Skip to main content
NCBI home page
Springer logoLink to Springer
. 2026 Aug 21;125(1):114. doi: 10.1007/s00436-026-08742-x

Molecular investigation of tick-borne pathogens in Ixodes ricinus feeding on lizards in the Central Pyrenees, Spain

Sofia M Soares 1,✉, Marta Sánchez-Sánchez 2, Ruth Rodríguez-Pastor 1, Clara Muñoz-Hernández 2, Alberto Moraga-Fernández 2, Laura Colorado 3, Henar Alonso 4, María Paz Peris 1,5, Patrick S Fitze 3,6, Isabel G Fernández de Mera 2, Javier Millán 1,7,8
PMCID: PMC13615137  PMID: 42789116

Abstract

Ixodes ricinus is the most widespread tick species in Europe, parasitizing a broad range of vertebrate hosts, including reptiles. However, the role of lizards in the ecology of tick-borne pathogens remains poorly understood. This study investigated tick infestation levels and the occurrence of tick-borne pathogens in I. ricinus feeding on European common lizards (Zootoca vivipara louislantzi) in the central Pyrenees, Spain. A total of 137 lizards were captured in summer and spring of 2024 at two sites (~ 1700 m.a.s.l.). Tick infestation prevalence was 98.5% and a mean abundance of 5.8 ± 7.0 ticks. Infestation was significantly higher in males, adults, and during spring. Molecular screening of 525 ticks (188 pools) using real-time and conventional PCR protocols detected Rickettsia spp. DNA in 15.4% pools, with an overall minimum infection rate (MIR) of 5.52%, with stage-specific MIRs of 4.79% in larvae and 7.81% in nymphs. Sequencing of 14 amplicons identified Rickettsia helvetica (n = 11) and Rickettsia monacensis (n = 3). Babesia DNA was detected at low prevalence (MIR: 0.38%) and sequences clustered within the Babesia divergens-Babesia capreoli complex. No Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum DNA was detected. Our findings show that lizards can sustain high levels of I. ricinus infestation, constituting a reliable bloodmeal source for ticks infected with Rickettsia and Babesia in the mountain ecosystems of the Pyrenees. Although the lizard’s role in pathogen transmission remains to be clarified, its consistent exposure to immature ticks highlights its potential value as a sentinel species for monitoring tick-borne pathogen circulation in high-altitude environments.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s00436-026-08742-x.

Keywords: Alpine, Lyme disease, Reptile, Rickettsia

Highlights

High infestation levels of Ixodes ricinus were recorded on the European common lizard from high-altitude sites in the Pyrenees.

Infestation patterns varied significantly by host sex, age and season.

Rickettsia helvetica, Rickettsia monacensis and Babesia divergens-Babesia capreoli complex were detected in ticks feeding on lizards.

No DNA of other major tick-borne pathogens screened (including Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum) was detected.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s00436-026-08742-x.

Introduction

Ixodes ricinus is the most widespread tick species in Europe, displaying a broad host range, with immature stages commonly parasitizing small mammals, birds, and reptiles (Kahl and Gray 2023). Although the ecology of I. ricinus has been extensively studied, the role of reptiles has historically been underestimated compared with other hosts. However, studies have reported high levels of tick infestation in lizards, suggesting that reptiles may play a more significant role in the tick’s life cycle than previously recognized (Amore et al. 2007; Tomassone et al. 2017). Beyond serving as bloodmeal hosts, lizards may also serve as reservoirs for tick-borne pathogens (Dsouli et al. 2006; De Sousa et al. 2012; Norte et al. 2015). Notably, I. ricinus feeding on lizards has been shown to harbor multiple pathogens, including Borrelia spp., Rickettsia spp. and Anaplasma spp. emphasizing their potential epidemiological importance (Ekner et al. 2011; Václav et al. 2011; Tomassone et al. 2017).

The Borrelia burgdorferi sensu lato (s.l.) complex represents the most widespread group of tick-borne bacteria in Europe and includes several species associated with reptiles. In ticks collected from lizards, different members of this complex have been identified, but only Borrelia lusitaniae has been detected in lizard tissue samples (Majláthová et al. 2006, 2008; Földvári et al. 2009; Tijsse-Klasen et al. 2010). Consequently, it is considered to be maintained within natural cycles involving lizards as reservoirs and I. ricinus as the main vector (Amore et al. 2007; Norte et al. 2015). This potentially pathogenic species (Collares-Pereira et al. 2004) has been detected in questing ticks in the north-western regions of Spain (Díaz et al. 2017; Remesar et al. 2019a, b), although it has not yet been reported in Iberian lizards.

In Europe, Rickettsia monacensis and R. helvetica, both members of the spotted fever group (SFG), have been detected in ticks feeding on lizards as well as in lizard tissues, suggesting that reptiles may act as reservoir hosts (Tijsse-Klasen et al. 2010; De Sousa et al. 2012; Tomassone et al. 2017). Nevertheless, studies investigating the role of lizards in the ecology of Rickettsia remain limited and are especially scarce in the Iberian Peninsula (De Sousa et al. 2012; Kubelová et al. 2015; Tomassone et al. 2017; Mendoza-Roldan et al. 2021).

Other tick-borne bacteria have occasionally been associated with European lizards, including some Anaplasmataceae (Ekner et al. 2011; Köhler et al. 2023; Václav et al. 2011). The presence of Ehrlichia spp. and Coxiella burnetii was investigated in ticks attached to reptiles in Italy, but only a single tick tested positive for Ehrlichia sp.(Mendoza-Roldan et al. 2021).

Moreover, tick-borne protozoa have received even less attention in studies of lizard-tick associations. In particular, Babesia spp., which comprise several species transmitted by I. ricinus (Gray et al. 2019), are usually not investigated in ticks feeding on lizards. Only a few studies have addressed this topic, including the pathogen screening of ticks collected from sand lizards (Lacerta agilis) in the Netherlands (Tijsse-Klasen et al. 2010; Köhler et al. 2023), where Babesia was either not detected or detected at very low prevalence.

The European common lizard or viviparous lizard (Zootoca vivipara) is the most widely distributed terrestrial reptile worldwide, with Iberian populations located in the southwest of its range, where it frequently inhabits montane ecosystems (Horreo et al. 2021). This species exhibits a relatively small home range, approximately 15 m in radius, with variation by age and sex (Lecomte et al. 1994; Massot and Clobert 2000). Such limited spatial movement makes it a useful model for studying local interactions between hosts, ticks, and the pathogens they harbor. Given the overlap between the habitats occupied by I. ricinus and the common lizard, this species may play a significant role in the maintenance of ticks and the pathogens they carry.

The Pyrenees constitute a mountainous region, where I. ricinus is abundant (Alonso-Carné et al. 2016; Estrada-Peña 2001). However, data from the Spanish Pyrenees remain scarce, particularly regarding reptile-associated tick-pathogens. In this study, we analyzed I. ricinus infestation levels in the European common lizard (Zootoca vivipara louislantzi) and used feeding ticks to investigate the presence of vector-borne pathogens in the central Pyrenees, Spain.

Materials and methods

Field methods

The study was carried out in the central Pyrenees at two sites in the Huesca province (Aragón Autonomous Region): site 1 in Somport (42°47’N, 0°31’W) and site 2 in Candanchú (42°46’N, 0°32’W), located at approximately 1650 m and 1680 m above sea level (a.s.l.), respectively. The study sites were purposefully selected due to the presence of monitored populations of the common lizard known to be infested with ticks (Peñalver-Alcázar et al. 2016).

The sites are characterized by meadows and grasslands with a predominance of herbs and small shrubs (Peñalver-Alcázar et al. 2016), being popular year-round tourist destinations for hiking, climbing and skiing. Lizards were captured by hand (Peñalver‐Alcázar et al. 2016), during two sampling sessions in 2024: one conducted in late spring (June) at site 1 and in summer (August) in both sites. A total of 137 common lizards were examined, including 33 captured in June and 104 in August, with 112 at site 1 and 25 at site 2. Each captured lizard was characterized by sex and age, as well as classified as either adult (> 2 years) or juvenile (< 2 years) (Le Galliard et al. 2005). The distribution of individuals by site, season, age class and sex is presented in Table 1.

Table 1.

Number of common lizards (Zootoca vivipara louislantzi) captured by site, season, age and sex groups in the Central Pyrenees, Spain. Two individuals could not be assigned to sex and are included in the total counts

Site Season Age class Female Male

Site 1

(Somport)

 Spring Adult 13 8
Juvenile 7 3
Summer Adult 31 13
Juvenile 19 16

Site 2

(Candanchú)

 Summer Adult 15 0
Juvenile 10 0
Open in a new tab

Attached ticks were carefully removed using tweezers and placed into plastic vials containing 95% ethanol and stored at room temperature. After careful examination, each lizard was released at its original capture site. Tick species and life-stage were determined using the morphological keys on Estrada-Peña et al. (2017).

Molecular methods

A total of 801 ticks (662 larvae and 139 nymphs) were collected. For pathogen screening, ticks were grouped into separate pools of larvae and nymphs (maximum of five ticks per pool) from the same host. A maximum of one pool per lizard and life stage was included. This resulted in 525 ticks (397 larvae and 128 nymphs) distributed in 188 pools (156 pools of larvae and 32 pools of nymphs).

Tick pools were first homogenized in a 0.2-ml sterile microtube containing ten 0.1-mm zirconia microbeads and one 3.2-mm sterile stainless steel microbead (BioSpec, Bartlesville, OK, USA) in a Mini Bead Beater-16 (Model 607-EUR, BioSpec, Bartlesville, OK, USA) for two cycles of one minute and thirty seconds at 3450 rpm. Genomic DNA was then extracted using the QIAGEN DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA), following the manufacturer’s instructions. The final elution volume was 100 µl.

All samples were initially screened for tick-borne pathogens using the VIASURE Tick-Borne Diseases panel from CerTest Biotec (Spain), a probe-based multiplex real-time PCR provided in two 8-well strip assays and including an internal control (IC) to monitor amplification performance and potential inhibition. The panel allows the detection of Borrelia burgdorferi s.l./Borrelia miyamotoi and/or Borrelia hermsii (23 S rRNA), Anaplasma phagocytophilum (msp2), Coxiella burnetii (IS1111), Rickettsia spp. (23 S rRNA), Babesia microti (CCT-eta), Babesia divergens (hsp70), and Ehrlichia chaffeensis/Ehrlichia muris (groEL) using specific primers and fluorescent-labelled hydrolysis probes.

Each reaction was run in a final volume of 20 µL per well, prepared by adding 15 µL of Rehydration Buffer to each lyophilized well and 5 µL of extracted DNA (samples or controls). A positive control and a negative (no-template) control were included in each run. The thermal profile consisted of 95 °C for 2 min, followed by 45 cycles of 95 °C for 10 s and 60 °C for 50 s, with fluorescence acquisition during the 60 °C step. Amplification was performed on the CFX Opus 96 Real-Time PCR System (Bio-Rad, USA), and data were analyzed using Bio-Rad CFX Maestro software (version 2.3). Result interpretation followed the manufacturer’s criteria: a sample was considered positive when it showed a typical sigmoidal amplification curve with Ct < 40 in the corresponding target channel, with a valid IC signal when applicable.

Subsequently, all DNA pools were screened for Rickettsia spp. by conventional PCR (cPCR), targeting a 416-bp fragment of the 16 S ribosomal RNA (16 S rRNA) gene, independently of the real-time PCR results. Samples that scored positive were further confirmed and characterized by Rickettsia-specific conventional PCR assays amplifying recombinase A (recA) and adenosine triphosphate synthase alpha subunit (atpA) gene fragments (Table 2). In contrast, only DNA pools that tested positive for B. microti/B. divergens real-time PCR were subjected to cPCR for molecular characterization by amplifying a partial fragment of the 18 S ribosomal (18 S rRNA) gene (Table 2). For all cPCR assays, the reaction mixture consisted of 2X PCR Master Mix (Promega Corporation, USA), 1 µL of each primer at 10 µM, 1 µL of DNA, and nuclease-free water, totaling 25 µL. Primers and thermocycling conditions are detailed in Table 2, and all assays were carried out in a Bio-Rad C1000 Touch Thermal Cycler (Bio-Rad, USA). Amplicons were visualized in 1.5% agarose gels stained with GelRed (Biotium, USA). A pool was considered positive to Rickettsia spp. if tested positive to 16 S rRNA, atpA and recA assays. Bands at the expected size for recA and atpA (Rickettsia spp.) and 18 S rRNAf (Babesia spp.) gene fragments were sent for purification and Sanger sequencing (Macrogen, Spain). Chromatograms were visualized using Chromas 2.6.6 software (Technelysium Pty Ltd, Australia) to edit nucleotide sequences. The level of similarity between the nucleotide sequences obtained in this study and those deposited in the NCBI GenBank database was evaluated using the Nucleotide BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Table 2.

Primers and conditions used for the amplification and characterization of Rickettsia spp. and Babesia spp. in Ixodes ricinus feeding on common lizards (Zootoca vivipara louislantzi) in the Central Pyrenees, Spain

Gene target1 Primers Size (bp) Annealing conditions Reference
Name Sequence (5’ – 3’)
Rickettsia spp.
16 S ribosomal RNA (16 S rRNA) fD1 AGAGTTTGATCCTGGCTCAG 416 30 s at 54 °C Weisburg et al. (1989)
Rc16 AACGTCATTATCTTCCTTGC
Recombinase A gene (recA) F TGCTTTTATTGATGCCGAGC 428 30 s at 52 °C Fernández de Mera et al. (2009)
R CTTTAATGGAGCCGATTCTTC
Adenosine triphosphate synthase alpha subunit gene (atpA) F ACATATCGAGATGAAGGCTCC 731 30 s at 48 °C Fernández de Mera et al. (2009)
R CCGAAATACCGACATTAACG
Babesia spp.
18 S ribosomal RNA (18 S rRNA) PIRO F CCAGCAGCCGCGGTAATTC 360 45 s at 64 °C Tabar et al. (2008)
PIRO R CTTTCGCAGTAGTTYGTCTTTAACAAATCT
Open in a new tab

A Maximum Likelihood phylogenetic tree was generated using Molecular Evolutionary Genetics Analysis 10 (MEGA X) software to confirm the species identification of Rickettsia spp. (Kumar et al. 2018). Concatenated partial fragments of atpA and recA genes were used to construct the phylogenetic tree, which allowed for improving phylogenetic resolution and robustness (Vitorino et al. 2007). Alignments of our nucleotide sequences, together with reference sequences retrieved from GenBank, were performed using the ClustalW tool implemented in Ugene software. The evolutionary history was inferred using the Tamura 3-parameter substitution model, which had the lowest Bayesian Information Criterion (BIC) values. A discrete Gamma distribution was used to model evolutionary rate differences among sites. Statistical support for tree topology was assessed through bootstrap analysis with 1000 replicates.

Statistical analysis

A descriptive analysis was conducted to calculate the prevalence of infestation with 95% Clopper-Pearson confidence intervals, the mean tick abundance and the mean tick intensity, each reported with the corresponding standard deviation. All metrics were calculated separately for larvae, nymphs, and overall infestation. Parasitological terms (e.g., prevalence, mean abundance and mean intensity) follow the standardized definitions proposed by Bush et al. (1997).

Tick abundance was analysed using generalized linear models (GLMs) with a negative binomial distribution, using separate models for total, larval, and nymphal tick infestation. Predictor variables included sex (female, male), age class (juvenile, adult), and a combined site–season factor to control for potential confounding effects between these variables, since site 2 was sampled only in summer. Three individuals for which sex could not be determined were excluded from the analysis, resulting in a total sample size of 134 lizards. To explicitly test for seasonal differences, an additional model restricted to site 1 (the only site sampled in both spring and summer) was fitted with sex, age, and season as predictors. Model coefficients were expressed as incidence rate ratios (IRR) with 95% confidence intervals, and statistical significance was set at p < 0.05 for all tests.

Agreement between the two screening PCR protocols for Rickettsia spp. was evaluated using Cohen’s kappa coefficient to assess concordance beyond chance. The coefficient was calculated to compare the presence or absence of Rickettsia spp. detected by both methods. Kappa values were interpreted according to the guidelines for agreement proposed by Mary L. McHugh (2012).

All statistical analyses were performed in R (version 4.4.0; R Core Team, 2024).

For assessing infection levels in larvae and nymphs, the Minimal Infection Rate (MIR) was calculated under the assumption that each positive pool contained only one infected tick (Estrada-Peña et al. 2021). In the case of Rickettsia spp., the MIR calculated was based on the cPCR results.

Results

Parasite ecology

Overall, 135 out of 137 lizards were infested with ticks (prevalence = 98.5%; 95% CI: 94.8–99.8%). All ticks were larvae or nymphs of I. ricinus, with 54 lizards infested with both stages simultaneously. In total, 801 ticks were collected and identified, of which 662 (83%) were larvae and 139 (17%) were nymphs. Mean tick abundance was 5.8 ± 7.0, and the mean intensity was 5.9 ± 7.0, with a maximum of 41 ticks recorded on a single host (Table 3).

Table 3.

Description of the infestation by Ixodes ricinus in 137 common lizards (Zootoca vivipara louislantzi) captured in the central Pyrenees

Tick stage Larvae Nymphs Overall
% Prevalence (95% CI) 91.9 (86.1–95.9) 45.9 (37.4–54.7) 98.5 (94.8–99.8)
Range 0–37 0–12 0–41
Mean abundance ± SD 4.8 ± 6.1 1.0 ± 1.7 5.8 ± 7.0
Mean intensity ± SD 5.3 ± 6.2 2.2 ± 1.9 5.9 ± 7.0
Open in a new tab

The outcomes of the negative binomial GLMs indicated significant effects of sex and season on total tick abundance (Table 4). Males had higher tick infestations than females (IRR = 1.43, 95% CI = 1.07–1.91, p = 0.017), while adults showed a higher estimated tick abundance than juveniles, although this difference did not reach statistical significance (IRR = 1.31, 95% CI = 0.98–1.74, p = 0.052). Moreover, tick infestation was significantly lower in summer than in spring (IRR = 0.37, 95% CI = 0.27–0.51, p < 0.001).

Table 4.

Results of the negative binomial generalized linear models (GLMs) assessing the effects of sex, age, and site–season on total, larval and nymphal tick infestation. Model estimates (β) with their standard errors (SE) are presented on the log scale. Incidence Rate Ratios (IRRs) are the exponentiated estimates with 95% confidence intervals (CI)

Model Predictor β SE z value p-value IRR 95% CI
Total tick abundance (Intercept) 2.169 0.171 12.7 < 0.001 8.75 6.03–12.81
Sex (Male vs. Female) 0.354 0.148 2.39 0.017 1.43 1.07–1.91
Age (Adult vs. Juvenile) 0.268 0.138 1.95 0.052 1.31 0.98–1.74
Site-season (Site 1 Summer vs. Site 1 Spring) -1.035 0.153 -6.76 < 0.001 0.36 0.26–0.49
Site-season (Site 2 Summer vs. Site 1 Spring) -1.165 0.215 -5.42 < 0.001 0.31 0.20–0.48
Larval abundance (Intercept) 1.99 0.198 10.05 < 0.001 7.31 4.74–11.43
Sex (Male vs. Female) 0.373 0.171 2.18 0.029 1.45 1.04–2.04
Age (Adult vs. Juvenile) 0.193 0.158 1.22 0.222 1.21 0.87–1.68
Site-season (Site 1 Summer vs. Site 1 Spring) -0.983 0.178 -5.51 < 0.001 0.37 0.26–0.54
Site-season (Site 2 Summer vs. Site 1 Spring) -1.062 0.247 -4.31 < 0.001 0.35 0.21–0.57
Nymphal abundance (Intercept) 0.186 0.267 0.7 0.486 1.2 0.69–2.05
Sex (Male vs. Female) 0.312 0.221 1.41 0.159 1.37 0.89–2.10
Age (Adult vs. Juvenile) 0.829 0.243 3.41 < 0.001 2.29 1.43–3.79
Site-season (Site 1 Summer vs. Site 1 Spring) -1.309 0.218 -6.01 < 0.001 0.27 0.18–0.41
Site-season (Site 2 Summer vs. Site 1 Spring) -1.774 0.393 -4.52 < 0.001 0.17 0.07–0.35
Open in a new tab

Note: Reference categories used in the models were: female (sex), juvenile (age), spring (season), Site 1–Spring (site–season)

When modelled separately, male lizards carried more larvae than females (IRR = 1.45, 95% CI = 1.04–2.04, p = 0.029), and larval tick infestations were lower in summer (IRR = 0.37, 95% CI = 0.26–0.54, p < 0.001). Age was not significantly associated with larval infestation (p > 0.05). Adult lizards hosted more nymphs than juveniles (IRR = 2.29, 95% CI = 1.43–3.79, p < 0.001) and nymphal tick infestation was lower in summer than in spring (Site 1 Summer: IRR = 0.27; p < 0.001). No significant association was found between host sex and nymph tick infestation (p > 0.05).

Pathogen detection and identification

The qPCR detected Rickettsia spp. DNA in 30/188 pools (16.0%), from 28 individual lizards, comprising 17 pools of larvae and 13 pools of nymphs. According to the cPCR, Rickettsia spp. DNA was detected in 29/188 pools (15.4%) belonging to 26 lizards, including 19 pools of larvae and 10 pools of nymphs. Overall MIR, based on cPCR-positive pools, was 5.52% (29/525, 95% CI: 2.6–9.5), whereas the MIRs for larvae and nymphs were 4.79% (19/397, 95% CI: 1.8–9.1) and 7.81% (10/128, 95% CI: 0.8–21.0), respectively. Among the 188 samples analyzed with both PCR protocols, 22 were positive in both assays, eight were positive only by qPCR and seven were positive only by cPCR, resulting in a total of 37 pools positive by at least one method. The overall agreement between methods was 92%, yielding a Cohen’s kappa value of 0.70 (95% CI: 0.56–0.84), indicating a moderate level of agreement between the two PCR methods.

Additionally, the qPCR protocol detected DNA of B. microti/B. divergens in 2/188 pools (1.1%) from two lizards, including one larval pool and one nymphal pool. The overall MIR for Babesia sp. was 0.38% (2/525; 95% CI: 0.10–1.38), while larval and nymphal MIRs were 0.25% (1/397; 95% CI: 0.04–1.41) and 0.78% (1/128; 95% CI: 0.14–4.29), respectively.

The sequencing of recA and atpA partial fragments from 14 randomly selected cPCR-positive pools confirmed the presence of R. helvetica and R. monacensis. Rickettsia helvetica DNA was detected in 11 pools (five pools of larvae and six pools of nymphs from 11 different lizards), and R. monacensis DNA was confirmed in three pools (two pools of larvae and one pool of nymphs from three lizards). The recA sequences obtained were 100% identical to those deposited in the GenBank database (LN794217.1, CP113531.1, OZ018776.1), while the identity for atpA sequences ranged from 99.3% to 100% (OZ018776.1). The concatenated atpA and recA fragments obtained from 14 pools and used for phylogenetic analysis yielded four distinct concatenated sequences. One of them were grouped with R. monacensis, while the remaining three were clustered with R. helvetica (Fig. 1). Unique partial sequences identified in this study were deposited in GenBank under the accession numbers PX596871 (Ir5_atpA) and PX596872 (Ir6_atpA).

Fig. 1.

Fig. 1

Open in a new tab

Maximum Likelihood phylogenetic tree of spotted Fever Group Rickettsia nucleotide sequences identified in this study (highlighted in bold and shaded in blue), together with reference sequences from GenBank. The tree was constructed using concatenated partial fragments of atpA and recA genes (1044 base pairs). Rickettsia prowazekii was used as an outgroup. Numbers at nodes indicate bootstrap support (values below 50% are not shown)

On the other hand, partial 18 S rRNA gene fragments were sequenced from two positive pools and the presence of Babesia spp. was confirmed. The sequences obtained showed 99.64% similarity between them and were 100% identical with those deposited in the GenBank database, corresponding to the Babesia divergens complex (Babesia capreoli -MG344755.1-; Babesia sp. FR1 -MZ825347.1-; B. divergens -MK256977.1-). Species-level discrimination within the B. divergens complex was not possible.

No DNA of other tick-borne pathogens targeted by the qPCR panel was detected in any of the analyzed pools, including Borrelia spp., A. phagocytophilum, C. burnetii, and E. chaffeensis/E. muris.

Discussion

This study confirms that the common lizard serves as a host for the immature stages of I. ricinus and may locally sustain high levels of tick infestation in the central Pyrenees. We also demonstrated the presence of tick-borne Rickettsia spp. and Babesia sp. in ticks feeding on this lizard species. The detection of pathogen DNA in feeding ticks does not represent or constitute proof of vectorial competence, nor does it indicate that lizards are hosts of the detected pathogens (Estrada-Peña et al. 2021). However, our findings support that reptiles, particularly lacertid lizards, can be used for the detection of local circulation of tick-borne pathogens.

The prevalence of I. ricinus infestation observed in our study was remarkably high compared to previous reports for common lizards (Wu et al. 2019; Gwiazdowicz et al. 2020). Given that the studied lizard populations were selected due to their known high tick prevalence (Fitze, personal observations), they do not represent average infestation levels across the Pyrenees. Adult common lizards exhibited significantly higher nymphal infestation than juveniles. This may be due to their larger body size and wider home ranges, which increase both surface area for tick attachment and the likelihood of tick exposure (Bauwens et al. 1983; Perry and Garland 2002). Male individuals also carried significantly more ticks than females, which is consistent with previous reports (Dudek et al. 2016; Wu et al. 2019; Gwiazdowicz et al. 2020; Hernández Rojas et al. 2025). Such male-biased infestations are commonly explained by the greater activity and broader home ranges of males, particularly during the mating season (Bauwens et al. 1983; Perry and Garland 2002). In addition, hormonal factors may contribute to increased male susceptibility to ectoparasites, since elevated testosterone levels can suppress immune responses (Salvador et al. 1996). Notably, tick infestation was significantly higher in spring than in summer, coinciding with the common lizard’s reproductive season (Bleu et al. 2013) and the peak activity period of immature I. ricinus (Alonso-Carné et al. 2016).

Rickettsia spp. was the most prevalent pathogen detected in both larvae and nymphs. The presence of infected larvae may result from transovarial transmission, a common feature among Rickettsia species. This mechanism allows the bacteria to persist within tick populations without the need for an infected vertebrate host (Azad and Beard 1998). The MIRs observed in this study were lower than those reported elsewhere. For example, ticks feeding on common lizards in Poland showed MIRs of 23.2% in larvae and 35.3% in nymphs (Dyczko et al. 2024). Similarly, in the Central System Mountains of the Iberian Peninsula, 47% of nymphs and 32% of larvae collected from the Iberian emerald lizard (Lacerta schreiberi) were Rickettsia-positive (Kubelová et al. 2015). Such differences may reflect regional and ecological differences, host species variation, or the pooling of ticks in our study, which can underestimate true infection prevalence.

Sequencing revealed the presence of R. helvetica and R. monacensis, consistent with previous studies indicating I. ricinus as the main vector of both species and the frequent detection of these Rickettsia in I. ricinus ticks in the Iberian Peninsula (Márquez 2008; Milhano et al. 2010; Moerbeck et al. 2022). Rickettsia helvetica has previously been detected in common wall lizard (Podarcis muralis) tissues in northern Italy and in the Madeiran wall lizard (Teira dugesii) from Portugal (De Sousa et al. 2012; Tomassone et al. 2017), demonstrating that lizards can harbor the bacterium. Human infections caused by R. helvetica have been reported in France, Sweden, and Switzerland (Oteo and Portillo 2012). In Spain, this species has been identified in I. ricinus collected from humans (Fernández-Soto et al. 2006; Ibarrondo-Mendiola et al. 2025), but no human clinical cases have been reported to date. Similarly, R. monacensis has been detected previously in lizard tissues in Portugal (De Sousa et al. 2012) and in ticks parasitizing lizards (Kubelová et al. 2015; Tomassone et al. 2017). Rickettsia monacensis is a recognized human pathogen and has been reported in different European countries, including Spain (De Sousa et al. 2022; Jado et al. 2007; Portillo et al. 2015). In a recent study, R. monacensis was identified as the most prevalent Rickettsia species in ticks collected from humans in the Basque Country (Ibarrondo-Mendiola et al. 2025), underscoring its public health importance.

Babesia sp. was detected at low MIR, in concordance with previous studies analyzing questing ticks from the French Pyrenees (0.4%) and other European studies (Akl et al. 2019; Hamšíková et al. 2016; Onyiche et al. 2021; Rosso et al. 2024). Nevertheless, Babesia prevalence may be underestimated. The qPCR assays used were highly species-specific and may not have detected other circulating Babesia lineages, and only cPCR was performed in the tick pools positive for qPCR. Transovarial transmission and transstadial persistence have been documented for B. divergens (Bonnet et al. 2007) and, given the close genetic similarity between B. divergens and B. capreoli, similar transmission patterns are considered likely for the latter (Gray et al. 2019). These transmission routes may therefore partly explain the detection of Babesia DNA.

Although sequencing did not allow discrimination between B. divergens and B. capreoli, the detection of genotypes within this complex is consistent with previous reports from the Pyrenees and other regions of Spain (Akl et al. 2019; Remesar et al. 2019a, b). These two species are associated with partially distinct ecological cycles: B. capreoli is primarily maintained in wild cervids (Andersson et al. 2016; Remesar et al. 2019a, b), whereas B. divergens is historically linked to cattle (Hildebrandt et al. 2021), but is also detected in wild ungulates (Fanelli 2021; Leverett et al. 2025). In the study area, both wild boar (Sus scrofa) and roe deer (Capreolus capreolus) are abundant, alongside other wild ungulates (Herrero et al. 2013; González et al. 2013). This makes the circulation of these piroplasmids expected. Given that B. divergens is a recognized zoonotic agent and the main cause of human babesiosis in Europe (Hildebrandt et al. 2013). Therefore, the detection of B. divergens–capreoli–like genotypes suggests that potentially pathogenic Babesia spp. may circulate in high-altitude recreational areas of the Pyrenees. Nevertheless, the role of reptiles in the ecology of Babesia remains poorly understood. Most research on piroplasmids has focused on mammals, while reptiles and other non-mammalian vertebrates remain largely understudied (Schnittger et al. 2012). Similar low infection rates have been reported in ticks feeding on sand lizards (Tijsse-Klasen et al. 2010).

Notably, no DNA of other major tick-borne pathogens targeted by the VIASURE Tick-Borne Diseases panel (CerTest Biotec) was found. This contrasts with previous studies conducted in the Pyrenees, where a broader diversity of pathogens has been reported in questing I. ricinus, including B. burgdorferi s. l. and A. phagocytophilum (Akl et al. 2019 b). However, data on the presence of tick-borne pathogens in the central Pyrenees remain limited. Therefore, the absence of these pathogens in ticks feeding on common lizards may therefore reflect local ecological conditions or limited circulation of these agents in the studied area. It may also be influenced by the use of a targeted molecular assay designed for specific pathogens, potentially overlooking other circulating tick-borne agents.

Interestingly, no Borrelia DNA was detected in feeding I. ricinus. While several lizard species have demonstrated potential reservoir competence for B. lusitaniae, including the Spanish wall lizard (Podarcis hispanicus) in Portugal (Norte et al. 2015) and the common wall lizard in Tuscany, Italy (Amore et al. 2007). However, the role of the common lizard remains unclear. In Poland, B. lusitaniae DNA was detected in nymphs feeding on common lizards (Dyczko et al. 2024), suggesting possible involvement in local transmission cycles. The absence of Borrelia in our study may therefore reflect either limited local circulation of the pathogen or a lack of capacity of this lizard species to maintain Borrelia in natural systems.

In summary, our findings identify the common lizard as a frequent host of immature I. ricinus in high-altitude Pyrenean ecosystems and show that ticks feeding on this species harbor tick-borne pathogens. Although the reservoir competence of the common lizard for these pathogens remains undetermined, its consistent exposure to infected ticks supports its value as a sentinel species for monitoring local tick-borne pathogen circulation in mountain environments. Further studies are needed to clarify whether this reptile actively contributes to pathogen maintenance or primarily sustains infected tick populations.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (DOCX 3.99 MB) (4MB, docx)

Acknowledgements

This study was partially funded by the EFA100/1 project is 65% co-financed by the European Union through the Interreg VI-A Spain-France-Andorra Programme (POCTEFA 2021-2027). The objective of POCTEFA is to strengthen the economic and social integration of the Spain-France-Andorra border region. MSS was supported by JAE-PRE grant (JAEPR23054-Consejo Superior de Investigaciones Científicas). CMH was supported by a postdoctoral contract from the Junta de Comunidades de Castilla-La Mancha (SBPLY/25/180225/000138) co-financed by the European Social Fund Plus (ESF+). AMF was supported by a postdoctoral contract from University of Castilla-La Mancha (2024-UNIVERS-12849) co-financed by the European Social Fund Plus (ESF+). RRP was supported by a Maria Zambrano postdoctoral contract (aid for the requalification of the Spanish University System, for 2021–2023) funded by the Ministry of Universities and the European Union-NextGenerationEU.

Author contributions

Sofia M. Soares: Writing – original draft, Investigation, Methodology, Formal analysis, Data curation. Marta Sánchez-Sánchez: Writing – review & editing, Resources, Investigation, Methodology, Formal analysis. Ruth Rodríguez-Pastor: Writing – review & editing, Methodology, Visualization, Data curation. Clara Muñoz-Hernández: Writing– review & editing, Resources, Investigation, Methodology, Formal analysis. Alberto Moraga-Fernández: Writing – review & editing, Resources, Investigation, Methodology, Formal analysis. Laura Colorado: Writing – review & editing, Methodology, Investigation. Henar Alonso: Writing – review & editing, Resources.María Paz Peris: Writing – review & editing, Methodology, Investigation, Formal analysis. Patrick S. Fitze: Sample collection, Writing – review & editing, Methodology, Investigation, Visualization. Isabel G. Fernández de Mera: Writing – review & editing, Resources, Investigation, Methodology, Formal analysis. Javier Millán: Writing – review & editing, Methodology, Investigation, Formal analysis, Data curation, Conceptualization, Resources.

Funding

Open Access funding provided thanks to the CRUE-CSIC agreement with Springer Nature. This study was partially funded by the EFA100/1 project is 65% co-financed by the European Union through the Interreg VI-A Spain-France-Andorra Programme (POCTEFA 2021–2027). The objective of POCTEFA is to strengthen the economic and social integration of the Spain-France-Andorra border region. Additional financial support was provided by the Spanish Ministry of Education and Science (PID2020-113428GB-I00, funded by MCIN/AEI/10.13039/501100011033 and by “ERDF A way of making Europe”, European Union) to PSF.

Data availability

The sequence data obtained from this study have been deposited in the GenBank® database (https://www.ncbi.nlm.nih.gov/genbank), under the accession numbers: PX596871 and PX596872.

Declarations

Ethical approval

The capture and handling of lizards was carried out under a license granted by the Gobierno de Aragón (INAGA/500201/24/2024/05882) and with the approval of the used experimental protocols by the same organization (1738/2024). All procedures complied with current Spanish legislation and adhered to the ethical guidelines established by the Association for the Study of Animal Behavior the Animal Behavior Society for the use of animals in behavioral research.

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Akl T, Bourgoin G, Souq M-L et al (2019) Detection of tick-borne pathogens in questing Ixodes ricinus in the French Pyrenees and first identification of Rickettsia monacensis in France. Parasite 26:20. 10.1051/parasite/2019019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alonso-Carné J, García‐Martín A, Estrada‐Peña A (2016) Modelling the phenological relationships of questing immature Ixodes Ricinus (Ixodidae) using temperature and NDVI data. Zoonoses Public Health 63:40–52. 10.1111/zph.12203 [DOI] [PubMed] [Google Scholar]
  3. Amore G, Tomassone L, Grego E et al (2007) Borrelia lusitaniae in Immature Ixodes ricinus (Acari: Ixodidae) Feeding on Common Wall Lizards in Tuscany, Central Italy. J Med Entomol 44:303–307. 10.1603/00222585(2007)44[303:bliiir]2.0.co;2 [DOI] [PubMed] [Google Scholar]
  4. Andersson MO, Bergvall UA, Chirico J et al (2016) Molecular detection of Babesia capreoli and Babesia venatorum in wild Swedish roe deer, Capreolus capreolus. Parasit Vectors 9:221. 10.1186/s13071-016-1503-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Azad AF, Beard CB (1998) Rickettsial pathogens and their arthropod vectors. Emerg Infect Dis 4:179–186. 10.3201/eid0402.980205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bauwens D, Strijbosch H, Stumpel Bauwens AHP et al (1983) The lizards Lacerta agilis and L. vivipara as hosts to larvae and nymphs of the tick Ixodes ricinus. Holarctic Ecol 6(1):32–40. http://www.jstor.org/stable/3682714 [Google Scholar]
  7. Bleu J, Le Galliard JF, Fitze PS et al (2013) Reproductive allocation strategies: A long-term study on proximate factors and temporal adjustments in a viviparous lizard. Oecologia 171:141–151. 10.1007/s00442-012-2401-1 [DOI] [PubMed] [Google Scholar]
  8. Bonnet S, Jouglin M, Malandrin L et al (2007) Transstadial and transovarial persistence of Babesia divergens DNA in Ixodes ricinus ticks fed on infected blood in a new skin-feeding technique. Parasitology 134:197–207. 10.1017/S0031182006001545 [DOI] [PubMed] [Google Scholar]
  9. Bush AO, Lafferty KD, Lotz JM, Shostak AW (1997) Parasitology Meets Ecology on Its Own Terms: Margolis. Revisit J Parasitol 83:575. 10.2307/3284227 [DOI] [PubMed] [Google Scholar]
  10. Collares-Pereira M, Couceiro S, Franca I et al (2004) First Isolation of Borrelia lusitaniae from a Human Patient. J Clin Microbiol 42:1316–1318. 10.1128/JCM.42.3.1316-1318.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. De Sousa R, de Carvalho IL, Santos AS et al (2012) Role of the lizard Teira dugesii as a potential host for Ixodes ricinus tick-borne pathogens. Appl Environ Microbiol 78:3767–3769. 10.1128/AEM.07945-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. De Sousa R, dos Santos ML, Cruz C et al (2022) Rare Case of Rickettsiosis Caused by Rickettsia monacensis, Portugal, 2021. Emerg Infect Dis 28:1068–1071. 10.3201/eid2805.211836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Díaz P, Arnal JL, Remesar S et al (2017) Molecular identification of Borrelia spirochetes in questing Ixodes ricinus from northwestern Spain. Parasit Vectors 10:615. 10.1186/s13071-017-2574-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dsouli N, Younsi-Kabachii H, Postic D et al (2006) Reservoir role of lizard Psammodromus algirus in transmission cycle of Borrelia burgdorferi sensu lato (Spirochaetaceae) in Tunisia. J Med Entomol 43:737–742. 10.1603/0022-2585(2006)43[737:RROLPA]2.0.CO;2 [DOI] [PubMed] [Google Scholar]
  15. Dudek K, Skórka P, Sajkowska ZA et al (2016) Distribution pattern and number of ticks on lizards. Ticks Tick Borne Dis 7:172–179. 10.1016/j.ttbdis.2015.10.014 [DOI] [PubMed] [Google Scholar]
  16. Dyczko D, Krysmann A, Kolanek A, Borczyk B, Kiewra D (2024) Bacterial pathogens in Ixodes ricinus collected from lizards Lacerta agilis and Zootoca vivipara in urban areas of Wrocław, SW Poland—preliminary study. Exp Appl Acarol 93:409–420. 10.1007/s10493-024-00927-2 [DOI] [PMC free article] [PubMed]
  17. Ekner A, Dudek K, Sajkowska Z et al (2011) Anaplasmataceae and Borrelia burgdorferi sensu lato in the sand lizard Lacerta agilis and co-infection of these bacteria in hosted Ixodes ricinus ticks. Parasit Vectors 4:182. 10.1186/1756-3305-4-182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Estrada-Peña A (2001) Distribution, Abundance, and Habitat Preferences of Ixodes ricinus (Acari: Ixodidae) in Northern Spain. J Med Entomol 38:361–370. 10.1603/0022-2585-38.3.361 [DOI] [PubMed] [Google Scholar]
  19. Estrada-Peña A, Mihalca AD, Petney TN (eds) (2017) Ticks of Europe and North Africa. Springer International Publishing, Cham [Google Scholar]
  20. Estrada-Peña A, Cevidanes A, Sprong H, Millán J (2021) Pitfalls in Tick and Tick-Borne Pathogens Research, Some Recommendations and a Call for Data Sharing. Pathogens 10:712. 10.3390/pathogens10060712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Fanelli A (2021) A historical review of Babesia spp. associated with deer in Europe: Babesia divergens/Babesia divergens-like, Babesia capreoli, Babesia venatorum, Babesia cf. odocoilei. Vet Parasitol 294:109433. 10.1016/j.vetpar.2021.109433 [DOI] [PubMed] [Google Scholar]
  22. Fernández de Mera IG, Zivkovic Z, Bolaños M et al (2009) Rickettsia massiliae in the Canary Islands. Emerg Infect Dis 15:1869–1870. 10.3201/eid1511.090681 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Fernández-Soto P, Pérez-Sánchez R, Álamo-Sanz R, Encinas-Grandes A (2006) Spotted fever group rickettsiae in ticks feeding on humans in northwestern Spain: Is Rickettsia conorii vanishing? Annals of the New York Academy of Sciences. Blackwell Publishing Inc., pp 331–333. 10.1196/annals.1374.063 [DOI] [PubMed]
  24. Földvári G, Rigó K, Ria Majlá V et al (2009) Detection of Borrelia burgdorferi sensu lato in lizards and their ticks from Hungary. Vector-Borne Zoonotic Dis 9:331–336. [DOI] [PubMed]
  25. González J, Herrero J, Prada C, Marco J (2013) Changes in wild ungulate populations in Aragon, Spain between 2001 and 2010. Galemys. Span J Mammalogy 25:51–57. 10.7325/Galemys.2013.A5 [DOI] [Google Scholar]
  26. Gray JS, Estrada-Peña A, Zintl A (2019) Vectors of Babesiosis. Annu Rev Entomol 64:149–165. 10.1146/annurev-ento-011118-111932 [DOI] [PubMed] [Google Scholar]
  27. Gwiazdowicz DJ, Gdula AK, Kurczewski R, Zawieja B (2020) Factors influencing the level of infestation of Ixodes ricinus (Acari: Ixodidae) on lacerta agilis and zootoca vivipara (squamata: Lacertidae). Acarologia 60:390–397. 10.24349/acarologia/20204372 [DOI] [Google Scholar]
  28. Hamšíková Z, Kazimírová M, Haruštiaková D, Mahríková L, Slovák M, Berthová L, Kocianová E, Schnittger L (2016) Babesia spp. in ticks and wildlife in different habitat types of Slovakia. Parasit Vectors 9:292. 10.1186/s13071-016-1560-z [DOI] [PMC free article] [PubMed]
  29. Herrero J, Torres RT, Prada C et al (2013) Sustainable monitoring of roe deer in public hunting areas in the Spanish Pyrenees. Syst 22:456–462. 10.5424/fs/2013223-02820 [DOI] [Google Scholar]
  30. Hildebrandt A, Gray JS, Hunfeld K-P (2013) Human babesiosis in Europe: what clinicians need to know. Infection 41:1057–1072. 10.1007/s15010-013-0526-8 [DOI] [PubMed] [Google Scholar]
  31. Hildebrandt A, Zintl A, Montero E et al (2021) Human Babesiosis in Europe. Pathogens 10:1165. 10.3390/pathogens10091165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Horreo JL, Jiménez-Valverde A, Fitze PS (2021) Climatic niche differences among Zootoca vivipara clades with different parity modes: implications for the evolution and maintenance of viviparity. Front Zool 18:32. 10.1186/s12983-021-00403-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ibarrondo-Mendiola P, Vázquez P, Alkorta M et al (2025) Tick Species Identification and Zoonotic Bacteria Detection from Healthcare-Extracted Specimens from Humans in the Basque Country, Northern Iberian Peninsula. Pathogens 14:561. 10.3390/pathogens14060561 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Jado I, Oteo JA, Aldámiz M et al (2007) Rickettsia monacensis and Human Disease, Spain. Emerg Infect Dis 13:1405–1407. 10.3201/eid1309.060186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kahl O, Gray JS (2023) The biology of Ixodes ricinus with emphasis on its ecology. Ticks Tick Borne Dis 14(2):102114. 10.1016/j.ttbdis.2022.102114 [DOI] [PubMed] [Google Scholar]
  36. Köhler CF, Sprong H, Fonville M et al (2023) Sand lizards (Lacerta agilis) decrease nymphal infection prevalence for tick-borne pathogens Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in a coastal dune ecosystem. J Appl Ecol 60:1115–1126. 10.1111/1365-2664.14379 [DOI] [Google Scholar]
  37. Kubelová M, Papoušek I, Bělohlávek T et al (2015) Spotted fever group rickettsiae detected in immature stages of ticks parasitizing on Iberian endemic lizard Lacerta schreiberi Bedriaga, 1878. Ticks Tick Borne Dis 6:711–714. 10.1016/j.ttbdis.2015.06.003 [DOI] [PubMed] [Google Scholar]
  38. Kumar S, Stecher G, Li M et al (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol 35:1547–1549. 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Le Galliard J-F, Fitze PS, Cote J et al (2005) Female common lizards (Lacerta vivipara) do not adjust their sex-biased investment in relation to the adult sex ratio. J Evol Biol 18:1455–1463. 10.1111/j.1420-9101.2005.00950.x [DOI] [PubMed] [Google Scholar]
  40. Lecomte J, Clobert J, Massot M, Barbault R (1994) Spatial and behavioural consequences of a density manipulation in the common lizard 1. Écoscience 1:300–310. 10.1080/11956860.1994.11682255 [DOI] [Google Scholar]
  41. Leverett H, Apaa TT, McFadzean H, Johnson N (2025) Babesia Species Detected in Deer from Southwest England. Pathogens 14:303. 10.3390/pathogens14040303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Márquez FJ (2008) Spotted fever group Rickettsia in ticks from southeastern Spain natural parks. Exp Appl Acarol 45:185–194. 10.1007/s10493-008-9181-7 [DOI] [PubMed] [Google Scholar]
  43. Majláthová V, Majláth I, Derdáková M et al (2006) Borrelia lusitaniae and Green Lizards (Lacerta viridis), Karst Region, Slovakia. Emerg Infect Dis 12:1895–1901. 10.3201/eid1212.060784 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Majláthová V, Majláth I, Hromada M et al (2008) The role of the sand lizard (Lacerta agilis) in the transmission cycle of Borrelia burgdorferi sensu lato. Int J Med Microbiol 298:161–167. 10.1016/j.ijmm.2008.03.005 [DOI] [Google Scholar]
  45. Massot, Clobert (2000) Processes at the origin of similarities in dispersal behaviour among siblings. J Evol Biol 13:707–719. 10.1046/j.14209101.2000.00202.x [DOI] [Google Scholar]
  46. McHugh ML (2012) Interrater reliability: the kappa statistic. Biochem Med (Zagreb) 22:276–282 [PMC free article] [PubMed] [Google Scholar]
  47. Mendoza-Roldan JA, Ravindran Santhakumari Manoj R, Latrofa MS et al (2021) Role of reptiles and associated arthropods in the epidemiology of rickettsioses: A one health paradigm. PLoS Negl Trop Dis 15(2):e0009090. 10.1371/journal.pntd.0009090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Milhano N, de Carvalho IL, Alves AS et al (2010) Coinfections of Rickettsia slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a Safari Park, Portugal. Ticks Tick Borne Dis 1:172–177. 10.1016/j.ttbdis.2010.09.003 [DOI] [PubMed] [Google Scholar]
  49. Moerbeck L, Domingos A, Antunes S (2022) Tick-Borne Rickettsioses in the Iberian Peninsula. Pathogens 11:1377. 10.3390/pathogens11111377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Norte AC, Alves da Silva A, Alves J et al (2015) The importance of lizards and small mammals as reservoirs for Borrelia lusitaniae in Portugal. Environ Microbiol Rep 7:188–193. 10.1111/1758-2229.12218 [DOI] [PubMed] [Google Scholar]
  51. Onyiche TE, Răileanu C, Fischer S, Silaghi C (2021) Global distribution of babesia species in questing ticks: A systematic review and meta-analysis based on published literature. Pathogens 10:1–26. 10.3390/pathogens10020230 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Oteo JA, Portillo A (2012) Tick-borne rickettsioses in Europe. Ticks Tick Borne Dis 3:271–278. 10.1016/j.ttbdis.2012.10.035 [DOI] [PubMed] [Google Scholar]
  53. Peñalver-Alcázar M, Aragón P, Breedveld MC, Fitze PS (2016) Microhabitat selection in the common lizard: implications of biotic interactions, age, sex, local processes, and model transferability among populations. Ecol Evol 6:3594–3607. 10.1002/ece3.2138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Perry G, Garland T (2002) Lizard home ranges revisited: Effects of sex, body size, diet habitat, and phylogeny. Ecology 83:1870–1885. 10.1890/00129658(2002)083[1870:LHRREO]2.0.CO;2 [DOI] [Google Scholar]
  55. Portillo A, Santibáñez S, García-Álvarez L et al (2015) Rickettsioses in Europe. Microbes Infect 17:834–838. 10.1016/j.micinf.2015.09.009 [DOI] [PubMed] [Google Scholar]
  56. R Core Team (2024) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Available at: https://www.r-project.org
  57. Remesar S, Díaz P, Prieto A et al (2019a) Prevalence and distribution of Babesia and Theileria species in roe deer from Spain. Int J Parasitol Parasites Wildl 9:195–201. 10.1016/j.ijppaw.2019.05.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Remesar S, Díaz P, Venzal JM et al (2019b) Longitudinal Study of Infection with Borrelia spp. in Questing Ticks from North-Western Spain. Vector-Borne Zoonotic Dis 19:785–792. 10.1089/vbz.2019.2442 [DOI] [PubMed] [Google Scholar]
  59. Rosso F, Ferrari G, Weil T, Tagliapietra V, Marini G, Dagostin F, Arnoldi D, Girardi M, Rizzoli A (2024) Temporal changes in tick-borne pathogen prevalence in questing Ixodes ricinus across different habitats in the North-Eastern Italian Alps. MicrobiologyOpen 13:e010. 10.1002/mbo3.70010 [DOI] [PMC free article] [PubMed]
  60. Salvador A, Veiga JP, Martin J et al (1996) The cost of producing a sexual signal: testosterone increases the susceptibility of male lizards to ectoparasitic infestation. Behav Ecol 7:145–150. 10.1093/beheco/7.2.145 [DOI] [Google Scholar]
  61. Schnittger L, Rodriguez AE, Florin-Christensen M, Morrison DA (2012) ) Babesia: A world emerging. Infect Genet Evol 12:1788–1809. 10.1016/j.meegid.2012.07.004 [DOI] [PubMed] [Google Scholar]
  62. Tabar M-D, Altet L, Francino O et al (2008) Vector-borne infections in cats: Molecular study in Barcelona area (Spain). Vet Parasitol 151:332–336. 10.1016/j.vetpar.2007.10.019 [DOI] [PubMed] [Google Scholar]
  63. Tijsse-Klasen E, Fonville M, Reimerink JH et al (2010) Role of sand lizards in the ecology of Lyme and other tick-borne diseases in the Netherlands. Parasit Vectors 3:42. 10.1186/1756-3305-3-42 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Tomassone L, Ceballos LA, Ragagli C et al (2017) Importance of Common Wall Lizards in the Transmission Dynamics of Tick-Borne Pathogens in the Northern Apennine Mountains, Italy. Microb Ecol 74:961–968. 10.1007/s00248017-0994-y [DOI] [PubMed] [Google Scholar]
  65. Václav R, Ficová M, Prokop P, Betáková T (2011) Associations Between Coinfection Prevalence of Borrelia lusitaniae, Anaplasma sp., and Rickettsia sp. in Hard Ticks Feeding on Reptile Hosts. Microb Ecol 61:245–253. 10.1007/s00248-010-9736-0 [DOI] [PubMed] [Google Scholar]
  66. Hernández Rojas C, Sonia Olmeda Á, Valcárcel F et al (2025) Contribución de los lacértidos a la distribución de las garrapatas en la península ibérica. Ecosistemas 34(2):2922. 10.7818/ECOS.2922 [DOI]
  67. Vitorino L, Chelo IM, Bacellar F, Zé-Zé L (2007) Rickettsiae phylogeny: a multigenic approach. Microbiol (N Y) 153:160–168. 10.1099/mic.0.2006/001149-0 [DOI] [PubMed] [Google Scholar]
  68. Weisburg WG, Dobson ME, Samuel JE et al (1989) Phylogenetic diversity of the Rickettsiae. J Bacteriol 171:4202–4206. 10.1128/jb.171.8.42024206.1989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Wu Q, Richard M, Rutschmann A et al (2019) Environmental variation mediates the prevalence and co-occurrence of parasites in the common lizard, Zootoca vivipara. BMC Ecol 19:44. 10.1186/s12898-019-0259-3 [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (DOCX 3.99 MB) (4MB, docx)

Data Availability Statement

The sequence data obtained from this study have been deposited in the GenBank® database (https://www.ncbi.nlm.nih.gov/genbank), under the accession numbers: PX596871 and PX596872.

Articles from Parasitology Research are provided here courtesy of Springer

RESOURCES