Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2006 Feb 8.
Published in final edited form as: Oncogene. 2005 Feb 24;24(9):1491–1500. doi: 10.1038/sj.onc.1208307

Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia

K Wade Foster 1,5, Zhaoli Liu 2, Clinton D Nail 3, Xingnan Li 1, Thomas J Fitzgerald 3, Sarah K Bailey 3, Andra R Frost 4, Iuri D Louro 3,6, Tim M Townes 1, Andrew J Paterson 3, Jeffrey E Kudlow 3, Susan M Lobo-Ruppert 3, J Michael Ruppert 1,2,3,*
PMCID: PMC1361530  NIHMSID: NIHMS7908  PMID: 15674344

Abstract

KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions.

Keywords: KLF4, squamous cell carcinoma, dysplasia, doxycycline, MMTV

Introduction

Components of pathways that mediate early steps in tumor progression represent attractive targets for therapy or chemoprevention of cancer (Hanahan and Weinberg, 2000; Sherr, 2004). For certain forms of carcinoma, the pathways that specify epithelial cell fate during development appear to mediate these early steps (Dominguez et al., 1996; Johnson et al., 1996; Kinzler and Vogelstein, 1997; Taipale and Beachy, 2001; Sancho et al., 2003). Klf4, a member of the Kruppel-like family of transcription factors, was identified based upon similarity with other zinc finger proteins (Shields et al., 1996; Garrett-Sinha et al., 1996). Although dispensable for embryonic development, it plays critical roles in specification or function of differentiating epithelial cells. Klf4 transcripts are expressed in suprabasal cells of mouse skin (Garrett-Sinha et al., 1996). Klf4-deficient mice die from dehydration following birth, due to failure of these cells to form a permeability barrier (Segre et al., 1999). As in skin, Klf4 is expressed in suprabasal epithelial cells of the gut, where it is required for specification of mucosecreting goblet cells (Shields et al., 1996; Katz et al., 2002; Sancho et al., 2003).

We previously identified wild-type KLF4 as a transforming activity in cDNA libraries representing human squamous cell carcinoma of the head and neck (HNSCC) (Foster et al., 1999). We showed that KLF4 is up-regulated in HNSCC, particularly within the basal cell layer of adjacent dysplastic epithelium, and in breast cancer (Foster et al., 1999; Foster et al., 2000; Pandya et al., 2004). In contrast, expression is reduced in colorectal carcinoma (Tonthat et al., 1997; Foster et al., 2000; Zhao et al., 2004), and enforced expression inhibited the tumorigenicity of a colon cancer cell line (Dang et al., 2003). These studies suggest that KLF4 may function as either a tumor suppressor or an oncogene, depending upon the tumor type.

Here we show that induction of KLF4 in basal keratinocytes induces outgrowth of dysplastic lesions resembling squamous cell carcinoma (SCC) in situ. A novel, affinity-purified KLF4 antibody (anti-KLF4) gave prominent nuclear staining in these mouse skin lesions and in a subset of human cutaneous SCCs. Consistent with a nuclear role for KLF4, a KLF4-estrogen receptor fusion protein (KLF4-ER) exhibited 4-hydroxytamoxifen (4-OHT)-dependent nuclear localization and conditional transformation in vitro. Taken together, our results identify a model of initiation of epithelial dysplasia that exhibits genetic and molecular similarities with human neoplasia of the skin and oropharynx.

Results

Induction of KLF4 in mouse skin

As transgenic animals carrying constitutive keratin promoters exhibited lethality, we used alternate inducible and constitutive strategies to direct KLF4 to basal cells. KLF4 was linked to a tetracycline response element (TRE) (Figure 1a), and seven founder lines were crossed to mice carrying a keratin 14 (K14)-reverse tetracycline-responsive transcriptional activator (rtTA) transgene (Figure 1b). This X chromosome-linked K14-rtTA was previously shown to direct expression of TRE-linked transgenes to K14-positive cell types (Xie et al., 1999). Induction with doxycycline (dox) yielded a skin phenotype in male animals of two lines, 32831 and 32812. No phenotype was observed in K14-rtTA control animals treated with dox. The results shown below were obtained using 32831 mice, carrying an autosomal TRE-KLF4, although similar results were obtained using 32812 (not shown). A phenotype in TRE-KLF4 females required homozygosity of the K14-rtTA (see below).

Figure 1.

Figure 1

Doxycycline (dox) inducible KLF4 transgenic mouse lines. (a) A transgene composed of the keratin 14 (K14) promoter and the reverse tetracycline-responsive transcriptional activator (rtTA) directs expression of tetracycline response element (TRE)-linked transgenes to K14 positive cell types. Other elements of the TRE-KLF4 transgene include the minimal cytomegalovirus promoter (PminCMV) and an intron (Int) and polyadenylation signal (poly A) from the SV40 genome. (b) Upper panel: Southern analysis of transgenic mouse lines was performed using a human KLF4 cDNA probe derived from the 3′ UTR. Lower panel: PCR analysis used conserved primers derived from different exons to co-amplify mouse genomic DNA and the human transgene. Control DNAs were mouse genomic DNA alone or else mouse DNA admixed with a molar excess of KLF4 cDNA. (c) RT-PCR analysis of KLF4 in mouse skin. The mouse and human PCR products differ in size by 20bp. Genotypes are indicated on the right. (d) Primary keratinocytes were prepared from K14-rtTA;TRE-KLF4 newborn mice (Dlugosz et al., 1995). Dox was added to the culture media for the indicated interval, and total RNA was analyzed by Northern. Ethidium bromide-stained RNA was visualized by irradiation of the filter (below).

To detect human KLF4 transcripts, we utilized the size difference of mouse and human products of reverse transcriptase (RT)-PCR obtained using a pair of conserved primers (Figure 1c, upper panel). Expression of transgene-derived transcripts was comparable to that of endogenous KLF4 at two days (lane 3). By 21 days, a majority of the transcripts were derived from the transgene (lane 5). No product was obtained without addition of RT (lanes 2, 4, and 6), indicating successful removal of genomic DNA from the samples. Detectable transgene expression required both the rtTA (middle panel, lanes 3, 5) and dox (upper panel, lane 1). As for whole skin, Northern analysis of RNA from primary keratinocyte cultures revealed undetectable levels of transgene expression without dox (Figure 1d). Expression was readily detected after 3 hours of induction, and gradually increased until 24 hours.

KLF4 rapidly induces dysplasia and SCC-like skin lesions

Following 2 days of dox treatment, skin morphology was indistinguishable from uninduced animals or control mice (Figure 2a–b). In contrast, at 9 days the skin showed hyperkeratosis, atrophy of the sebaceous glands, cystic degeneration of hair follicles, and hyperplasia (Figure 2c). After 3–4 weeks, we observed crusted skin lesions and moistness and thinning of the pelage of the ventral skin, with hyperplastic, keratinizing epithelium extending into the dermis (Figure 2d). Dysplastic changes included loss of basal cell polarity and delayed maturation of squamous epithelium. By 42 days lesions resembled severe dysplasia or SCC in situ, with hyperchromatic, pleomorphic nuclei and mitotic figures (Figure 2e). Extension of cells into the dermis were similar to superficially invasive SCC, but lacked the invasive property of fully malignant cells and did not efface the adjacent skeletal muscle layer.

Figure 2.

Figure 2

Histology of the skin following induction of KLF4. (a–f) Dox was administered for the indicated interval and ventral skin of male animals was analyzed. The dermo-epidermal junction (DEJ) is marked with a dashed line (c, e). In parallel with these studies, dox was withdrawn between days 21 and 42 (f). (g–h) mRNA in situ hybridization analysis of dysplastic skin lesions. Antisense (AS) or sense control (S) probes for KLF4 were applied to serial sections. Epithelial-mesenchymal boundaries are indicated (panel h, black lines). Scale bar, 100μ. (i–l) Analysis of KLF4 using affinity-purified, polyclonal antibody (anti-KLF4). (i) Dysplastic mouse skin after 4 weeks of induction. (j) Nontransgenic skin was a control. (k–l) Adjacent areas of a human tissue section contained cutaneous SCC (k) or mild dysplasia (l). Scale bar, 100μ.

Progression of dysplastic lesions observed at 21 days to SCC-like lesions required continued induction. Withdrawal of dox on days 21–42 lead to resolution of the phenotype (Figure 2f). RT-PCR revealed no expression of the transgene following withdrawal (not shown).

KLF4 is predominantly nuclear in mouse skin lesions and human cutaneous SCC

mRNA in situ hybridization analysis detected KLF4 in dysplastic mouse epithelium, but not in adjacent mesenchymal cells, consistent with restriction of transgene expression to K14-positive cell types, as previously reported for this K14-rtTA line (Xie et al., 1999)(Figure 2g–h). KLF4 antibody stained a subset of nuclei in this epithelium, and stained more diffusely within the cytoplasm (Figure 2i). Little or no staining was observed in normal mouse skin (Figure 2j), perhaps because only part of the immunizing peptide is conserved.

We previously showed that KLF4 is upregulated in virtually all cases of HNSCC (Foster et al., 1999; Foster et al., 2000). To determine if KLF4 is expressed in cutaneous cancers, we stained 5 cases of SCC and one case of basal cell carcinoma (BCC). Two of the SCCs exhibited prominent nuclear staining, in contrast to weak staining of adjacent epithelium (Figure 2k–l). Three other SCCs and the BCC showed little or no staining, indicating that KLF4 is differentially regulated in skin tumors.

Dysplastic lesions exhibit similarities with SCC

To molecularly characterize the lesions, we analyzed the cytokeratins K14, K1, K16, and K17, and the proliferation marker PCNA in ventral skin (Figure 3). K14, normally confined to the basal cell layer (Figure 3, No dox), stained basal and many parabasal cells after 2 days of induction. By 9–21 days nearly all the epithelial cells were K14 positive.

Figure 3.

Figure 3

Immunostaining of KLF4-induced lesions. The indicated antibodies were applied to sections of ventral skin of males. Arrowheads indicate the DEJ. Asterisks indicate lesions deeper within the dermis that are PCNA-positive and K1-low, similar to human SCC. Scale bar, 100μ.

Prior to induction, PCNA was prominent in basal cells of the interfollicular skin, but low in parabasal cells (Figure 3, No dox). As for K14, PCNA was rapidly induced in parabasal cells of interfollicular skin (Figure 3, 2 days), and largely mirrored K14 at later timepoints. PCNA persisted in basal and parabasal cells within spheres of epithelial cells deep within the dermis (Figure 3, PCNA, 21 days, asterisks).

K1, a marker of early differentiation in interfollicular cells (Figure 3, No dox), was rapidly induced by KLF4 in outer root sheath keratinocytes of the hair follicle, indicating an alteration of cell fate (Figure 3, 2 days). At day 9, K1 was expressed in the majority of epithelial cells, but was later restricted to more differentiated, suprabasal cells, and was largely negative in cells deeper in the dermis (Figure 3, 21 days, asterisks). Analysis of skin at 21 days using the follicle marker K17 revealed uniform staining of cystic follicles, but not of the dysplastic surface epithelium, consistent with derivation of dysplastic epithelium from both cell types (not shown).

K16 was low prior to induction as expected, but focally positive in basal keratinocytes of interfollicular epithelium by 2 days (Figure 3). At 9 days, expression was uniform in interfollicular cells, and focally positive in follicular cysts. K16 was prominent in suprabasal cells at day 21.

In summary, KLF4 induced outgrowth of dysplastic, squamous epithelial lesions composed of K14-, PCNA-, and K16-positive cells that gradually lost K1, similar to human cutaneous SCC (van der Velden et al., 1997; Horn and Bravo, 1998). Rapid induction of K14 and PCNA in parabasal cells at 2 days is consistent with inhibition of the proliferation-differentiation switch that normally occurs in developing epithelium.

KLF4 induces an apoptotic response

Induction of KLF4 in cultures of bitransgenic, primary keratinoctyes resulted in death of the vast majority of cells by 48 hrs (not shown). To determine whether KLF4 can induce apoptosis in vivo, we analyzed frozen sections by TUNEL. Prior to induction, TUNEL-positive squamous cells were rare (Figure 4). By day 2 parabasal cells exhibited staining. Apoptosis peaked at day 9, when both interfollicular cells and follicular cysts were strongly positive. In contrast, staining of severely dysplastic skin was less frequent (Figure 4, day 38). Thus, KLF4 induces a transitory apoptotic responses that diminishes in association with progression to dysplasia.

Figure 4.

Figure 4

TUNEL analysis of apoptosis following induction of KLF4. Frozen sections were labeled with digoxigenin (dig)–dUTP and terminal transferase. Dig was detected using an alkaline phosphatase conjugated antibody and the substrate Fast Red (arrowheads). At 38 days, dysplastic epithelium exhibited TUNEL staining that was limited to the most superficial cells. Epithelial cells deeper within the dermis are indicated with an asterisk. Sections were lightly counterstained with hematoxylin. The DEJ is indicated with a dashed line. Scale bar, 100μ.

p53 deficiency promotes KLF4-induced dysplasia

The established role of p53 in the genesis of SCC suggested that deficiency of this tumor suppressor could promote the KLF4-induced phenotype (Boyle et al., 1993; Kemp et al., 1993; Ziegler et al., 1994; Jonason et al., 1996; Brash and Ponten, 1998; Jonkers et al., 2001). We identified settings in which p53 deficiency was important or essential for KLF4-induced dysplasia (Figures 5 and 6). Unlike p53 wild-type males (p53+/+), in which the phenotype was largely confined to the ventral skin (see above), induction of KLF4 in p53 hemizygous knockout animals (p53+/−) induced pronounced gross and microscopic changes of both the dorsal and ventral skin (not shown). Whereas the dorsal skin of p53+/+ males exhibited only focal, mild dysplasia (Figure 5a, left panel), p53+/− and p53−/− animals similarly exhibited severe dysplasia in association with infiltration of the dermis by a well-vascularized, cellular and fibrotic stroma, or fibrovascular response (FVR) (Figure 5a, middle and right panels). No dysplasia was observed in p53-deficient mice in the absence of KLF4 induction.

Figure 5.

Figure 5

p53 gene dosage alters the skin phenotype of TRE-KLF4 transgenic mice. (a) Analysis of dorsal skin in p53 wild-type (p53+/+) or deficient (p53+/−, p53−/−) males. p53+/+ animals exhibited only focal, minor involvement (left panel, asterisk). In contrast, p53+/− animals exhibited epithelial dysplasia and a prominent fibrovascular response that effaced several mm of the dermis (middle panel, 3 week induction). In the right panel, a p53−/− animal showed increased nuclear atypia following 4 weeks of induction. Blood vessels near the DEJ are indicated by arrows (middle and right panels). (b) Mosaic expression in female skin resulting from an X chromosome-linked rtTA transgene (rtTAX+/−) induced only focal, minor abnormalities (left panel, asterisk). Either p53 hemizygosity (middle panel) or uniform expression (rtTAX+/+, right panel) resulted in the dysplastic phenotype. The results shown were observed in each of 5 or more animals. Scale bars, 100μ.

Figure 6.

Figure 6

Analysis of MMTV-KLF4 transgenic mice. (a) p53+/− animals developed dorsal hair loss, dysplasia, and fibrotic skin between 6 and 8 mo. of age in association with subcutaneous sarcoma. Dysplasia appeared similar to the inducible model, with a prominent fibrovascular response, and blood vessels near the DEJ (black arrowhead). (b) Skin of an MMTV-KLF4;p53+/− animal at 3 mo. of age. (c–f) Immunostaining of dysplasia and/or the associated sarcoma in an MMTV-KLF4;p53+/− animal. (c) Staining of dysplastic epithelium with anti-KLF4. (d) Absence of staining of adjacent sarcoma cells with anti-KLF4. (e) Increased nuclear staining by anti-p63 in epithelial cells vs. sarcoma cells (asterisk). (f) Differential staining of epithelium with anti-keratin AE1/AE3, and extensive intercalation of keratin-positive epithelium with the underlying sarcoma (asterisk). (g–h) Skin of an MMTV-KLF4;p53+/+ animal at 18 mo. of age. (g) Dysplasia with prominent vascularization and a fibrotic response near the DEJ (black arrowhead). (h) The region marked in panel g is shown at higher magnification, demonstrating nuclear pleomorphism, hyperchromicity, frequent mitoses, and blood vessels adjacent to the DEJ. Scale bars, 100μ.

The above studies utilized males, in which our expression strategy is expected to yield relatively uniform induction. However, human SCCs are clonally derived from small clusters of cells (Brash and Ponten, 1998; Mao et al., 2004). To examine whether induction of KLF4 in a mosaic pattern could lead to dysplasia, we examined females, in which random inactivation of the X chromosome leads to expression of X-linked, hemizygous alleles in patches measuring less than 1.0 mm (Deamant and Iannaccone, 1987; Ng et al., 1990; Gao et al., 2002). In K14-rtTAX+/−;TRE-KLF4+/−;p53+/+ females, mosaic KLF4 was insufficient to induce any gross phenotype. By microscopy there were only focal changes including cystic follicles and mild changes in the adjacent interfollicular epithelium (e.g., Figure 5b, left panel). However, the dysplastic phenotype was consistently observed in females that were either p53+/− (Figure 5b, middle panel) or K14-rtTAX+/+ (Figure 5b, right panel). These results suggest that KLF4 must be expressed in a sufficient patch size to induce dysplasia, and that a smaller patch size is sufficient in p53-deficient skin.

Constitutive KLF4 induces dysplasia in a p53-dependent fashion

To determine the consequence of longer term expression of KLF4, we utilized the mouse mammary tumor virus promoter (MMTV) promoter, which is active in skin (Hennighausen et al., 1995; Jonkers et al., 2001). As no phenotype was observed by 18 months of age, we crossed the p53 knockout allele into each of four lines. By 8 months of age, MMTV-KLF4;p53+/− animals of two lines developed dorsal skin lesions similar to those observed in the inducible model (above), with dysplastic skin overlying a vascular, fibrotic dermis (100% of 15 animals; Figure 6a). Ten p53+/− littermate controls showed no abnormality by 8 months of age (Fisher’s exact test, P<0.001). Likewise, MMTV-KLF4;p53+/− animals at 3–6 months of age exhibited no phenotype (Figure 6b). Thus, progression from grossly normal skin to dysplasia occurred between 6 and 8 months of age in MMTV-KLF4;p53+/− animals.

The life-span of these animals was limited to 8 mo. due to the outgrowth of sarcoma within the dysplasia-associated FVR (100% of 15 animals) (not shown). These 1.0–1.5 cm diameter tumors were composed of spindled, anaplastic cells and scattered giant cells. KLF4, p63, or cytokeratin antibodies did not stain sarcoma cells, but did stain the overlying dyplastic epithelium (Figure 6c–f). The FVR may lead to sarcoma when additional defects are acquired in the responding p53+/− mesenchymal cells, consistent with the known predisposition of p53−/− animals to this neoplasm.

Three MMTV-KLF4;p53+/+ animals that were >18 months of age developed severe dysplasia of the dorsal skin or ears, with delayed maturation, nuclear pleomorphism and hyperchromicity (Figure 6g–h). Although sarcoma was not observed, a FVR included blood vessels intercalated between basal and parabasal epithelial cells (Figure 6h). The skin phenotypes and the associated mesenchymal changes observed in KLF4 transgenic mice are summarized in Table 1.

Table 1.

Role of expression pattern and p53 status in KLF4-induced dysplasia.

p53 +/+
p53 +/−
Genotype Expression type Dysplasiaa FVRb Dysplasia FVR
XY;TRE-KLF4+/−;K14-rtTAX+/Y Inducible, uniform + + ++ +++
XX;TRE-KLF4+/−;K14-rtTAX+/− Inducible, mosaic − − ++ +++
XX;TRE-KLF4+/−;K14-rtTAX+/+ Inducible, uniform + + NT NT
MMTV-KLF4+/− (age at onset) Constitutive ++ (18 mo) +++ ++ (6–8 mo) +++
a

+: dysplasia confined to the ventral skin. ++: diffuse involvement of both the dorsal and ventral skin.

b

FVR indicates a prominent fibrovascular response that typically measured 2.0–3.0 mm in thickness and effaced the adipose and muscle layers underlying the dysplastic epithelium (+++) or else a milder response that did not efface the dermis (+). NT – not tested.

Localization to the nucleus correlates with transforming activity

Although KLF4 can function in the nucleus to regulate the activity of several cellular or viral promoters (Jenkins et al., 1998; Zhang et al., 1998; Mahatan et al., 1999; Shie et al., 2000; Zhang et al., 2000; Hinnebusch et al., 2004), mechanistic insight into its role as an oncogene is lacking. To identify molecular changes following acute activation of KLF4, we generated a 4-OHT conditional allele by fusion of KLF4 to a portion of the estrogen receptor (KLF4-ER) (Littlewood et al., 1995). Upon addition of 4-OHT to culture media, the fusion protein underwent rapid translocation to the nucleus (Figure 7a). To test for transforming activity, we used a volume of KLF4-ER retroviral supernatant sufficient to transduce only a small fraction of cells (i.e., <1.0%), as indicated by resistance to puromycin. When 4-OHT was included in the growth media, KLF4-ER induced transformed foci on a background monolayer of wild-type RK3E cells (Figure 7b). The spindled, refractile appearance of cells composing these foci were typical of KLF4-transformed cells (Foster et al., 1999; Pandya et al., 2004). Few or no foci were observed in the absence of 4-OHT, indicating the strictly conditional nature of the allele.

Figure 7.

Figure 7

Characterization of KLF4-ER. (a) KLF4 was fused to a 4-hydroxytamoxifen (4-OHT)-responsive fragment of the mouse estrogen receptor (ER). Stably-transduced cells were stained to enable localization of KLF4-ER. Nuclear localization results in a pink color in the merged red (antibody) and blue (nuclei) images. (b) KLF4-ER or Vector control retrovirus was transduced into a small subset of RK3E epithelial cells, and cultures were maintained in the presence of 4-OHT or vehicle. Dishes were stained to identify transformed foci (inset).

Discussion

The exclusion of KLF4 from epithelial basal cells in a variety of tissues lead to the notion that misexpression of this potential oncogene in proliferation-competent cells could lead to dysplasia (Foster et al., 1999). While the current study addressed this hypothesis using the skin as a model, the insights gained may be relevant to dysplasia in related tissues, such as the oral cavity or the breast (Foster et al., 2000; Pandya et al., 2004). Within 48 hrs of KLF4 induction in basal cells, the distinctive properties of basal and parabasal cells were merged, consistent with loss of the proliferation-differentiation switch. Over a period of a few weeks, lesions became largely K1-negative, but retained KLF4, K14, K16, and PCNA, similar to human SCC. The pleomorphic, hyperchromic nuclei and mitotic figures throughout the thickness of the epithelium was similar to SCC in situ. Although the lesions did not progress to highly invasive or metastatic SCC, other features of the malignant phenotype included a prominent fibrovascular response (FVR), particularly in p53+/− animals. FVRs are likewise observed in association with pre-malignant, dysplastic lesions in the K14-HPV16 model of SCC (Coussens et al., 1996; Hoffman et al., 2003). In support of results obtained after short-term induction of KLF4, a very similar skin phenotype was observed in MMTV-KLF4 mice. In this model, onset of the phenotype was delayed in a p53-dependent fashion, perhaps due to lower expression of the transgene, or to heterogeneous expression in the skin. Consistent with a role for KLF4 in human SCC, semi-quantitative immunostaining revealed similar expression of KLF4 in human SCC (see Figure 2k–l) and in several KLF4-induced skin lesions (e.g., see Figure 6c).

Human SCC is thought to derive from patches of dysplastic epithelium, referred to as actinic keratosis or oral leukoplakia, that are often composed of p53-deficient cells (Brash and Ponten, 1998; Forastiere et al., 2001; Mao et al., 2004). Although it is known that neoplastic cells must compete with and resist growth suppression by adjacent wild-type cells (Weinberg, 1989), few cancer models have been evaluated by inducing genetic alterations in a mosaic pattern (Hann and Balmain, 2001; Johnson et al., 2001). In the inducible KLF4 model, p53 deficiency tilted the balance in favor of KLF4-expressing cells, so that even mosaic expression was sufficient to induce lesions. p53 functions in multiple cellular processes and may limit the establishment of KLF4-positive cells by promoting the apoptotic response, by cooperating with KLF4 in the induction of p21/Waf1, or by other mechanisms (Yonish-Rouach et al., 1991; Zhang et al., 2000).

A related strategy was used to induce an epitope-tagged Klf4 transgene in basal cells of mouse skin (Jaubert et al., 2003), accelerating skin differentiation by 1 day and inducing developmental defects such as cleft palate. No dysplasia was observed, perhaps due to differences with the current study. These include the period of induction (~5 embryonic days vs. ~20-40 postnatal days), use of K5 vs. K14 promoters to drive expression, the use of dox-off vs. dox-on strategies, and the use of mouse vs. human transgenes.

That KLF4 functions as an oncogene is surprising given its role as an effector of differentiation in epithelium, and its proposed role as a tumor suppressor gene in colorectal cancer (Segre et al., 1999; Katz et al., 2002; Dang et al., 2003; Zhao et al., 2004). Interactions between KLF4 and cell fate determinants such as TGFβ (Adam et al., 2000; King et al., 2003), Wnt (van de Wetering et al., 2002; Sancho et al., 2003), or others may account for its distinct role in different tissues, as cell type specific effects are common for these important signaling molecules (Engel et al., 1998; Taipale and Beachy, 2001; Maillard and Pear, 2003). In developing colonic epithelium, KLF4 exerts its effects after cell migration, the proliferation-differentiation switch and several binary cell fate decisions are made in response to molecules such as Wnt, Notch, Hes, and Neurogenin (Sancho et al., 2003). Consistent with an active role in regulation of epithelial cell fate, KLF4 is rapidly induced in colorectal cancer cells following suppression of Wnt pathway signaling by dominant-negative TCF (van de Wetering et al., 2002; Sancho et al., 2003). KLF4 also directly activates p21/Waf1, which may contribute to the proliferation-differentiation switch in normal epithelium, but acts as an oncogene in certain tumors (Zhang et al., 2000; Sancho et al., 2003; Weiss, 2003; Xia et al., 2004). We are currently utilizing KLF4-ER and microarrays to better understand how KLF4 interacts with these various pathways.

Existing mouse models of cutaneous SCC reflect many of the alterations observed in human tumors, and can now be examined in the context of enforced expression of KLF4 (Arbeit et al., 1994; Brown and Balmain, 1995; Coussens et al., 1996; Jonkers et al., 2001; Liu et al., 2001; Forastiere et al., 2001; Hann and Balmain, 2001; Wu and Pandolfi, 2001; Mao et al., 2004). Taken together, the results demonstrate that established mouse transgenic approaches can complement an oncogene identification strategy using cultured epithelial cells (Foster et al., 1999) to elucidate potential mechanisms of human carcinoma progression.

Materials and Methods

KLF4 expression constructs

To generate a TRE-regulated expression construct, the protein coding region of the wild-type human KLF4 cDNA was excised from pCTV3K-SCC7-1 using SalI and Asp718 (Foster et al., 1999). The resulting 2.3 kb fragment was adapted with EcoRI sites and ligated to the vector fragment produced by EcoRI digestion of pXP2-TRE-hGFAT (Xie et al., 1999). A 4.4 kb BamHI fragment containing these elements was purified for microinjection.

To generate a constitutive construct under control of MMTV, bases 1–1780 of KLF4 were released from pXP2-TRE-KLF4 with EcoRI and then ligated to the vector fragment produced by EcoRI digestion of MMTV-pEV-TGFα (Matsui et al., 1990). A 4.7 kb XhoI fragment was purified for microinjection.

To generate a 4-OHT dependent allele, the protein-coding region of KLF4 was amplified by PCR, incorporating a myc epitope tag at the N-terminus and BamHI sites at the fragment ends. When cloned into pBluescript, the expected sequence was obtained and the insert was ligated to the vector fragment produced by BamHI digestion of pBpuro c-mycER™ (Littlewood et al., 1995). The final construct, termed pBpuro-KLF4-ER, fuses the KLF4 protein-coding region to an estrogen-independent, 4-OHT-inducible fragment of the estrogen receptor (ER). Retroviral transduction of RK3E cells, selection in puromycin, and 4-OHT induction was performed as described (Louro et al., 2002). For induction of transformed foci, 0.2 ml of retroviral supernatant was added to subconfluent cultures of RK3E as described (Foster et al., 1999). Cells were fed twice weekly with non-selective growth media, containing either 4-OHT or vehicle, for a total period of 2.5 weeks. Cells were fixed and stained overnight with modified Wright’s stain (Sigma).

Generation and analysis of transgenic mice

C57BL/6 (B6) X SJL (J) F2 fertilized ova were treated by microinjection in the Transgenic Animal/Embryonic Stem Cell Core Facility at the University of Alabama at Birmingham. Transgenic founders were identified by PCR and confirmed by Southern analysis. PCR primers for genotyping were 5′ GGCAAGTTCGTGCTGAAGGCGT 3′ and 5′ CGATCGTCTTCCCCTCTTTGGCTT 3′, and were used as described (Foster et al., 1999). TRE-KLF4 founders were crossed to B6;J F2 animals, and these lines were subsequently crossed to mice transgenic for X chromosome-linked or autosomal alleles of K14-rtTA (Xie et al., 1999). For the inducible model, the illustrated results were obtained using the TRE-KLF432831 autosomal allele and an X-linked K14-rtTA (rtTAX) in the B6;J background of the founders. For the constitutive model, MMTV-KLF4 transgenes and the p53 loss-of-function allele (strain p53N5-T, Taconic) were backcrossed 3 times onto FVB/NJ (Jackson Labs) prior to analysis of skin phenotypes (Donehower et al., 1992). Following fixation and embedding in paraffin, analysis of hematoxylin- and eosin-stained slides was performed by a pathologist (A.R.F.). Unless otherwise noted, the described gross or microscopic results were observed in each of seven or more animals, and with complete penetrance.

To generate TRE-KLF4 mice with the genotypes indicated for K14-rtTAX and p53, the three crosses used (male X female) were: TRE-KLF4+/− X rtTAX+/+, TRE-KLF4+/−;rtTAX+/Y X rtTAX+/+, and TRE-KLF4+/−;p53−/− X p53+/−;rtTAX+/+. rtTAX+/+ females were first identified by consistent transgene transmission, and were expanded for breeding. Oligonucleotides, cycling parameters, and electrophoretic parameters for genotyping of K14-rtTA and p53 are available upon request.

Dox (Sigma) was administered in 5% sucrose water in amber bottles, and was changed three times per week. To limit toxicity, dox was initiated at 125 μg/ml and then increased at five day intervals to 250 μg/ml or 2.00 mg/ml as necessary to induce a skin phenotype.

mRNA expression studies

Total RNA was isolated from mouse skin or cultured cells (Chomczynski and Sacchi, 1987). RT reactions were performed using total RNA, oligo-dT(12–18) at 50 μg/ml, and SuperScript™ II RT (Invitrogen). For RT-PCR analysis of mouse skin, cDNA was treated with DNAse I to remove genomic DNA (DNA-free™, Ambion), and products corresponding to mouse and human KLF4 cDNA were resolved on a 5% polyacrylamide gel. Primer sequences and cycling parameters were as above for genotyping. Northerns were performed as described (Foster et al., 1999). mRNA in situ hybridization analysis of mouse skin cryosections was performed using digoxigenin (dig)-labeled transcripts as described (Louro et al., 2002). Templates for in vitro transcription were isolated from total mRNA of mouse NIH3T3 cells by RT-PCR. PCR products incorporated a T7 RNA polymerase binding site, and forward and reverse primers were: KLF4-AS, 5′ TGGATATGACCCACACTGCCAGA 3′, and 5′ GGATCCTAATACGACTCACTATAGGGAGAAATTCTGGTCTTCCCTCCCCCA 3′; KLF4-S, 5′ GGATCCTAATACGACTCACTATAGGGAGATGGATATGACCCACACTGCCAGA 3′, and 5′ AATTCTGGTCTTCCCTCCCCCA 3′; Hybridized transcripts were detected using enzyme-antibody conjugates and the alkaline phosphatase substrate Fast Red.

Immunodetection assays

Tissues were fixed overnight in 10% neutral buffered formalin and processed for paraffin embedding. Rabbits were immunized using a KLH-conjugated peptide (aa 74–91: CGGSNLAPLPRRETEEFN). Anti-KLF4 was purified by peptide immunoaffinity chromatography (Geneka/Active Motif), and used for paraffin IHC at 13μg/ml. Normal rabbit Immunoglobulin (Dako, X0903) was used a negative control. Anti-KLF4 specifically detected KLF4 by immunoblot, and similar staining of normal and tumor tissue was obtained in side-by-side comparisons to the monoclonal antibody we previously reported (see Supplementary Information) (Foster et al., 2000; Pandya et al., 2004).

For other primary antibodies, we utilized heat-induced epitope retrieval in 10mM sodium citrate (pH=6.0). Anti-p63 mouse monoclonal antibody was used at 1μg/ml (Ab-4, NeoMarkers). Rabbit anti-cytokeratin 1 (CK1) was used at 1 μg/ml (PRB165P, Covance Research Products). Monoclonal antibodies to CK14 and CK16 were used at 1:20 (v/v; NCL-LL002 and NCL-CK16, Novocastra Laboratories Ltd). CK17 polyclonal antibody, a gift from Pierre Coulombe, was used at 1:2000 (McGowan and Coulombe, 1998). Pan-cytokeratin monoclonal antibody was used at 2 μg/ml (AE1/AE3, NeoMarkers). Immunodetection was performed using a biotinylated secondary antibody, streptavidin-horseradish peroxidase (Signet Pathology Systems), and the substrate diaminobenzidine (BioGenex). Sections were counterstained with Harris’ hematoxylin (Surgipath). PCNA was detected using a biotinylated monoclonal antibody (clone PC10) and streptavidin-peroxidase (Zymed).

Immunofluorescence analysis of KLF4-ER was performed using the aminoterminal myc epitope antibody 9E10 (Sigma) diluted 1:100 in 50% goat serum (Pandya et al., 2004).

In situ apoptosis detection (TUNEL)

Frozen sections were fixed in PBS containing 1% paraformaldehyde for 10 minutes at room temperature, and then in ethanol/acetic acid (2:1 vol/vol) for 5 minutes at −20°C. Dig-labeled nucleotides were added to DNA ends with terminal deoxynucleotidyl transferase (Chemicon). Sections were incubated in blocking buffer for 20 min. at room temperature (blocking buffer is 5.0 % goat serum (vol/vol; Sigma), 10 mg/ml casein (ICN), 100 mM Tris-HCl (pH 7.5), 150 mM NaCl). Following incubation with alkaline phosphatase-conjugated antibody (Dako D5105; diluted 1:60 in blocking buffer), sections were developed with the chromogenic substrate Fast Red (Sigma), counterstained with Mayers Hematoxylin (Dako), and mounted using Supermount (Biogenex).

Supplementary Material

Supplementary

Acknowledgments

We thank Andrzej A. Dlugosz for advice on keratinocyte isolation, and Lawrence A. Donehower for advice on p53 genotyping. This research was supported by grants CA65686, CA094030, CA89019, and P30CA13148 from the U.S. National Cancer Institute and by a gift to the Comprehensive Cancer Center from the Avon Foundation.

Footnotes

Supplementary Information

Supplementary information is available at the Oncogene website

References

  1. Adam PJ, Regan CP, Hautmann MB, Owens GK. J Biol Chem. 2000;275:37798–37806. doi: 10.1074/jbc.M006323200. [DOI] [PubMed] [Google Scholar]
  2. Arbeit JM, Munger K, Howley PM, Hanahan D. Journal of Virology. 1994;68:4358–4368. doi: 10.1128/jvi.68.7.4358-4368.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Boyle JO, Hakim J, Koch W, van der RP, Hruban RH, Roa RA, Correo R, Eby YJ, Ruppert JM, Sidransky D. Cancer Res. 1993;53:4477–4480. [PubMed] [Google Scholar]
  4. Brash DE, Ponten J. Cancer Surv. 1998;32:69–113. [PubMed] [Google Scholar]
  5. Brown K, Balmain A. Cancer Metastasis Rev. 1995;14:113–124. doi: 10.1007/BF00665795. [DOI] [PubMed] [Google Scholar]
  6. Chomczynski P, Sacchi N. Anal Biochem. 1987;162:156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  7. Coussens LM, Hanahan D, Arbeit JM. Am J Pathol. 1996;149:1899–1917. [PMC free article] [PubMed] [Google Scholar]
  8. Dang DT, Chen X, Feng J, Torbenson M, Dang LH, Yang VW. Oncogene. 2003;22:3424–3430. doi: 10.1038/sj.onc.1206413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Deamant FD, Iannaccone PM. J Cell Sci. 1987;88:305–312. doi: 10.1242/jcs.88.3.305. [DOI] [PubMed] [Google Scholar]
  10. Dlugosz AA, Glick AB, Tennenbaum T, Weinberg WC, Yuspa SH. Methods Enzymol. 1995;254:3–20. doi: 10.1016/0076-6879(95)54003-2. [DOI] [PubMed] [Google Scholar]
  11. Dominguez M, Brunner M, Hafen E, Basler K. Science. 1996;272:1621–1625. doi: 10.1126/science.272.5268.1621. [DOI] [PubMed] [Google Scholar]
  12. Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery CA, Jr, Butel JS, Bradley A. Nature. 1992;356:215–221. doi: 10.1038/356215a0. [DOI] [PubMed] [Google Scholar]
  13. Engel ME, Datta PK, Moses HL. J Cell Biochem Suppl. 1998;30–31:111–22. 111–122. [PubMed] [Google Scholar]
  14. Forastiere A, Koch W, Trotti A, Sidransky D. N Engl J Med. 2001;345:1890–1900. doi: 10.1056/NEJMra001375. [DOI] [PubMed] [Google Scholar]
  15. Foster KW, Frost AR, McKie-Bell P, Lin CY, Engler JA, Grizzle WE, Ruppert JM. Cancer Res. 2000;60:6488–6495. [PubMed] [Google Scholar]
  16. Foster KW, Ren S, Louro ID, Lobo-Ruppert SM, McKie-Bell P, Grizzle W, Hayes MR, Broker TR, Chow LT, Ruppert JM. Cell Growth Differ. 1999;10:423–434. [PubMed] [Google Scholar]
  17. Gao XH, Kondoh G, Tarutani M, Hara M, Inoue S, Nakanishi T, Okabe M, Yamaguchi Y, Yoshikawa K, Itami S, Takeda J. J Invest Dermatol. 2002;118:998–1002. doi: 10.1046/j.1523-1747.2002.01778.x. [DOI] [PubMed] [Google Scholar]
  18. Garrett-Sinha LA, Eberspaecher H, Seldin MF, de Crombrugghe B. J Biol Chem. 1996;271:31384–31390. doi: 10.1074/jbc.271.49.31384. [DOI] [PubMed] [Google Scholar]
  19. Hanahan D, Weinberg RA. Cell. 2000;100:57–70. doi: 10.1016/s0092-8674(00)81683-9. [DOI] [PubMed] [Google Scholar]
  20. Hann B, Balmain A. Curr Opin Cell Biol. 2001;13:778–784. doi: 10.1016/s0955-0674(00)00283-0. [DOI] [PubMed] [Google Scholar]
  21. Hennighausen L, Wall RJ, Tillmann U, Li M, Furth PA. J Cell Biochem. 1995;59:463–472. doi: 10.1002/jcb.240590407. [DOI] [PubMed] [Google Scholar]
  22. Hinnebusch BF, Siddique A, Henderson JW, Malo MS, Zhang W, Athaide CP, Abedrapo MA, Chen X, Yang VW, Hodin RA. Am J Physiol Gastrointest Liver Physiol. 2004;286:G23–G30. doi: 10.1152/ajpgi.00203.2003. [DOI] [PubMed] [Google Scholar]
  23. Hoffman JA, Giraudo E, Singh M, Zhang L, Inoue M, Porkka K, Hanahan D, Ruoslahti E. Cancer Cell. 2003;4:383–391. doi: 10.1016/s1535-6108(03)00273-3. [DOI] [PubMed] [Google Scholar]
  24. Horn TD and Bravo N. (1998). Cutaneous Oncology Miller S.J. and Maloney M.E. (eds). Blackwell Science, Inc.: Malden, pp. 361–372.
  25. Jaubert J, Cheng J, Segre JA. Development. 2003;130:2767–2777. doi: 10.1242/dev.00477. [DOI] [PubMed] [Google Scholar]
  26. Jenkins TD, Opitz OG, Okano J, Rustgi AK. J Biol Chem. 1998;273:10747–10754. doi: 10.1074/jbc.273.17.10747. [DOI] [PubMed] [Google Scholar]
  27. Johnson L, Mercer K, Greenbaum D, Bronson RT, Crowley D, Tuveson DA, Jacks T. Nature. 2001;410:1111–1116. doi: 10.1038/35074129. [DOI] [PubMed] [Google Scholar]
  28. Johnson RL, Rothman AL, Xie J, Goodrich LV, Bare JW, Bonifas JM, Quinn AG, Myers RM, Cox DR, Epstein EH, Jr, Scott MP. Science. 1996;272:1668–1671. doi: 10.1126/science.272.5268.1668. [DOI] [PubMed] [Google Scholar]
  29. Jonason AS, Kunala S, Price GJ, Restifo RJ, Spinelli HM, Persing JA, Leffell DJ, Tarone RE, Brash DE. Proc Natl Acad Sci USA. 1996;93:14025–14029. doi: 10.1073/pnas.93.24.14025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jonkers J, Meuwissen R, van der GH, Peterse H, van d V, Berns A. Nat Genet. 2001;29:418–425. doi: 10.1038/ng747. [DOI] [PubMed] [Google Scholar]
  31. Katz JP, Perreault N, Goldstein BG, Lee CS, Labosky PA, Yang VW, Kaestner KH. Development. 2002;129:2619–2628. doi: 10.1242/dev.129.11.2619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kemp CJ, Donehower LA, Bradley A, Balmain A. Cell. 1993;74:813–822. doi: 10.1016/0092-8674(93)90461-x. [DOI] [PubMed] [Google Scholar]
  33. King KE, Iyemere VP, Weissberg PL, Shanahan CM. J Biol Chem. 2003;278:11661–11669. doi: 10.1074/jbc.M211337200. [DOI] [PubMed] [Google Scholar]
  34. Kinzler KW, Vogelstein B. Nature. 1997;386:761. doi: 10.1038/386761a0. [DOI] [PubMed] [Google Scholar]
  35. Littlewood TD, Hancock DC, Danielian PS, Parker MG, Evan GI. Nucleic Acids Res. 1995;23:1686–1690. doi: 10.1093/nar/23.10.1686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Liu LH, Boivin GP, Prasad V, Periasamy M, Shull GE. J Biol Chem. 2001;276:26737–26740. doi: 10.1074/jbc.C100275200. [DOI] [PubMed] [Google Scholar]
  37. Louro ID, Bailey EC, Li X, South LS, McKie-Bell PR, Yoder BK, Huang CC, Johnson MR, Hill AE, Johnson RL, Ruppert JM. Cancer Res. 2002;62:5867–5873. [PubMed] [Google Scholar]
  38. Mahatan CS, Kaestner KH, Geiman DE, Yang VW. Nucleic Acids Res. 1999;27:4562–4569. doi: 10.1093/nar/27.23.4562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Maillard I, Pear WS. Cancer Cell. 2003;3:203–205. doi: 10.1016/s1535-6108(03)00052-7. [DOI] [PubMed] [Google Scholar]
  40. Mao L, Hong WK, Papadimitrakopoulou VA. Cancer Cell. 2004;5:311–316. doi: 10.1016/s1535-6108(04)00090-x. [DOI] [PubMed] [Google Scholar]
  41. Matsui Y, Halter SA, Holt JT, Hogan BL, Coffey RJ. Cell. 1990;61:1147–1155. doi: 10.1016/0092-8674(90)90077-r. [DOI] [PubMed] [Google Scholar]
  42. McGowan KM, Coulombe PA. J Cell Biol. 1998;143:469–486. doi: 10.1083/jcb.143.2.469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ng YK, Ohaki Y, Deamant F, Iannaccone PM. Cell Differentiation & Development. 1990;30:27–34. doi: 10.1016/0922-3371(90)90071-4. [DOI] [PubMed] [Google Scholar]
  44. Pandya AY, Talley LI, Frost AR, Fitzgerald TJ, Trivedi V, Chakravarthy M, Chhieng DC, Grizzle WE, Engler JA, Krontiras H, Bland KI, Lobuglio AF, Lobo-Ruppert SM, Ruppert JM. Clin Cancer Res. 2004;10:2709–2719. doi: 10.1158/1078-0432.ccr-03-0484. [DOI] [PubMed] [Google Scholar]
  45. Sancho E, Batlle E, Clevers H. Curr Opin Cell Biol. 2003;15:763–770. doi: 10.1016/j.ceb.2003.10.012. [DOI] [PubMed] [Google Scholar]
  46. Segre JA, Bauer C, Fuchs E. Nat Genet. 1999;22:356–360. doi: 10.1038/11926. [DOI] [PubMed] [Google Scholar]
  47. Sherr CJ. Cell. 2004;116:235–246. doi: 10.1016/s0092-8674(03)01075-4. [DOI] [PubMed] [Google Scholar]
  48. Shie JL, Chen ZY, Fu M, Pestell RG, Tseng CC. Nucleic Acids Res. 2000;28:2969–2976. doi: 10.1093/nar/28.15.2969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Shields JM, Christy RJ, Yang VW. J Biol Chem. 1996;271:20009–20017. doi: 10.1074/jbc.271.33.20009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Taipale J, Beachy PA. Nature. 2001;411:349–354. doi: 10.1038/35077219. [DOI] [PubMed] [Google Scholar]
  51. Tonthat H, Kaestner KH, Shields JM, Mahatanankoon CS, Yang VW. FEBS Lett. 1997;419:239–243. doi: 10.1016/s0014-5793(97)01465-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. van de Wetering M, Sancho E, Verweij C, de Lau W, Oving I, Hurlstone A, van der Horn K, Batlle E, Coudreuse D, Haramis AP, Tjon-Pon-Fong M, Moerer P, van den Born M, Soete G, Pals S, Eilers M, Medema R, Clevers H. Cell. 2002;111:241–250. doi: 10.1016/s0092-8674(02)01014-0. [DOI] [PubMed] [Google Scholar]
  53. van der Velden LA, Schaafsma HE, Manni JJ, Ruiter DJ, Ramaekers CS, Kuijpers W. Eur Arch Otorhinolaryngol. 1997;254:376–383. doi: 10.1007/BF01642554. [DOI] [PubMed] [Google Scholar]
  54. Weinberg RA. Cancer Res. 1989;49:3713–3721. [PubMed] [Google Scholar]
  55. Weiss RH. Cancer Cell. 2003;4:425–429. doi: 10.1016/s1535-6108(03)00308-8. [DOI] [PubMed] [Google Scholar]
  56. Wu X, Pandolfi PP. Trends Cell Biol. 2001;11:S2–S9. doi: 10.1016/s0962-8924(01)02127-4. [DOI] [PubMed] [Google Scholar]
  57. Xia W, Chen JS, Zhou X, Sun PR, Lee DF, Liao Y, Zhou BP, Hung MC. Clin Cancer Res. 2004;10:3815–3824. doi: 10.1158/1078-0432.CCR-03-0527. [DOI] [PubMed] [Google Scholar]
  58. Xie W, Chow LT, Paterson AJ, Chin E, Kudlow JE. Oncogene. 1999;18:3593–3607. doi: 10.1038/sj.onc.1202673. [DOI] [PubMed] [Google Scholar]
  59. Yonish-Rouach E, Resnitzky D, Lotem J, Sachs L, Kimchi A, Oren M. Nature. 1991;352:345–347. doi: 10.1038/352345a0. [DOI] [PubMed] [Google Scholar]
  60. Zhang W, Geiman DE, Shields JM, Dang DT, Mahatan CS, Kaestner KH, Biggs JR, Kraft AS, Yang VW. J Biol Chem. 2000;275:18391–18398. doi: 10.1074/jbc.C000062200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zhang W, Shields JM, Sogawa K, Fujii-Kuriyama Y, Yang VW. J Biol Chem. 1998;273:17917–17925. doi: 10.1074/jbc.273.28.17917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Zhao W, Hisamuddin IM, Nandan MO, Babbin BA, Lamb NE, Yang VW. Oncogene. 2004;23:395–402. doi: 10.1038/sj.onc.1207067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Ziegler A, Jonason AS, Leffell DJ, Simon JA, Sharma HW, Kimmelman J, Remington L, Jacks T, Brash DE. Nature. 1994;372:773–776. doi: 10.1038/372773a0. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary

RESOURCES