunomodulatory substance to destroy invading pathogenic microorganisms and play an immune defense role²⁶. When pathogenic microorganisms invade the body, they may cause partial leakage of electrons during aerobic respiration, and these leaked electrons combine with oxygen to form superoxide anions under the catalysis of NADPH oxidase (NOX) on the cell membrane. Due to the poor stability of the superoxide anion, it can be further converted into hydrogen peroxide under the action of superoxide dismutase, part of the hydrogen peroxide can be decomposed into water and oxygen, and the other part of the hydrogen peroxide can be catalyzed by iron ions to form hydroxyl radicals. Although many kinds of cells can produce ROS in the above ways, the involvement of neutrophils is still the main way of production^27–29. In the detection of ROS content, the intracellular ROS content was determined by the 2’, 7’-dichlorodihydrofluorescein diacetate probe (DCFH-DA). The DCFH-DA probe itself has no fluorescence reaction and can freely shuttle across the cell membrane into the cell. When the DCFH-DA probe is normally ingested by the cell, it will be hydrolyzed by intracellular esterase to produce DCFH without a fluorescence reaction, which can be further oxidized by intracellular ROS to 2’, 7’ dichlorofluorescein (DCF). DCF is a fluorescent reactive substance, and its fluorescence value can be measured by flow cytometry to indirectly reflect the change of intracellular ROS content.

As shown in Fig. 6, ROS content in the model group after induction of H. pylori infection was significantly increased compared with the control group (p < 0.05), indicating that GES-1 cells after induction of H. pylori infection experienced serious oxidative stress, resulting in a large amount of ROS accumulation in the cells. Compared with the model group, the intracellular ROS content was significantly decreased after intervention with different concentrations of PV9 (p < 0.05). After intervention with PV9 at a concentration of 50 μg/mL, the intracellular ROS clearance effect induced by H. pylori infection was the most obvious, and its improvement effect approached that of the control group. These results indicated that PV9 intervention could significantly alleviate the oxidative stress induced by H. pylori infection and reduce ROS produced by oxidative stress, which may be related to the good antioxidant activity of PV9.

Fig. 6. Effect of PV9 on ROS content of GES-1 cells induced by H.

pylori infection. A the peak of ROS content in GES-1 cells, B the histogram of ROS content in GES-1 cells. * denotes significant difference with the Control group (p < 0.05); # denotes significant difference with the Model group (p < 0.05).

When H. pylori enters the body, it depends on BabA and SabA to adhere to gastric mucosa epithelial cells. In addition, the cytotoxin-related factor A (CagA) and vacuolar cytotoxin A (VacA) carried by activating the body’s own immune system after contact with gastric mucosa epithelial cells, induce inflammation through a variety of molecular pathways and recruit neutrophils in the body to the site of inflammation. Neutrophils directly kill pathogenic microorganisms by producing ROS as antibacterial agents, while H. pylori itself secretes a variety of antioxidant enzymes (NapA, catalase, superoxide dismutase) to resist the body’s elimination of ROS^30,31. This protective effect prevents the body from effectively killing H. pylori through the production of ROS. Meanwhile, the continuous colonization effect produced by ROS will continuously trigger the recognition of the body’s immune system, resulting in a large number of neutrophils infiltrating and producing excessive ROS. It can produce a large amount of IL-1β, IL-6, and IL-8, and cause the body to be in a chronic inflammatory state for a long time, thus forming an oxidative stress storm^32,33.

Due to the good anti-adhesive activity of PV9 in vitro, after the intervention of PV9, the number of H. pylori adhering to the cell surface can be reduced, and then the inflammatory response of the cell can be reduced, which is manifested by the reduction of ROS production, which may be the main reason for its excellent effect. Our previous studies have found that PV9 also has good antioxidant activity, which is also related to the reduction of ROS content in experimental groups. It has been found that the intake of active peptides with antioxidant function can reduce ROS content by regulating the activity of antioxidant enzymes and related signaling pathways in cells^34,35. It can be inferred that PV9 may play a protective role in cells by improving the activity of various antioxidant enzymes in cells, maintaining normal mitochondrial membrane potential, accelerating the clearance of intracellular ROS, and alleviating the oxidative stress damage of GES-1 cells induced by H. pylori infection, which has been confirmed in subsequent studies.

PV9 significantly improved the increase in mitochondrial membrane potential

Mitochondria, as organelles existing in most eukaryotic cells, not only play a key role in energy conversion but also serve as a storage and regulator of calcium ions, controlling the concentration and release of calcium ions in cells and playing a key role in apoptosis regulation. When mitochondria convert energy into energy supply for the body, a series of electron transfer processes is carried out in the inner membrane of mitochondria, so that protons are transported from the mitochondrial matrix to the mitochondrial membrane gap, thus forming an electrochemical gradient of protons and resulting in changes in membrane potential. After H. pylori infects the body, it induces cells to produce excessive ROS through its own secreted cytotoxin CagA, which promotes oxidative stress damage of mitochondria, and mitochondrial dysfunction leads to abnormal cell death^36,37. VacA, another cytotoxin secreted, causes cellular vacuolation, targeting mitochondria, and changes mitochondrial membrane permeability, causing mitochondrial membrane potential and ATP dissipation, activating the expression of related pro-apoptotic genes such as Bax, and inducing cell apoptosis^38,39.

The JC-1 fluorescent probe is usually used to detect the changes in the membrane potential of intracellular mitochondria, which shows a high potential dependence. In normal mitochondria, JC-1 aggregates in the mitochondrial matrix to form a polymer that can produce red fluorescence. In unhealthy mitochondria due to decreased or lost membrane potential, JC-1 cannot accumulate in the mitochondrial matrix but only exists in the cytoplasmic matrix as a monomer, producing green fluorescence. Therefore, the change of mitochondrial membrane potential can be detected by using flow cytometry to change JC-1 from red fluorescence to green fluorescence. As can be seen from Figs. 7A and 7B, the control group was basically all red fluorescence, and its mitochondrial membrane potential was 97.37%. Compared with the control group, the leakage of mitochondrial membrane potential in the model group induced by H. pylori infection was serious, from red fluorescence to green fluorescence, and the mitochondrial membrane potential decreased significantly (p < 0.05) to 68.65%, indicating that the normal mitochondrial function in GES-1 cells was destroyed after H. pylori infection. The permeability of the mitochondrial membrane was changed, and the membrane potential decreased significantly (p < 0.05). Compared with the model group, after intervention with different concentrations of PV9, the intracellular mitochondrial membrane potential of all experimental groups was significantly increased (p < 0.05), indicating that PV9 intervention can significantly improve the changes of mitochondrial membrane potential induced by H. pylori infection. Kim et al.⁴⁰ found that red ginseng extract can protect human gastric epithelial cells from oxidative damage by reducing intracellular ROS accumulation and improving mitochondrial dysfunction. Lin et al.⁴¹ also found that cinnamaldehyde can reduce intracellular ROS accumulation and improve mitochondrial dysfunction, thereby restoring the osteogenic differentiation potential of bone marrow mesenchymal stem cells induced by hydrogen peroxide. PV9 may be related to reducing oxidative stress damage to mitochondria by clearing the excessive accumulation of ROS caused by H. pylori infection in cells, so as to maintain normal mitochondrial membrane potential and achieve normal mitochondrial function.

Fig. 7. Core functional detection of cell biology.

A, B Effect of PV9 on mitochondrial membrane potential of GES-1 cells induced by H. pylori infection. C, D Effect of PV9 on the cell cycle of GES-1 cells induced by H. pylori infection. E, F Effect of PV9 on apoptosis of GES-1 cells induced by H. pylori infection. * denotes significant difference with the Control group (p < 0.05); # denotes significant difference with the Model group (p < 0.05).

PV9 could improve GES-1 cell cycle

The cell cycle refers to the whole process of the cell from the end of one division to the end of the next division, which can be divided into three stages: the G0/G1 phase, the S phase, and the G2/M phase. The G0/G1 phase is the first stage of the cell cycle, which is the period from the completion of the last cell division to the beginning of DNA synthesis. In this period, the cell volume will increase, and it will begin to synthesize a variety of enzymes, proteins, and RNA, while material metabolism and energy preparation are the basic preparations for DNA replication. The S phase is mainly the synthesis phase of DNA. When the cell is in this period, DNA begins to replicate, and the cell synthesizes histone proteins and other proteins related to DNA replication, so that the DNA content is doubled to complete DNA replication and ensure the accurate transmission of genetic information. The G2/M phase is the phase from which DNA replication is completed to mitosis, where cells continue to synthesize substances such as proteins and RNA to further prepare for cell division and eventually enter the mitosis phase. Studies have found that when the body is invaded by foreign microorganisms, the toxins secreted by them will trigger the excessive production of intracellular ROS, thereby mediating the severe oxidative stress of cells and down-regulating cycle-dependent protein kinase^42,43, affecting the cell cycle arrest changes, and then leading to cell apoptosis. Therefore, effective improvement of cell cycle arrest caused by H. pylori infection is very important for alleviating GES-1 cell damage.

Propidium Iodide (PI) is a fluorescent dye of double-stranded DNA. When PI enters the cell, it will produce fluorescence after binding with double-stranded DNA in the cell, and the fluorescence intensity generated is proportional to the content of double-stranded DNA. Therefore, the content of double-stranded DNA can be reflected by the detection of fluorescence intensity, and the changes in each stage of the cell cycle can be analyzed. The effect of PV9 on the GES-1 cell cycle induced by H. pylori infection is shown in Fig. 7C and 7D. Compared with the control group, the cell cycle composition in the model group was significantly changed after H. pylori infection (p < 0.05), showing that the S phase was significantly increased, and the G0/G1 phase and G2/M phase were significantly decreased (p < 0.05), indicating that the cell cycle of GES-1 cells after H. pylori infection was more blocked in the S phase. This phenomenon is consistent with the findings of Canales et al.⁴⁴, namely, H. pylori infection can affect the cell cycle, blocking cells in the S phase and inducing cell apoptosis. Shirin et al.⁴⁵ also found that H. pylori could induce apoptosis of AGS cells and inhibit the progression of the G1 to S phase of the cell cycle. H. pylori itself secretes a variety of toxic factors, which induce strong oxidative stress and inflammation in cells during its colonization and lead to cell cycle arrest by reducing cyclin-dependent kinase inhibitors.

Compared with the model group, the cell cycle composition was significantly improved after intervention with different concentrations of PV9 (p < 0.05). With the increase of PV9 concentration, the S-phase component content of GES-1 cells decreased gradually after infection. When PV9 concentration was 50 μg/mL, the improvement effect of S phase block was the most obvious, which was reduced from 39.11 ± 0.70% to 32.95 ± 0.53%, and the S phase was significantly reduced compared with the model group (p < 0.05), indicating that after PV9 intervention, the blocked S phase could be effectively reduced and cells could enter G2/M phase normally. And then the final mitosis phase completes the cycle of the cell cycle. PV9 may reduce oxidative stress damage caused by H. pylori infection, maintain normal mitochondrial membrane potential, regulate cell cycle disorders, reduce abnormal cell proliferation, and restore normal DNA replication processes to improve cell arrest induced by H. pylori infection.

PV9 can prevent the apoptosis of GES-1 cells induced by H. pylori infection

Apoptosis is a highly ordered programmed cell death process, which is a universal phenomenon in organisms and plays an important role in the growth and development of organisms and the maintenance of internal environment stability. Apoptosis is mainly induced by the death receptor pathway and the mitochondrial pathway. The Death receptor pathway (exogenous pathway) transmits apoptotic signals through different signal transmission systems, causing apoptosis. For example, Fas and FasL of tumor necrosis factor receptor superfamily members can initiate apoptotic signal transduction and cause apoptosis⁴⁶. The mitochondrial pathway (endogenous pathway) refers to the pathway triggered by severe oxidative stress damage, DNA damage, mitochondrial membrane potential dissipation, etc., which upregulates the contents of pro-apoptotic genes Bad and Bax in the Bcl-2 family, resulting in the release of cytochrome C and the formation of apoptotic bodies by binding with Apaf-1. Further activation of the downstream effect caspase, and then induces apoptosis⁴⁷.

Phosphatidylserine (PS) is located on the inner side of normal cell membranes, but during early apoptosis, PS can be flipped from the inner side of the cell membrane to the surface of the cell membrane for exposure to the extracellular environment. Annexin V is a Ca²⁺-dependent phospholipid-binding protein with a high affinity for PS. Annexin V can bind specifically to PS, so Annexin V is often used as an indicator to detect early apoptosis of cells. When using Annexin V with FITC as a probe for early apoptosis detection, Annexin V binding with PS can produce green fluorescence. Propidium Iodide (PI) can stain necrotic cells or cells that have lost cell membrane integrity in late apoptosis, resulting in red fluorescence. In the process of flow detection, normal cells are in the third quadrant because they do not fluorescently react with the two dyes. Early apoptotic cells showed green fluorescence in the first quadrant, while late apoptotic cells and necrotic cells showed green and red fluorescence in the fourth quadrant.

Figure 7E and 7F show the effect of PV9 on the apoptosis of GES-1 cells induced by H. pylori infection. There were fewer cells in the control group undergoing apoptosis (3.55 ± 0.16%), and the cells as a whole concentrated in the third quadrant. Compared with the control group, apoptosis began to occur after H. pylori infection (23.08 ± 0.87%), and apoptosis was significantly increased in the H. pylori infection model group (p < 0.05). Due to apoptosis, some cells combined with dyes showed fluorescence concentrated in the first and fourth quadrants, which was consistent with the results of Moss et al.⁴⁸, that is, cells will accelerate apoptosis after being infected by H. pylori. The virulence factor of H. pylori, CagA-PAI, enters gastric mucosa epithelial cells through the type IV secretion system after H. pylori infection, interferes with intracellular signaling, and induces cell apoptosis⁴⁹. Another virulence factor, VacA, enters cells and reaches mitochondria through vacuolation and internalization of cells, causing mitochondrial cleavage and dysfunction and spilling out cytochrome C and apoptosis factors in mitochondria, leading to apoptosis¹⁰. In addition, it has been found that the excessive production and accumulation of ROS in cells stimulated by foreign substances is also the main factor causing apoptosis^33,50. Combined with the results of 2.5–2.7, it is speculated that when H. pylori infects GES-1 cells, ROS accumulation in the cells will cause serious oxidative stress damage, make mitochondrial dysfunction unable to maintain normal membrane potential, and block the cell cycle, leading to cell apoptosis.

Compared with the model group, when different concentrations of PV9 were used to intervene, it was found that the apoptosis of all groups after intervention was improved. When PV9 concentration was 10 μg/mL, the apoptosis was relieved (22.12 ± 0.69%), but there was no significant difference compared with the model group (p > 0.05). When the concentration was increased to 50 μg/mL, the apoptosis was significantly improved (p < 0.05), and the apoptosis rate was reduced to 14.84 ± 0.89%, which had no significant difference compared with the control group (p > 0.05). In conclusion, PV9 can significantly reduce the apoptosis induced by H. pylori infection and keep the cells in a normal growth state. The reason for this phenomenon may be related to the reduction of ROS content and the good antioxidant activity of PV9. Wang et al. found that rice bran protein peptide can improve the oxidative stress damage of cells by regulating the expression of apoptosis-related proteins, which is related to the antioxidant activity of rice bran protein peptide⁵¹. Therefore, PV9 may improve apoptosis induced by H. pylori infection by increasing the overall antioxidant level of cells, accelerating ROS clearance and reducing accumulation, alleviating mitochondrial damage, maintaining normal physiological functions, and improving oxidative stress damage of cells, and thus inhibiting apoptosis induced by H. pylori infection. Therefore, we further analyzed the changes of intracellular antioxidant-related factors.

PV9 can significantly improve the oxidative stress state of GES-1 cells

When H. pylori infects GES-1 cells, its own release of CagA, VacA, urease, and other virulence factors will stimulate the production of excessive ROS in cells, resulting in increased lipid peroxidation, destruction of cell membrane structure, mitochondrial dysfunction, and then apoptosis. In combination with the results of 2.5–2.8, in order to further explore whether PV9 is related to the regulation of the levels of cellular antioxidant factors in alleviating the cell damage caused by H. pylori infection-induced GES-1 cells, the levels of intracellular oxidative stress-related factors were determined.

Lactate dehydrogenase (LDH) is a zinc-containing metal protein in cells and an important oxidoreductase in the glycolytic pathway in vivo. Under normal circumstances, LDH exists stably in cells. When cells are infected by H. pylori, the virulence factors released by it will stimulate NADPH oxidase in cells to produce emergency factors to attack cells, aggravate lipid peroxidation on the surface of cell membranes, and destroy cell membrane structure, resulting in increased LDH spill content. Therefore, the integrity of cell membrane structure can be directly reflected by measuring the content of LDH in culture medium⁵². As shown in Fig. 8A, compared with the control group (13.87 ± 0.08 ng/mL), the LDH content in the culture medium of the model group (27.29 ± 0.92 ng/mL) was significantly increased (p < 0.05), indicating that the cell membrane structure of GES-1 was destroyed after infection by H. pylori. The content of LDH in culture medium was significantly increased (p < 0.05). Compared with the model group, LDH content in culture medium was significantly decreased after intervention with different concentrations of PV9 (p < 0.05), and when PV9 concentration was 50 μg/mL, LDH content in culture medium was reduced to the lowest 14.56 ± 0.80 ng/mL, which had no significant difference from the control group (p > 0.05). These results indicated that the oxidative stress damage of GES-1 cells was significantly improved after the intervention with a certain dose of PV9, the damage degree of cell membrane structure was reduced, and the level of LDH secretion tended to be normal.

Fig. 8. Effect of PV9 on oxidative stress of GES-1 cells induced by H.

pylori infection. A LDH, B MDA, C SOD, D GSH-Px, E CAT. * denotes significant difference with the Control group (p < 0.05); # denotes significant difference with the Model group (p < 0.05).

Malondialdehyde (MDA) is an organic compound with important biochemical significance. It is the end product of the peroxidation of polyunsaturated fatty acids, which is mainly produced by lipid peroxidation in vivo. Its content is closely related to the degree of lipid peroxidation, and it is often used as an important marker of oxidative stress and lipid peroxidation in organisms⁵³. As shown in Fig. 8B, compared with the control group (1.22 ± 0.06 ng/mL), the MDA content in the model group (2.57 ± 0.17 ng/mL) was significantly increased (p < 0.05), indicating that the degree of intracellular lipid peroxidation was aggravated when GES-1 cells were infected by H. pylori. This causes oxidative damage to the cells. Compared with the model group, intracellular MDA content also increased to a certain extent when PV9 concentration was 10 μg/mL and 25 μg/mL. This phenomenon may be caused by the fact that PV9 could not effectively inhibit MDA accumulation and production under low concentration conditions, and H. pylori further sustained oxidative damage to GES-1 cells. However, when the intervention concentration of PV9 was 50 μg/mL, the degree of lipid peroxidation in GES-1 cells was significantly improved, and the intracellular MDA content (2.30 ± 0.06 ng/mL) was significantly decreased (p < 0.05). The results showed that PV9 in high concentration (50 μg/mL) could effectively remove free radicals in cells, restore antioxidant capacity, and improve lipid peroxidation induced by H. pylori infection.

Superoxide dismutase (SOD) is an important endogenous antioxidant enzyme in organisms, which can catalyze the disproportionation of superoxide anions produced by the body under oxidative stress and convert them into hydrogen peroxide and oxygen. Hydrogen peroxide can also be further broken down into cell-harmless water and oxygen by glutathione peroxidase and catalase, thereby reducing free radical damage to cells⁵⁴. As shown in Fig. 8C, SOD activity in the model group was significantly reduced compared with the control group (p < 0.05), indicating that H. pylori infection accelerated the loss of intracellular antioxidant enzymes. After intervention with different concentrations of PV9, SOD activity in experimental groups was significantly increased in the range of PV9 concentration compared with the model group (p < 0.05). When the concentration of PV9 was 50 μg/mL, there was no significant difference in SOD activity compared with the control group (p > 0.05), indicating that the intervention of PV9 can effectively improve the intracellular SOD activity, which can be used to resist the oxidative stress reaction induced by H. pylori infection.

Glutathione peroxidase (GSH-Px) is an important antioxidant enzyme in the body, which can catalyze the transformation of reduced glutathione into oxidized glutathione and reduce harmful hydrogen peroxide to harmless hydroxyl compounds in the body, so as to protect the structure and function of cell membranes from interference and damage by oxides^55,56. As shown in Fig. 8D, compared with the control group (2068.26 ± 128.98 U/mL), the GSH-Px activity in the model group (957.89 ± 76.56 U/mL) was significantly decreased (p < 0.05). Compared with the model group, PV9 intervention concentrations were 10 μg/mL (1961.99 ± 122.63 U/mL), 25 μg/mL (2130.64 ± 62.88 U/mL) and 50 μg/mL (2156.05 ± 73.00 U/mL). The activity of GSH-Px in experimental groups was significantly increased (p < 0.05), and there was no significant difference compared with the control group (p > 0.05). These results indicate that H. pylori infection of GES-1 cells can lead to depletion of GSH-Px activity and a decrease in antioxidant capacity. After the intervention with PV9, the activity of GSH-Px in cells gradually increased, which improved the antioxidant activity in the body, and was used to decompose peroxide and reduce the damage to cells.

Catalase (CAT) exists widely in the peroxidase of cells and is an important antioxidant enzyme in the body. It can catalyze the decomposition of hydrogen peroxide into oxygen and water, so that cells can avoid the toxic effect of hydrogen peroxide⁵⁷. As shown in Fig. 8E, compared with the control group, CAT activity in the model group was significantly reduced (p < 0.05). Compared with the model group, after intervention with different concentrations of PV9, CAT activity in the 25 μg/mL group (3.19 ± 0.59 ng/mL) and the 50 μg/mL group (4.31 ± 0.08 ng/mL) was significantly increased (p < 0.05), except for the 10 μg/mL group. And with the increase of intervention concentration, the control group gradually tended to (p > 0.05). The results showed that the intervention with PV9 can effectively improve the intracellular CAT activity, accelerate the decomposition of intracellular peroxide, and improve the antioxidant capacity of cells.

According to the above results, PV9 can effectively protect the integrity of GES-1 cells infected by H. pylori, reduce the release of LDH, inhibit the occurrence of lipid peroxidation, and reduce the production of MDA. At the same time, by increasing the activity of SOD, GSH-Px, and CAT in cells, the antioxidant activity of cells was increased, the level of oxidative stress was improved, and the protective effect of GES-1 against the damage induced by H. pylori infection was achieved. These results suggest that the antagonistic effect of PV9 on H. pylori infection is related to the enhancement of the overall antioxidant capacity of cells and is closely related to the clearance of ROS and the maintenance of cell mitochondrial membrane potential.

PV9 inhibits GES-1 cells' inflammation by down-regulating levels of pro-inflammatory factors

H. pylori infection of GES-1 cells induces oxidative stress damage and inflammation. The occurrence of an inflammatory response will lead to the imbalance of the contents of proinflammatory factors and anti-inflammatory factors in the cell, among which the overexpression of proinflammatory factors is the main factor triggering the inflammatory response, and its content is positively correlated with the degree of inflammatory response^58,59. Therefore, the alleviating effect of PV9 on H. pylori infection-induced injury of GES-1 cells was evaluated by the contents of intracellular pro-inflammatory factors and anti-inflammatory factors. The effects of PV9 on the contents of pro-inflammatory factors interleukin-1β (IL-1β), interleukin-6 (IL-6), interleukin-8 (IL-8), interleukin-18 (IL-18), and tumor necrosis factor-α (TNF-α) and the anti-inflammatory factor interleukin-10 (IL-10) in GES-1 cells induced by H. pylori infection are shown in Fig. 9.

Fig. 9. Effect of PV9 on the inflammatory factor content of GES-1 cells induced by H.

pylori infection. A IL-1β, B IL-6, C IL-8, D IL-18, E TNF-α, F IL-10. * denotes significant difference with the Control group (p < 0.05); # denotes significant difference with the Model group (p < 0.05).

As can be seen from Fig. 9, compared with the control group, the contents of intracellular pro-inflammatory factors IL-1β, IL-6, IL-8, IL-18, and TNF-α were significantly increased in the model group (p < 0.05), by 1.04, 1.69, 3.40, 2.78, and 0.65 times, respectively. This is consistent with the results of Huang et al., that H. pylori infection of GES-1 cells induces an increase in the content of proinflammatory factors in the cells⁶⁰. After H. pylori infection, the virulence factors CagA and VacA secreted by the bacteria will destroy the structure of the cell membrane and affect the dysfunction of mitochondrial function, resulting in the upregulation of the contents of IL-1β, IL-6, IL-8, IL-18, and TNF-α, thus mediating the severe inflammatory response of the cells.

The over-upregulated expression of proinflammatory factors is the direct factor causing the inflammatory response. Pro-inflammatory factors mainly include interleukin substances, such as IL-1β, IL-6, IL-8, IL-18, and so on. It has been reported that H. pylori infection can cause an increase in the content of pro-inflammatory factors, resulting in neutrophil infiltration and severe inflammation of cells. IL-1β, IL-6, IL-8, and IL-18 are believed to play a key role in H. pylori infection-related diseases, and the sustained overexpression of these pro-inflammatory factors will cause chronic inflammation in the stomach microenvironment for a long time, resulting in gastritis, gastric ulcer, and other injuries^61,62. Figure 9A–D shows the effect of PV9 on the levels of IL-1β, IL-6, IL-8, and IL-18 in GES-1 cells induced by H. pylori infection. As can be seen from Fig. 9A–D, compared with the model group, the contents of IL-1β, IL-6, IL-8, and IL-18 in the experimental group were significantly decreased after the intervention with PV9 (p < 0.05), and the contents of IL-1β in the experimental group were decreased by 0.47 times when the concentration of PV9 was 50 μg/mL. There was no significant difference compared with the control group (p > 0.05). The content of IL-6, IL-8, and IL-18 in cells decreased by 0.54, 0.61, and 0.71 times, all of which were close to the normal content in the control group, indicating that the release of interleukin-like pro-inflammatory factors in GES-1 cells could be effectively reduced after intervention with PV9, thus alleviating the cellular inflammatory response.

TNF-α is an important inflammatory factor in cells, and the excessive secretion of TNF-α can trigger the inflammatory response of cells. In addition, overexpression of TNF-α can also induce the release of other inflammatory factors, such as IL-1β, IL-6, IL-8, nd IL-18, causing further cell damage and inducing cell apoptosis, which is an important factor in triggering the body’s inflammatory response^12,63. Figure 9E shows the effect of PV9 on TNF-α content in GES-1 cells induced by H. pylori infection. As shown in Fig. 9E, after H. pylori infection, the content of TNF-α in the cells increased significantly (p < 0.05), indicating that the cells had a serious inflammatory response. Compared with the model group, after the intervention with PV9, the content of TNF-α in GES-1 cells of experimental groups was significantly decreased (p < 0.05), and showed a dose-dependent effect. When the intervention concentration of PV9 was 50 μg/mL, the content of TNF-α in the cell was significantly reduced by 0.40 times, and there was no significant difference compared with the control group (p > 0.05), indicating that after the intervention of PV9, the release of TNF-α in the cell was reduced, and the cellular inflammatory response was weakened. Li et al.⁶⁴ found that after H. pylori infection, the contents of IL-1β, IL-6, and TNF-α in gastric tissue were significantly increased, and after intervention with corn peptide, the contents of IL-1β, IL-6, and TNF-α in gastric tissue were significantly reduced, thus reducing the cell damage caused by the inflammatory response. Furthermore, it can protect GES-1 cells injured by H. pylori infection. Some naturally active substances have also been reported to improve the inflammatory response induced by H. pylori infection by reducing levels of interleukinoids and TNF-α^61,65. These literature reports are similar to the results of this study.

IL-10 is a typical intracellular anti-inflammatory factor, which is mainly produced by T cells and mononuclear macrophages. The presence of IL-10 can significantly inhibit the production of pro-inflammatory factors and help to control inflammatory response and prevent excessive inflammation from damaging the body itself⁶⁶. As can be seen from Fig. 9F, compared with the control group, the content of anti-inflammatory factor IL-10 in the model group was significantly decreased (p < 0.05), indicating that H. pylori infection increased the degree of inflammation in GES-1 cells, which was consistent with the results of the pro-inflammatory factor test above. Compared with the model group, after intervention with different concentrations of PV9, the content of IL-10 in GES-1 cells in the experimental groups could be significantly increased (p < 0.05). When PV9 was 50 μg/mL, the content of IL-10 in GES-1 cells was increased by 5.82 times, which was similar to the content of IL-10 in the control group. These results indicated that PV9 intervention could significantly increase the content of IL-10 in cells and improve the anti-inflammatory ability of cells. Studies have shown that IL-10 can inhibit the expression of pro-inflammatory factors and reduce the overall inflammatory response of cells by inhibiting the activation of NF-κB⁶⁷, It also suggests that the improvement of PV9 on inflammation may be related to the inhibition of NF-κB. In summary, PV9 can significantly improve the level of inflammation in cells by increasing the content of anti-inflammatory factors and decreasing the content of pro-inflammatory factors.

Protective mechanism of PV9 on GES-1 cells induced by H. pylori infection is based on inhibiting the apoptosis

According to the results of 2.5–2.10, it can be seen that PV9 has a protective effect on GES-1 induced by H. pylori infection, which may be through inhibiting the adhesion of H. pylori, improving the total antioxidant capacity of the body, alleviating the oxidative stress response of the body, reducing the release of intracellular pro-inflammatory factors, weakening the degree of inflammation, and improving the cell cycle arrest and apoptosis. A variety of synergistic pathways can be used to antagonize the damage of GES-1 cells caused by H. pylori infection. It has been found that reducing the effect of pro-apoptotic factors and enhancing the effect of anti-apoptotic factors are important ways to inhibit apoptosis. Bax and Bad are two important genes involved in cell apoptosis, and their existence promotes the apoptosis of cells. Bcl-2 and Bcl-xl are two kinds of anti-apoptosis genes, and their existence can resist the apoptosis of cells⁹. Therefore, the mRNA expression levels of pro-apoptotic factor and anti-apoptotic factor were studied to evaluate the effect of PV9 on the apoptosis of GES-1 cells. In order to further analyze the antagonistic effect of PV9 on the damage of GES-1 cells induced by H. pylori infection. According to the above test results, it was found that when the intervention concentration of PV9 was 50 μg/mL, its protective effect was the best, so the concentration of 50 μg/mL was selected for subsequent test analysis.

As shown in Fig. 10A-D, compared with the control group, the mRNA expression levels of Bcl-2 and Bcl-xl in GES-1 cells of the model group were significantly decreased (p < 0.05), decreased by 0.61 and 0.77 times, respectively, and the expression levels of Bax and Bad were significantly increased (p < 0.05) after H. pylori infection and injury, increased 8.82 and 26.57 times, respectively. These results indicated that the expression of pro-apoptotic factor and anti-apoptotic factor in GES-1 cells could be unbalanced after H. pylori infection, and overexpression of pro-apoptotic factor could accelerate apoptosis, which was consistent with the above results. This result is consistent with that of Hsu et al.⁶⁸. Compared with the model group, when PV9 was 50 μg/mL, the expression levels of Bcl-2 and Bcl-xl in GES-1 cells of the experimental group were significantly increased (p < 0.05), by 1.36 and 2.96 times, respectively, while the expression levels of Bax and Bad were significantly decreased (p < 0.05), by 0.71 and 0.81 times, respectively. These results indicated that PV9 intervention could significantly increase the expression of anti-apoptotic factors and reduce the expression of pro-apoptotic factors, significantly improve the degree of apoptosis, and keep cells in a normal state, which was consistent with the results of cell cycle and apoptosis detection (p < 0.05). Xu et al.⁶⁹ also found that apoptosis of GES-1 cells could be reduced by regulating the ratio of anti-apoptotic factors to pro-apoptotic factors, and it is consistent with the results of this experiment.

Fig. 10. Effect of PV9 on mRNA expression of related factors in GES-1 cells induced by H.

pylori infection. A Bcl-2, B Bcl-xl, C Bax, D Bad, E TLR4, F MyD88, G NF-κB, H NF-κB p65. * denotes significant difference with the Control group (p < 0.05); # denotes significant difference with the Model group (p < 0.05).

Studies have shown that when the body is interfered with by exogenous toxins or factors, the NF-κB signaling pathway will be activated, and the expression of pro-apoptotic factors and anti-apoptotic factors in cells will be unbalanced, resulting in serious cell damage⁹. Nuclear factor-κB (NF-κB), as an important signaling molecule, has been shown to be closely related to the occurrence of inflammation and the promotion of accelerated cell apoptosis, and NF-κB plays a key role in regulating the immune response triggered by bacterial infection⁷⁰. The mode receptor TLR4 on the surface of GES-1 cells can specifically recognize the virulence factors released by H. pylori, and the activated TLR4 can rapidly promote the recruitment of MyD88, and the two form the TLR4-MyD88 complex. The cascade reaction of the NF-κB signaling pathway promotes the generation of NF-κB, while the active subunit p65 of NF-κB is activated under the stimulation of cytokines such as TNF-α and IL-1β and then transfers from the cytoplasm to the active site of NF-κB in the nucleus, promoting the serious inflammatory response and apoptosis expression of cells. Therefore, this study preliminarily explored the potential action mechanism of PV9 from the TLR4/MyD88/NF-κB signaling pathway.

As can be seen from Fig. 10E–H, compared with the control group, the expression levels of TLR4, MyD88, NF-κB, and NF-κB p65 in GES-1 cells of the model group were significantly increased (p < 0.05), by 4.54, 5.24, 5.12, and 10.00 times, respectively. After the induction of H. pylori infection, the expression of TLR4 and MyD88 in GES-1 cells increased, which led to the increase of the expression of NF-κB and NF-κB p65, activating the NF-κB signaling pathway, and activating the anabolic activity of inflammatory factors in cells, resulting in cellular inflammatory damage and promoting apoptosis. Compared with the model group, at 50 μg/mL, the expression levels of TLR4, MyD88, NF-κB, and NF-κB p65 in GES-1 cells of the experimental group were significantly decreased (p < 0.05), by 0.79, 0.74, 0.75, and 0.66 times, respectively. There was no significant difference in the expression level of TLR4 compared with the control group (p > 0.05), but the expression levels of MyD88, NF-κB, and NF-κB p65 were similar to those of the blank control group.

Discussion

PV9 has a protective effect on GES-1 induced by H. pylori infection, which may be through inhibiting the adhesion of H. pylori, improving the total antioxidant capacity of the body, alleviating the oxidative stress response of the body, reducing the release of intracellular pro-inflammatory factors, weakening the degree of inflammation, and improving the cell cycle arrest and apoptosis. A variety of synergistic pathways can be used to antagonize the damage of GES-1 cells caused by H. pylori infection. It has been found that reducing the effect of pro-apoptotic factors and enhancing the effect of anti-apoptotic factors are important ways to inhibit apoptosis. These results suggest that the protective mechanism of PV9 may be regulating the expression of apoptosis and the TLR4/MyD88/NF-κB signaling pathway. When PV9 is present, it can reduce the number of H. pylori attached to the cell surface, and the expression of virulence factor is reduced, and the expression of TLR4 in the cell is also reduced, and the subsequent content of the corresponding substance will not be significantly increased (Fig. 11).

Fig. 11. Protective mechanism of PV9 on GES-1 cells induced by H.

pylori infection is based on inhibiting cell apoptosis and the TLR4/MyD88/NF-κB pathway.

It should be noted that the present study is primarily based on the gene level. Although qPCR data suggest the involvement of the TLR4/MyD88/NF-κB signaling pathway in PV9 inhibiting H. pylori infection, assessment of protein-level changes remains a subject for future investigation. Addressing this aspect, particularly the analysis of post-translational modifications such as phosphorylation in vivo, will be an important next step to fully elucidate the underlying mechanism.

In this study, the binding effect between PV9 and H. pylori adhesin SabA and BabA was first confirmed, thereby inhibiting H. pylori adhesion to GES-1 cells. PV9 is mainly bonded to adhesin by a hydrogen bond, and van der Waals force and hydrophobic interaction also play a role in this process. The results showed that PV9 can significantly improve the damage of GES-1 cells induced by H. pylori infection, and its mechanism of action is to accelerate the clearance of ROS, maintain the normal function of mitochondria, relieve the oxidative stress and inflammatory response of cells, and inhibit cell apoptosis to achieve multi-channel synergistic protection of GES-1 cells. In addition, preliminary qPCR results suggest that PV9 may regulate apoptosis and the TLR4/MyD88/NF-κB signaling pathway. In the future, we will employ omics technologies in conjunction with gene and protein-level signaling pathway validation to elucidate the molecular mechanisms underlying PV9’s antagonistic effects against Helicobacter pylori infection in vivo.

Methods

Materials

Rice bran protein peptide PVLWGVPKG (PV9) was bought from Shanghai Qiangyao Biotechnology Co., Ltd. (Shanghai, China). H. pylori 43504 was purchased from American Type Culture Collect (ATCC). Total RNA Kit II R6934 was purchased from Omega BioTek Co., Ltd. (Norcross, Georgia, USA). PrimeScript™ IV 1st strand cDNA Synthesis Mix 6215 was bought from Takara Biomedical Co., Ltd. (Beijing, China). PowerUp™ SYBR™ Green Master Mix was obtained from Thermo Fisher Scientific (Waltham, Massachusetts, USA). ELISA kits were bought from Shanghai Jianglai Biotechnology Co., Ltd. (Shanghai, China). JC-1 mitochondrial membrane potential kit, cell cycle PI kit, and Annexin V-FITC apoptosis kit were obtained from Beyotime Biotechnology Co., Ltd. (Shanghai, China).

H. pylori culture

H. pylori (ATCC43504) was mixed and diluted with soybean peptone broth liquid medium and then inoculated on soybean peptone agar inclined medium containing 5% defibrinated sheep blood. The strain was cultured at 37 °C, 5% O₂, 10% CO₂, and 85% N₂ for 48 h. For subsequent test use.

GES-1 cell culture

GES-1 cells were cultured with RPMI-1640 containing 10% fetal bovine serum at 37 °C and 5% CO₂ for 48 h and then passed and tested when the cell adhesion length reached 70-80%.

Effect of PV9 on the survival rate of GES-1 cells

GES-1 cells were inoculated into 96-well plates according to 1×10⁵ cells/mL cell density, 100 μL cell suspension was added to each well, and the control group and experimental group were set up with 6 compound pores in each group. Follow-up tests were conducted when the cell fusion reached 80%. PV9 was dissolved in serum-free RPMI-1640 medium to prepare a solution with a mass concentration of 1 mg/mL, diluted to the required concentration (10, 25, 50, and 100 μg/mL), and then filtered through a 0.22 μm filter membrane to remove bacteria. The culture medium in the plate was cleaned with 100 μL PBS, the experimental group was added with 100 μL PV9 solution with the corresponding concentration, and the control group was added with 100 μL RPMI-1640 medium and cultured at 37 °C and 5% CO₂ for different times (6, 12, and 24 h). After culturing to the end of the corresponding time, 10 μL MTT solution (5 mg/mL) was added to each well and incubated in the incubator for 4 h. The medium was sucked away, and 150 μL DMSO solution was added, and the absorption value was determined at 570 nm with an enzyme marker, which was recorded as A_Control and A_Sample. Cell survival rate was calculated. The Eq. (1) is as follows:

$$\mathrm{Cell}\mathrm{viability}\left(\%\right)=\frac{{\text{A}}_{\text{Sample}}}{{\text{A}}_{\text{Control}}}\times 100$$ 1

The changes of PV9 in GES-1 cells were analyzed by liquid chromatography-mass spectrometry

GES-1 cells were inoculated into 96-well plates with a cell density of 1×10⁵ cells/mL, and 100 μL cell suspension was added to each well. Follow-up tests were performed when the cell fusion reached 80%. PV9 solution with a final concentration of 50 μg/mL was prepared by dissolving PV9 in serum-free RPMI-1640 medium and filtering through a 0.22 μm filter membrane. Culture medium was added with 200 μL PV9 solution in each well and cultured for different times (0, 0.5, 1, 2, 4, 8, 12, and 24 h). After culturing for the corresponding time, 100 μL PV9 solution was taken from each well and vacuum freeze-dried for use.

The vacuum freeze-dried sample was added to a 5% methanol-aqueous solution at a constant volume of 200 μL and centrifuged at 4 °C and 10,000 × g for 15 min. After centrifugation, 2 μL supernatant was taken into the sample. The dynamic changes of PV9 in GES-1 at different time periods were detected by LC-MS/MS.

Molecular docking analysis of the binding ability of PV9 and its degradation fragments to H. pylori adhesion protein

By using molecular docking technology, the docking activity centers of PV9 and its degradation fragments and two key adhesion proteins (BabA and SabA) on the surface of H. pylori, were predicted, and the key sites of binding between these peptides and adhesion proteins were analyzed. Adhesion proteins BabA (PDB ID: 4ZH0) and SabA (PDB ID: 4O5J) were obtained from the PDB database. The crystal structure was prepared by using Pymol to remove the original ligand protein and crystal water to obtain the three-dimensional target structure of the adhesion protein. AutoDock Tools 1.5.6 was used to optimize the three-dimensional structure of the target protein and add hydrogen atoms as docking receptors. Combining POCASA 1.1 (https://g6altair.sci.hokudai.ac.jp)⁷¹ according to a report in the existing predicted protein binding site, set up the target-protein related working parameters for docking: BabA (center X: 14.395, center Y: 12.272, center Z: 43.347), SabA (center X: 90.697, center Y: -15.156, center Z: -2.741). ChemDraw was used for structure drawing and energy optimization of PV9, and AutoDock Vina 1.1.2 was used for molecular docking. Finally, Pymol and Discovery Studio 2019 were used to visualize the docking result⁷².

Determination of anti-adhesive activity of PV9 against H. pylori

According to previous reports, the anti-adhesive activity of rice bran protein peptide PV9 against H. pylori was determined²⁴. H. pylori was first labeled with FITC, and the concentration of the bacterial solution was diluted to 1 × 10⁸ CFU/mL for use. PV9 was prepared using serum-free RPMI-1640 medium for sample preparation and was filtered through a 0.22 μm filter membrane for bacteria removal. The prepared PV9 solution was mixed with the diluted bacterial solution in equal proportion, so that the final concentration of PV9 solution was 4 mg/mL, and the PV9 solution was incubated at room temperature for 30 minutes away from light.

GES-1 cells were inoculated into 96-well plates according to the cell density of 3×10⁵ cells/mL, 100 μL of cell suspension was added to each well, and the control group and experimental group were set up with 6 compound wells in each group. Follow-up tests were conducted when the cell fusion reached 80%. Added 100 μL of 0.1 mol/L sterile PBS (pH 7.4) to each hole of the culture medium for cleaning once, added 100 μL of a mixture of H. pylori and PV9 to each hole, and incubated for 90 min away from light. After incubation, added 100 μL of 0.1 mol/L sterile PBS (pH 7.4) to each well and washed three times to remove free H. pylori. Finally, 100 μL of 0.1 mol/L sterile PBS (pH 7.4) was added to each well to determine the fluorescence intensity of each well, and the number of H. pylori in each well was obtained according to the standard curve. The control group was replaced by serum-free RPMI-1640 medium. The Eq. (2) is as follows:

$$\text{Anti}-\mathrm{adhesive}\mathrm{activity}(\%)=\frac{\text{number}\text{of}H.pylori\text{of}\text{control}-\text{number}\text{of}H.pylori\mathrm{of}\mathrm{sample}}{\text{number}\text{of}H.pylori\mathrm{of}\mathrm{control}}\times 100$$ 2

Confirmation of the binding between PV9 and adhesin proteins

The binding between PV9 and adhesin proteins was analyzed using Smart Blotter SB-10 (Wealtec, Nevada, USA). The assay was determined according to Li et al., with minor modifications²⁴. PVDF membrane (0.22 μm) was spotted with 2 μg compounds, which included Sialyl-Lewis^x-HSA (ProductNo 61/66, IsoSep AB, Lund, Sweden) and Lewis^b-HSA (ProductNo 61/08, IsoSep AB, Lund, Sweden). HSA was included as a negative control. FITC was dissolved in DMSO at a concentration of 2 mg/mL and treated with a 0.22 μm filter for sterilization. The FITC solution was mixed with H. pylori suspension, and then the mixture was incubated in the dark for 30 minutes with moderate shaking. The mixture was precipitated to end the labeling operation (4500 × g, 5 min), washed three times with PBS buffer (100 mmol/L, pH 7.4), and removed free FITC. Finally, the labeled-H. pylori solution was diluted with PBS buffer (100 mmol/L, pH 7.4) until the OD_600nm value was about 0.2. The PV9 (4 mg/mL) and the labeled-H. pylori were mixed and incubated.

The PVDF membrane was blocked in TBS (100 mmol/L, pH 7.4, 5% BSA) for 60 min at room temperature. The membrane was incubated with the labeled-H. pylori suspension for 30 min in the dark at room temperature, then washed three times with TBST buffer for 10 min in the dark. The membrane was observed with the Amersham ImageQuant 800 System (Cytiva, USA).

Effect of PV9 on ROS content in GES-1 cells induced by H. pylori infection

GES-1 cells were inoculated into 6-well plates according to 1×10⁶ cells/mL, and 1 mL cell suspension was added to each well. The control group, H. pylori infection model group, and PV9 experimental group were cultured overnight. After cell growth and fusion, the original culture medium was discarded, and 1 mL PV9 solution of different concentrations (10, 25, and 50 μg/mL) was added to each well of the PV9 experimental group, and 1 mL RPMI-1640 medium was added to the control group and the model group, respectively. After the 6-well plates were placed in an incubator at 37°C and 5% CO₂ for 24 h, 1 mL H. pylori bacterial solution was added to the remaining holes according to the infection number = 100:1, and 1 mL RPMI-1640 medium was added to the control group, and the 6-well plates were placed in the incubator for 12 h. The cells were collected and centrifuged at 600 × g for 5 min. 1 mL DCFH-DA fluorescent probe solution with a concentration of 10 μM was added to each well to re-suspend the cells. The cells were incubated at 37 °C for 20 min, gently shaken and mixed once every 5 min, and the probe solution was sucked up after incubation. After 2 times of washing with 1 mL RPMI-1640 medium, 500 μL RPMI-1640 medium was added to each well, and the ROS content in each group was detected by flow cytometry.

Effect of PV9 on mitochondrial membrane potential of GES-1 cells induced by H. pylori infection

GES-1 cells were grouped and cultured according to experiment 3.9. After culture, the cells were collected and centrifuged at 4 °C, 600 × g for 4 min. The cells were treated according to the JC-1 detection kit. The effect of PV9 on the mitochondrial membrane potential of GES-1 cells induced by H. pylori infection was analyzed by flow cytometry.

Effect of PV9 on GES-1 cell cycle induced by H. pylori infection

GES-1 cells were grouped and cultured according to experiment 3.9. After culture, the cells were collected, washed with pre-cooling PBS, centrifuged at 1000 × g for 5 min, treated according to the cell cycle PI detection kit, and the effect of PV9 on GES-1 cell cycle induced by H. pylori infection was analyzed by flow cytometry.

Determination of PV9 on GES-1 cell apoptosis induced by H. pylori infection

GES-1 cells were grouped and cultured according to experiment 3.9. After culture, cells were collected, washed with pre-cooled PBS, centrifuged at 1000 × g for 5 min, and treated with the Annexin V-FITC apoptosis detection kit. Flow cytometry was used to analyze the effect of PV9 on the apoptosis of GES-1 cells induced by H. pylori infection.

Effect of PV9 on oxidative stress-related factors in GES-1 cells induced by H. pylori infection

GES-1 cells were grouped and cultured according to experiment 3.9. After the culture, the cells were collected and broken by ultrasound, and the supernatant was obtained by centrifugation. The levels of lactate dehydrogenase (LDH), malondialdehyde (MDA), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), and catalase (CAT) in each group were determined by ELISA.

Effect of PV9 on inflammatory factors of GES-1 induced by H. pylori infection

GES-1 cells were grouped and cultured according to experiment 3.9. After the culture, the cells were collected and broken by ultrasound, and the supernatant was obtained by centrifuging. The levels of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), interleukin-8 (IL-8), interleukin-10 (IL-10), and interleukin-18 (IL-18) in each group were determined by ELISA.

Effect of PV9 on mRNA expression of related factors in GES-1 cells induced by H. pylori infection

GES-1 cells were grouped and cultured according to experiment 3.9. After culture, total RNA was extracted from cells by the Trizol method, and cDNA was generated by reverse transcription. GAPDH was used as a reference gene. The control group is normalized to a value of 1, and the relative mRNA expression was calculated using the 2^–ΔΔCt method. The mRNA expression levels of Bcl-2, Bcl-xl, Bax, Bad, TLR4, MyD88, NF-κB, and NF-κB p65 in each group were determined by qRT-PCR. The primer sequence is shown in Table 2.

Table 1.

Affinity and binding sites of PV9 and its degradation fragments with adhesins

Sequence	BabA-peptides docking result				SabA-peptides docking result
	Affinity (kcal/mol)	van der Waals	Hydrogen bond	Hydrophobic interaction	Affinity (kcal/mol)	van der Waals	Hydrogen bond	Hydrophobic interaction
PVLWGVPKG (PV9)	−6.2	CYS189* SER190 ASP192 GLY193 ASN195 SER199 VAL201 ASN206* VAL231 TYR245	GLY191* ASN194* SER198 GLN200 GLN207 SER244* THR246*	LYS208	−7.7	SER98 GLY102 ASN103 GLN123 GLN159* ALA160 THR163 ASN164 THR333	TRP97* LYS152* GLU156 SER165 ASN334 PRO335 GLN338	LEU94 ALA155 LYS168 PRO332 TYR336 ARG337
VP	-5.1	CYS189* SER190 GLY191* GLY193 ASN195 CYS197 SER198 TYR245	ASN194* GLN207 THR246*	VAL231	-6.0	GLY102 ASN103 LYS152* ALA155 GLN159*	SER98 ASN334	LEU94 TRP97* PRO332 PRO335 TYR336
WG	-6.1	LYS119 THR188 SER190 VAL243 TYR245	ASN123 SER130 THR131 SER132	ILE121 THR241	−6.8	SER98 LYS152* ALA155 GLU156 GLN159* ALA321 TYR322 LYS324 PRO332 ASN334 PRO335	GLY102 ASN103	LEU94 TRP97* TYR336
VL	-5.1	SER190 GLY191* ASP192 ASN194* GLN207 LYS208	CYS189* SER244* TYR245 THR246*	VAL231	-5.6	GLY102 ASN103 LYS152* PRO335	SER98 GLN159* ASN334 TYR336	LEU94 TRP97* ALA155 PRO332
PVL	-5.6	CYS189* GLY191* ASN195 SER198 GLN207 SER244* TYR245	SER190 GLY193 ASN194* THR246*	ASP192 VAL231	−7.0	LYS152* ALA155 GLN159* TYR322 LYS324 PRO332 ASN334 PRO335	SER98 GLY102 ASN103	LEU94 TRP97* TYR336
WGVP	-6.3	SER190 GLY191* GLY193 ASN195 CYS197 SER198 GLN207 VAL231 TYR245	CYS189* ASN194* SER244* THR246*	ASP192	−8.3	GLY102 ASN103 ALA155 SER165 PRO335 ARG337 GLN338	SER98 LYS152* GLN159* ASN334 TYR336	LEU94 TRP97* THR163 LYS168 PRO332

^*The binding site overlapped with relevant reports.

Statistical analysis

All results were expressed as mean ± standard deviations (SD), and statistical comparisons were performed using one-way analysis of variance (ANOVA), and Dun-can’s test was used as a post-hoc test following ANOVA. SPSS Statistics 26 (SPSS Inc., USA) was used to analyze the data. Significant differences were considered at p <0.05.

Author contributions

Guanlong Li: Conceptualization, Investigation, Methodology, Formal analysis, Writing-original draft, and Funding acquisition. Quanxin Wang: Formal analysis, analyzed the data, and Investigation. Xiaolan Liu: Writing-review and editing, Methodology, and Funding acquisition. Zhengfei Miao: Analyzed the data, Formal analysis, and Visualization. Zhe Wang: Analyzed the data, Formal analysis, and Methodology. Xiqun Zheng: Resources, writing review and editing, and Experimental design.

Data availability

The datasets generated and/or analyzed during the current study are not publicly available because they are part of an institutional database for ongoing projects, but are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.