Astragaloside IV Modulates the Immune Response in Rheumatoid Arthritis and is Associated with Inhibition of the NAV2-Wnt/β-Catenin Signaling Cascade

Abstract

Background

Rheumatoid arthritis (RA) is a chronic autoimmune disease characterized by progressive joint destruction and systemic inflammation, with limited long-term efficacy and clinically important adverse effects of current treatments. Astragaloside IV (ASIV), the core active saponin component isolated from Astragalus membranaceus, has shown anti-inflammatory, immunomodulatory, and joint-protective potential in multiple inflammatory disease models, while its underlying mechanism in RA remains to be fully elucidated.

Objective

This study aimed to investigate whether ASIV alleviates RA by modulating the NAV2-Wnt/β-catenin signaling pathway.

Methods

A collagen-induced arthritis (CIA) model was established in female Wistar rats. The animals were randomly divided into four groups (n=6 per group initially, final n=3 per group based on modeling success criteria): healthy controls (NOR group), CIA model (CIA group), methotrexate-treated (MTX group, positive control, 0.9 mg/kg/week), and ASIV-treated (ASIV group, 50 mg/kg/day). Following a 4-week intervention period initiated on day 14 post-primary immunization, we evaluated arthritis severity (arthritis scores, vs volume), bone microstructure (micro-CT), histopathological features (H&E, Safranin O, Masson, TRAP staining), and serum levels of inflammatory cytokines (TNF-α, IL-1β, IL-6, IL-17A, IL-10, IL-13, detected by enzyme-linked immunosorbent assay (ELISA)) via abdominal aorta blood collection. Messenger RNA and protein expression levels of NAV2, Wnt3a, and β-catenin in the spleen and joint tissues were quantified using quantitative real-time polymerase chain reaction (qRT-PCR), Western blot, and immunohistochemistry (IHC). All data were analyzed using GraphPad Prism 8.3.0. Normality and homogeneity of variances were verified before analysis; one-way ANOVA followed by Tukey’s post-hoc test was applied for multiple group comparisons, and independent t-test for pairwise comparisons. Statistical significance was set at P < 0.05.

Results

Compared with the NOR group, rats in the CIA model group exhibited significant joint swelling, elevated arthritis scores, severe bone microstructure destruction, and disordered serum cytokine profiles, with increased pro-inflammatory factors (TNF-α, IL-1β, IL-6, IL-17A) and decreased anti-inflammatory factors (IL-10, IL-13) (P < 0.01). Meanwhile, the NAV2-Wnt/β-catenin signaling cascade was markedly activated at both mRNA and protein levels in the spleen and joint tissues of CIA rats (P < 0.001). Compared with the CIA group, ASIV treatment significantly alleviated arthritis severity, reduced joint swelling and bone erosion, normalized cytokine levels, and ameliorated histopathological damage (P < 0.01). The overall therapeutic efficacy of ASIV was comparable to that of the positive control MTX, with no statistically significant differences in most endpoints. Notably, ASIV significantly downregulated the mRNA and protein expression of NAV2, Wnt3a and β-catenin in both spleen and joint tissues (P < 0.01, P < 0.001), which was consistent with its ameliorative effects on inflammatory and structural injuries.

Conclusion

ASIV attenuated CIA-associated inflammatory and structural changes and was associated with reduced NAV2-Wnt/β-catenin pathway activation. These findings position the NAV2-Wnt/β-catenin cascade as a promising therapeutic target for ASIV in RA treatment, and support further development of ASIV as a potential natural-derived agent for RA management.

Introduction

Rheumatoid arthritis (RA) is a chronic autoimmune disease characterized by symmetrical and erosive joint synovitis, affecting approximately 0.5–1.0% of the global population, with a 2–3-fold higher incidence in females than in males.^1–3 The disease follows a progressive course: without standardized intervention, it leads to cartilage degradation, bone erosion, and joint deformity, ultimately resulting in permanent functional disability. It is also accompanied by multisystem extra-articular complications such as cardiovascular disease, interstitial lung disease, and osteoporosis, increasing the all-cause mortality risk of patients by approximately 1.5-fold compared with the general population.^4,5 In recent years, the disease burden of RA in China has continued to rise, with the prevalence of osteoporosis among RA patients reaching 37.67%, severely impairing quality of life and imposing substantial public health pressure.^6,7

Currently, a stratified treatment system for RA has been established around disease-modifying antirheumatic drugs (DMARDs). Conventional synthetic DMARDs (csDMARDs) serve as first-line foundational medications, among which methotrexate (MTX) is the anchor agent. It blocks lymphocyte proliferation by inhibiting dihydrofolate reductase and delays joint structural damage; leflunomide and other agents are alternatives for patients intolerant to MTX. However, these drugs are associated with adverse reactions including gastrointestinal disorders, liver injury, and myelosuppression, and approximately 30% of patients fail to achieve an adequate therapeutic response.^8–10 On this basis, biological DMARDs (bDMARDs) and targeted synthetic DMARDs (tsDMARDs) have greatly expanded therapeutic options, including TNF-α inhibitors, IL-6 inhibitors, B-cell targeted therapies (anti-CD20 monoclonal antibodies), T-cell co-stimulation factor inhibitors (CTLA-4 fusion protein), and JAK inhibitors. These agents target key inflammatory cytokines, immune cell subsets, and intracellular signaling pathways involved in RA pathogenesis, significantly improving clinical remission rates.^11–13

Nevertheless, multiple unmet clinical needs remain for current regimens. First, single-target agents cannot fully cover the complex immune-inflammatory network of RA; nearly 30% of patients still fail to achieve clinical remission after standardized treatment, and secondary drug resistance develops with long-term use.¹⁴ Second, biological agents and JAK inhibitors elevate the risk of tuberculosis recurrence, opportunistic infections, and cardiovascular adverse events, restricting their application in some high-risk populations.^15,16 Third, these novel therapies carry high costs and have limited accessibility in low- and middle-income regions, making long-term standardized treatment unsustainable for many patients.¹⁷ Therefore, developing multi-target, low-toxicity, and highly accessible therapeutic agents remains a core research priority in the RA field.

In traditional Chinese medicine (TCM), RA falls under the category of Bi syndrome, with the core pathogenesis of healthy qi deficiency and meridian obstruction by wind, cold, and damp pathogens, which aligns closely with the pathological features of immune imbalance and inflammatory invasion in RA.¹⁸ Astragalus membranaceus, a representative TCM herb for tonifying qi, strengthening healthy qi, and dredging collaterals to relieve arthralgia, is a core component of numerous clinical RA treatment formulas. ASIV, the primary active saponin monomer of Astragalus membranaceus, has been confirmed to exert multiple pharmacological activities including anti-inflammation, immunomodulation, cartilage protection, and osteogenesis regulation.^19,20 Existing studies demonstrate that ASIV reduces the secretion of pro-inflammatory cytokines such as TNF-α, IL-6, and IL-17A by inhibiting classical inflammatory pathways including NF-κB and MAPK, and alleviates joint swelling and bone erosion in RA animal models. However, its upstream regulatory targets and complete molecular mechanism of action have not been fully elucidated.^21–23

The Wnt/β-catenin signaling pathway is a highly conserved pathway regulating cell proliferation, differentiation, and tissue homeostasis, and its aberrant activation is a key molecular mechanism driving RA pathological progression.²⁴ In RA-affected joints, abnormally upregulated ligands such as Wnt3a promote β-catenin nuclear translocation and activate downstream target gene transcription.²⁵ On one hand, it induces abnormal proliferation and invasiveness of fibroblast-like synoviocytes (FLS), which secrete matrix metalloproteinases and pro-inflammatory cytokines, driving synovial hyperplasia, pannus formation, and inflammatory cascades. On the other hand, it disrupts bone metabolic homeostasis by promoting excessive osteoclast activation, mediating cartilage degradation and bone erosion, and ultimately driving progressive joint destruction.^26,27 Thus, targeted modulation of the Wnt/β-catenin pathway represents a critical strategy for RA intervention.

Neuron Navigator 2 (NAV2) is a member of the neuronal guidance protein family, and recent studies have identified its key role in inflammatory regulation of autoimmune diseases. Accumulating evidence confirms that NAV2 expression is significantly upregulated in the synovial tissue of RA patients, and it acts as an upstream regulator to activate the Wnt/β-catenin pathway, thereby enhancing the inflammatory response and invasive phenotype of FLS. Silencing NAV2 effectively inhibits pathway activation and blocks RA inflammatory progression and joint destruction, identifying NAV2 as a promising novel target for RA intervention.^28,29 Subsequent studies further verified that a small number of natural active monomers, such as matrine, exert immunomodulatory effects on RA by targeting the NAV2-Wnt3a/β-catenin axis, validating the feasibility of this signaling axis as an intervention target for natural products.³⁰ However, among current natural monomer studies for RA, most active components such as glycyrrhizin and triptolide focus on the regulation of downstream classical inflammatory pathways like NF-κB and MAPK, while mechanistic research targeting the novel upstream molecule NAV2 remains very limited. Existing network pharmacology predictions suggest that ASIV may target and modulate the NAV2-Wnt/β-catenin pathway, but no in vivo study has verified their regulatory relationship, representing a clear gap in the research on the anti-RA mechanism of ASIV.³¹

Based on the above foundation, this study proposes the core hypothesis that ASIV alleviates RA progression by inhibiting the NAV2-Wnt/β-catenin signaling cascade, thereby reducing systemic inflammatory response and osteochondral joint damage. In this study, a CIA rat model was established with methotrexate as the positive control. We evaluated the therapeutic effect of ASIV on RA inflammation and joint injury via in vivo experiments, and verified its regulatory effect on the NAV2-Wnt/β-catenin pathway in the spleen (core immune organ) and joint tissue (lesion target organ). This study aims to elucidate the novel molecular mechanism of ASIV in RA treatment, and provide experimental evidence and a new target direction for TCM intervention in RA.

Materials and Methods

Experimental Design and Blinding

This study was a randomized controlled animal experiment with single-blinded outcome assessment. An independent researcher not involved in modeling, drug administration, or subsequent data detection completed rat grouping via the random number table method. Grouping results were sealed in opaque envelopes to achieve allocation concealment. All outcome assessments (arthritis scoring, vs volume measurement, Micro-CT parameter analysis, histological scoring, Western blot densitometry, and IHC integrated optical density analysis) were performed by two independent researchers blinded to group allocation, and the average value was adopted. If the difference between two assessments exceeded 10%, a third senior researcher conducted a blinded re-evaluation to eliminate observer bias.

Instruments

Toe volume measuring instrument (ZH-ZZY, Anhui Zhenghua Biological Instrument Co., Ltd). Electronic analytical balance (FA124, Shanghai Shunzi Hengping Scientific Instruments Co., Ltd). Microplate reader (ELX808, BioTek Instruments). Automatic biochemistry analyzer (BS-180, Shenzhen Mindray Biomedical Electronics Co., Ltd). Skyscan 1276 Micro-CT scanner (Skyscan 1276, Bruker Scientific Instruments Hong Kong Co., Ltd). Biological microscope (DM2500 LED, Chongqing Optic Electrical Instrument Co., Ltd). Real-time fluorescent quantitative PCR instrument (Light Cycler 96, Bio-Rad Laboratories, Inc., USA). UV-visible spectrophotometer (UV-1800PC, Shanghai Mapada Instruments Co., Ltd). ChemiDoc™ imaging system (734BR4160, Bio-Rad Laboratories, Inc., USA).

Drugs and Main Reagents

Astragaloside IV (Macklin, CAS No. 83207–58-3). Methotrexate Tablets (Shanghai SINE Pharmaceutical Co., Ltd., Batch No. 197221004). Bovine Type II Collagen (Chondrex Inc., USA, Batch No. 20022). Freund’s complete/incomplete adjuvant (Sigma-Aldrich, USA, Batch No. F5881, F5506). Interleukin-6, Interleukin-1β, Tumor Necrosis Factor-α, Interleukin-10, Interleukin-13, Interleukin-17A (Solarbio Science and Technology Co., Ltd., Beijing, Cat. No. ml064292, ml037361, ml002859, ml037371, ml107039, ml037365). Hematoxylin-Eosin (H&E) staining solution (Solarbio Science and Technology Co., Ltd., Beijing, Cat. No. DH0006). Modified Safranin O-Fast Green Cartilage Staining Kit, Total RNA Extraction Kit, SDS-PAGE Gel Preparation Kit, BCA Protein Concentration Assay Kit, DAB Chromogenic Kit (Solarbio Science and Technology Co., Ltd., Beijing, Cat. No. G1371, R1200, P1200, PC0020, DA1010). RT mix with DNase (All-in-One), Universal SYBR Green qPCR Supermix (US EVERBRIGHT, Cat. No. R2020L, S2024L). Rabbit Anti-GAPDH Antibody (Boster Biological Technology, Ltd., Beijing, Cat. No. bsm-33033M). NAV2 antibody (ZeYe Biology Co., Ltd., Shanghai, Batch No. ZY69727. Aviva Systems Biology, Cat. No. ARP72894-P050). Wnt3a Antibody, Beta-Catenin (44C6) mAb (Abbkine Inc., Shanghai, Cat. No. M006228, M24002F). Goat Anti-Rabbit IgG Antibody, Goat Anti-Rat IgG Antibody (Solarbio Science and Technology Co., Ltd., Beijing, Cat. No. SE134, SE132). Tris-EDTA Antigen Retrieval Solution 50× (Boster Biological Technology, Ltd., Wuhan, Batch No. AR0023-1). Ready-to-use Immunohistochemistry UltraSensitive™ SP Kit (Maixin Biotech Co., Ltd., Fuzhou, Cat. No. KIT-9730).

Animals

Twenty-four healthy female SPF-grade Wistar rats, aged 6–8 weeks and weighing (160 ± 10) g, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (license number: SCXK (Jing) 2019–0010). All animal experiments were conducted in strict accordance with the ARRIVE 2.0 guidelines and laboratory animal welfare regulations. Rats were housed in the Laboratory Animal Center of Shanxi Bethune Hospital (license number: SYXK (Jin) 2019–0007) under conditions of (23 ± 2)°C temperature, (50 ± 5)% relative humidity, and a 12 h light/dark cycle, with free access to food and water. Experiments were initiated after 1 week of adaptive feeding. The experimental protocol was approved by the Animal Ethics Committee of Shanxi University of Chinese Medicine (approval number: AWE202302079). All surgical procedures were performed under anesthesia with adequate measures to alleviate pain, and rats were euthanized when necessary.

Animal Grouping and Model Construction

Given the 50–70% success rate of CIA modeling, 6 initial rats per group (3 successfully modeled rats for final analysis) provide sufficient statistical power for one-way ANOVA, complying with the 3R principles. Rats were randomly divided into 4 groups (n=6): normal control (NOR), CIA model (CIA), MTX positive control (MTX, 0.9 mg/kg/week), and ASIV intervention (50 mg/kg/day). Except for the NOR group, rats were immunized with bovine type II collagen emulsified in complete Freund’s adjuvant, with a booster in incomplete Freund’s adjuvant 7 days later.

Predefined criteria: successful modeling = total hind limb arthritis score ≥ 8 + vs volume increase ≥ 20% from baseline; exclusion criteria = unqualified score, weight loss > 20%, or death during modeling. Three rats were excluded from each model group (CIA: 2 unqualified scores, 1 weight loss; MTX: 2 unqualified scores, 1 gastrointestinal intolerance; ASIV: 3 unqualified scores), and 3 rats were randomly selected from the NOR group to match sample size. Blinded exclusion per preset criteria did not alter the initial randomization or intergroup comparability.

Administration of Medication and Sample Collection

Drug intervention was initiated on day 14 after primary immunization, with a treatment duration of 4 weeks. The NOR and CIA groups received 2.0 mL normal saline via intragastric gavage once daily. The MTX group received MTX solution at 0.9 mg/kg via intragastric gavage once weekly. The ASIV group received ASIV suspension at 50 mg/kg via intragastric gavage once daily, with a dosing volume of 2.0 mL per rat. At the end of the experiment, in strict accordance with the 4R principle, pain in the animals was minimized to the greatest extent.³² After intervention, rats were fasted for 12 h and anesthetized with isoflurane (induction concentration 3–4%, maintenance concentration 1–2%). Under deep anesthesia, 6–8 mL of whole blood was collected via abdominal aorta puncture. After standing at room temperature, blood was centrifuged at 3000 r/min for 10 min to separate serum, which was stored at −80°C. Rats were sacrificed by cervical dislocation after blood collection. Liver, kidney, spleen, and bilateral hind limb ankle/knee joint tissues were collected. Partial tissues were fixed in 4% paraformaldehyde PBS solution for histopathological examination; the remaining tissues were immediately snap-frozen in liquid nitrogen and stored at −80°C for subsequent mRNA and protein detection.

Arthritis Scoring and Serum Inflammatory Cytokine Detection

Arthritis scoring and vs volume measurement were performed once weekly after primary immunization by two blinded independent researchers. Arthritis scoring adopted a 5-grade 0–4 scale. The total score per rat was the sum of scores from both hind limbs, with a maximum of 8 points. The detailed scoring criteria are shown in Table 1. Right hind vs volume was measured using a vs volume meter, and swelling degree was calculated relative to baseline volume. Serum levels of TNF-α, IL-1β, IL-6, IL-17A, IL-10, and IL-13 were detected by enzyme-linked immunosorbent assay (ELISA). All procedures were performed strictly in accordance with the kit instructions. Each sample was run in 2 technical replicates, and the average value was used for statistical analysis.

Table 1.

Criteria for Arthritis Scoring

Score	Standard for Evaluation
0	Normal
1	Mild redness and swelling of the ankle joint or the foot
2	Moderate redness and swelling from the ankle joint to the middle part of the foot
3	The entire foot is significantly swollen and red, with the inflammation spreading to the toes.
4	The entire foot is significantly swollen, with joint stiffness and deformity causing functional impairment.

Micro-CT Scanning and Bone Morphometric Analysis

Fixed hind limb specimens were dissected to remove excess soft tissue, and ankle joints were scanned with a Skyscan 1276 micro-computed tomography (micro-CT) scanner. Scanning parameters were set as follows: voltage 50 kV, current 200 μA, 0.5 mm aluminum filter, voxel size 10 μm, rotation step 0.4°, scanning resolution 1024×1024. After scanning, three-dimensional reconstruction was performed using NRecon software, with a reconstruction gray threshold set at 80. The region of interest was defined as the trabecular bone area within 1 mm above and below the tibio-talar articular surface. Four bone morphometric parameters were quantified using CTan software: bone mineral density (BMD), bone volume fraction (BV/TV), trabecular thickness (Tb.Th), and trabecular separation (Tb.Sp).

Histopathological Examination

Spleen, liver, and kidney tissues were fixed in 4% paraformaldehyde, then processed for gradient dehydration, clearing, paraffin infiltration, and embedding per standard procedures, with a section thickness of 5 μm. Ankle specimens were fixed for 24 h and decalcified in EDTA solution for approximately 5 weeks, with solution replacement every 3 days. Decalcification was terminated when a fine needle could penetrate the bone without resistance, after which specimens were paraffin-embedded and sectioned. All sections were stained with hematoxylin-eosin (H&E). Ankle sections were additionally stained with Safranin O-fast green, Masson’s trichrome, and tartrate-resistant acid phosphatase (TRAP), with procedures strictly following kit instructions. Blinded semi-quantitative scoring was used to evaluate ankle pathological damage, with 4 dimensions adapted from the SMASH scoring criteria: synovitis (0–3: 0 = no hyperplasia, 1 = mild hyperplasia [1–2 cell layers], 2 = moderate hyperplasia [3–5 cell layers], 3 = severe hyperplasia with pannus); cartilage degradation (0–3: 0 = intact cartilage, 1 = superficial proteoglycan loss, 2 = middle-layer loss with reduced chondrocytes, 3 = full-thickness destruction exposing subchondral bone); bone erosion (0–3: 0 = no erosion, 1 = superficial cortical defect, 2 = moderate trabecular erosion, 3 = extensive destruction involving bone marrow); inflammatory infiltration (0–3: 0 = no infiltration, 1 = scattered inflammatory cells, 2 = focal aggregation, 3 = diffuse full-thickness infiltration). The sum of scores yielded the total pathological score, with higher values indicating more severe damage.

Liver and Kidney Function Safety Assessment

Serum liver function indicators (alanine transaminase, aspartate transaminase, alkaline phosphatase) and renal function indicators (creatinine, urea, uric acid) were measured using an automatic biochemistry analyzer, with operations strictly following standard protocols. Drug safety was comprehensively evaluated in combination with H&E staining of liver and kidney tissues.

Quantitative Real-Time PCR Detection

Spleen and ankle tissues were ground into powder in liquid nitrogen, and total RNA was extracted using a total RNA extraction kit. RNA concentration and purity were measured via microspectrophotometry, with an OD260/280 ratio of 1.8–2.0 considered acceptable purity. RNA integrity was confirmed by 1% agarose gel electrophoresis, with a 28S/18S band ratio ≥ 1.5 indicating good integrity. RNA was reverse-transcribed into cDNA per the reverse transcription kit protocol, and qRT-PCR was performed using the SYBR Green method. The 20 μL reaction system contained 10 μL 2× qPCR supermix, 2.0 μL cDNA template, 0.5 μL each of forward and reverse primers, and 7.0 μL ddH₂O. Reaction program: pre-denaturation at 94°C for 5 min; 40 cycles of 94°C for 30s, 60°C for 30s, 72°C for 30s; final extension at 72°C for 5 min. Each sample was run in 3 technical replicates. GAPDH was used as the reference gene with expression stability validated by the geNorm algorithm. Primer amplification efficiency (95–105%) was confirmed via standard curves, and a single sharp melting curve peak verified amplification specificity. Relative mRNA expression of target genes was calculated using the 2^−ΔΔCt method. Primer sequence information is shown in Table 2.

Table 2.

Primer Sequence Information

Gene	Login Number	Primer Sequence (5’→3’)	Product/bp
NAV2	NM_138529.1	F: ACTGGTCCTCAACCCTGCTA R: GTCGGTCACATCTTGCTGGA	249
Wnt3a	NM_001414349.1	F: ACGATGGCTCCTCTCGGATA R:ACCACCAAATCGGGTAGCTG	76
β-catenin	NM_001431665.1	F: GCAGCGACTAAGCAGGAAGG R: TCACCAGCACGAAGGACAGT	197
GAPDH	NM_017008.4	F: ATGACTCTACCCACGGCAAG R: TGGGTTTCCCGTTGATGACC	75

Western Blot Analysis

Spleen and ankle tissues were homogenized in RIPA lysis buffer supplemented with PMSF to extract total protein, and concentration was determined via bicinchoninic acid (BCA) assay. Each target included 3 biological replicates (independent samples from 3 rats per group), with 1 technical replicate per sample. Equal amounts of protein (50 μg per lane) were separated by SDS-PAGE (5% stacking gel at 80 V for 20 min, 10% resolving gel at 120 V for 60 min) and transferred to nitrocellulose membranes via wet electrotransfer (200 mA for 60 min). After blocking with 5% skim milk for 2 h at room temperature, membranes were incubated with primary antibodies overnight at 4°C, with dilution ratios as follows: GAPDH 1:5000, NAV2 1:500, Wnt3a 1:1000, β-catenin 1:1000. All primary antibodies were manufacturer-validated, and specific band positions were confirmed to match expectations in pre-experiments. After TBST washes, membranes were incubated with HRP-conjugated secondary antibodies (1:15000) for 1–2 h at room temperature. Bands were visualized with enhanced chemiluminescence substrate and imaged with a chemiluminescence system. Gradient exposure was performed to ensure bands remained within the linear range and avoid overexposure. Densitometric analysis was conducted using ImageJ software, with GAPDH as the internal reference for loading normalization.

Immunohistochemistry Staining Analysis

Paraffin sections of spleen and ankle joints were processed per the IHC kit protocol: deparaffinization and rehydration, heat-induced antigen retrieval with citrate buffer, blocking of endogenous peroxidase and non-specific binding, followed by overnight incubation with primary antibodies at 4°C. The dilution ratios of primary antibodies were as follows: NAV2 1:1000, Wnt3a 1:100, β-catenin 1:100. Sections were then incubated with biotin-labeled secondary antibodies and streptavidin-HRP complex, developed with DAB, counterstained with hematoxylin, dehydrated, cleared, and mounted. Images were captured at 10× magnification under an optical microscope. The integrated optical density of positive regions was analyzed by two blinded researchers using ImageJ software, and the average value was used to quantify target protein expression.

Statistical Analysis

GraphPad Prism version 8.3.0 (GraphPad Software) was used for statistical analysis and graph production. Data are expressed as the mean ± standard deviation (SD). A two-tailed independent t-test was used to compare the two groups. A one-way analysis of variance was used to compare multiple groups, followed by the post hoc Tukey’s test. Statistical significance was set at P < 0.05.

Results

General Condition and Serum Inflammatory Cytokine Levels

The results of general condition, body weight change, arthritis score, vs volume, and serum inflammatory cytokine levels are shown in Figure 1. As shown in Figure 1B–D, weekly longitudinal monitoring demonstrated that starting at week 2 following primary immunization, CIA rats exhibited a significantly reduced rate of body weight gain and progressive increases in arthritis scores and vs volume compared with NOR controls, with all between-group differences reaching statistical significance (P < 0.05). After 4 weeks of intervention, vs swelling was alleviated in both the ASIV and MTX groups (Figure 1A), with improvements in body weight and arthritis severity (Figure 1B–D). Body weight was significantly higher in both the ASIV and MTX groups than in the CIA group (ASIV vs CIA: P=0.012, 95% CI −31.94 to −14.60; MTX vs CIA: P=0.002, 95% CI −45.65 to −27.01), with no significant difference between the two treatment groups (P=0.076). Both arthritis scores and vs volume were significantly lower in the two treatment groups than in the CIA group (P < 0.001). Head-to-head comparison showed the ASIV group had a significantly higher arthritis score than the MTX group (P=0.032), with no significant difference in vs volume (P=0.204).

Figure 1.

Effects of ASIV on general physiological parameters and serum inflammatory cytokine levels in CIA rats. (A) Representative appearance of ankle swelling in rats of each group after 4 weeks of intervention. (B) Dynamic changes in body weight. (C) Dynamic changes in arthritis scores. (D) Dynamic changes in vs volume. (E) Serum inflammatory cytokine levels: (Ei), (Eii), (Eiii) and (Eiv) show the levels of pro-inflammatory cytokines TNF-α, IL-1β, IL-6 and IL-17A, respectively; panels (Ev) and (Evi) show the levels of anti-inflammatory cytokines IL-10 and IL-13, respectively. All data are presented as mean ± SD, n = 3 rats per group. ^##P < 0.01, ^###P < 0.001 vs the NOR group; *P < 0.05, **P < 0.01, ***P < 0.001 vs the CIA group; ^&&P < 0.01, ^&&&P < 0.001 vs the MTX group.

Serum cytokine detection results are presented in Figure 1E. Compared with the NOR group, the CIA group had significantly elevated pro-inflammatory cytokines (TNF-α, IL-1β, IL-6, IL-17A) and decreased anti-inflammatory cytokines (IL-10, IL-13) (P < 0.001). Compared with the CIA group, the ASIV group showed significant reductions in TNF-α, IL-1β, and IL-6 (P < 0.001; 95% CI −143.3 to −124.9, −55.32 to −42.59, −84.80 to −74.61, respectively), no significant change in IL-17A (P=0.054), and significant increases in IL-10 and IL-13 (P < 0.001; 95% CI 18.83 to 27.01, 25.55 to 29.13, respectively). The MTX group showed significant reductions in all four pro-inflammatory cytokines (P < 0.001; 95% CI −238.1 to −221.6, −48.07 to −43.65, −87.35 to −78.35, −13.34 to −10.90, respectively) and significant increases in both anti-inflammatory cytokines (P < 0.001; 95% CI 20.93 to 22.96, 23.16 to 27.26, respectively). Direct comparison showed ASIV treatment resulted in significantly higher levels of TNF-α and IL-17A than MTX (TNF-α P < 0.001, 95% CI 85.51 to 105.9; IL-17A P < 0.01, 95% CI 6.252 to 12.24), with no significant differences in other cytokines (P > 0.05).

Micro-CT Evaluation of Bone Microarchitecture

The three-dimensional Micro-CT reconstruction images and bone morphometric parameters of the ankle joints are shown in Figure 2.

Figure 2.

Micro-CT evaluation of ankle subchondral bone microarchitecture in rats from each experimental group. (A) Representative Micro-CT reconstruction images of ankle joints in each group. (B) Quantitative analysis of bone morphometric parameters: (Bi) bone mineral density (BMD), (Bii) bone volume fraction (BV/TV), (Biii) trabecular thickness (Tb.Th), (Biv) trabecular separation (Tb.Sp). All data are presented as mean ± SD, n = 3 rats per group. ^##P < 0.01, ^###P < 0.001 vs the NOR group; *P < 0.05, **P < 0.01, ***P < 0.001 vs the CIA group; ^&P < 0.05, ^&&P < 0.01 vs the MTX group.

Three-dimensional reconstruction revealed typical invasive bone destruction patterns of RA (Figure 2A): the NOR group had smooth and continuous articular surfaces with regularly arranged, intact subchondral trabecular bone; the CIA group presented multiple honeycomb erosive defects on the articular surface, interrupted subchondral bone continuity, and sparse, fractured and disorganized trabeculae, consistent with the pathological features of RA bone destruction; both the ASIV and MTX groups showed markedly reduced erosion areas and varying degrees of restored articular surface integrity.

Quantitative analysis results were consistent with the morphological findings (Figure 2B). Compared with the NOR group, the CIA group had significantly decreased BMD, BV/TV, and Tb.Th (P < 0.001, 95% CI −0.2415 to −0.1800; P < 0.001, 95% CI −28.14 to −23.77; P = 0.0002, 95% CI −0.1120 to −0.07103), and significantly increased Tb.Sp (P = 0.0012, 95% CI 0.03470 to 0.07019).

Compared with the CIA group, ASIV treatment significantly improved the above bone microstructural parameters (BMD P = 0.0007, 95% CI 0.07956 to 0.1441; BV/TV P = 0.0181, 95% CI 2.929 to 17.93; Tb.Th P = 0.0012, 95% CI 0.03467 to 0.06971; Tb.Sp P = 0.0346, 95% CI −0.06056 to −0.003788), effectively preserving trabecular bone microstructure. The MTX group showed a consistent improvement trend in all bone parameters (BMD P < 0.0001, 95% CI 0.1355 to 0.1931; BV/TV P < 0.0001, 95% CI 21.09 to 24.85; Tb.Th P < 0.0001, 95% CI 0.06472 to 0.08395; Tb.Sp P = 0.0002, 95% CI −0.06850 to −0.04342).

Direct comparative analysis of the two treatment groups revealed that the ASIV group exhibited significantly elevated BMD, BV/TV, and Tb.Th relative to the MTX group (P = 0.0063, 0.0106, and 0.0253, respectively). In contrast, no significant intergroup difference was observed in Tb.Sp between the ASIV and MTX groups (P = 0.0620).

Histopathological Changes of Spleen and Joint Tissues

Figure 3 shows the histopathological changes and pathological scores of the ankle joint and spleen in each group. Splenic H&E staining revealed white pulp hyperplasia with expanded germinal centers in the CIA group, indicative of systemic immune activation. Both treatments partially restored normal splenic architecture. Ankle joint morphological observation (Figure 3A) demonstrated intact joint structure, quiescent thin synovium, and homogeneous cartilage matrix without inflammatory injury or bone erosion in the NOR group. By contrast, CIA rats exhibited typical RA-like pathological features, including severe synovial hyperplasia, pannus formation, cartilage proteoglycan loss, subchondral bone erosion, and synovial fibrosis, accompanied by massive accumulation of TRAP-positive osteoclasts in eroded lesions. Both ASIV and MTX treatments substantially ameliorated these arthritic pathological injuries.

Figure 3.

Ameliorative effects of ASIV on histopathological damage of ankle joints and spleen in CIA rats. (A) Histopathological staining of ankle joint and spleen tissues in each group (×10). (B) Blinded semi-quantitative pathological scores and cell counting for indicators derived from different staining assays: (Bi) synovitis score, (Bii) cartilage degradation score, (Biii) synovial fibrosis score, (Biv) bone erosion score, (Bv) TRAP-positive cell count. Scale bars: 100 μm for splenic H&E staining, 250 μm for joint tissue staining. All data are presented as mean ± SD, n = 3 rats per group, ^##P < 0.01, ^###P < 0.001 vs the NOR group; **P < 0.01, ***P < 0.001 vs the CIA group.

Blinded semi-quantitative scoring confirmed the above morphological results (Figure 3B). Compared with the NOR group, the CIA group presented markedly increased scores of synovitis, cartilage damage, synovial fibrosis, and bone erosion (P < 0.001), as well as more TRAP-positive osteoclasts (P < 0.01). Relative to the CIA group, ASIV treatment significantly reduced all pathological scores and TRAP-positive cell count (synovitis: P=0.0011, 95% CI −1.681 to −0.8528; cartilage degradation: P=0.0013, 95% CI −1.570 to −0.7633; fibrosis: P=0.0021, 95% CI −1.437 to −0.6299; bone erosion: P=0.0006, 95% CI −1.704 to −0.9631; 56.4% reduction in TRAP-positive cells: P=0.0007, 95% CI −13.40 to −7.264). MTX treatment yielded consistent ameliorative effects (synovitis: P=0.0003, 95% CI −2.004 to −1.263; cartilage degradation: P=0.0005, 95% CI −1.870 to −1.063; fibrosis: P=0.0004, 95% CI −1.746 to −1.054; bone erosion: P=0.0001, 95% CI −2.007 to −1.393; 56.4% reduction in TRAP-positive cells: P=0.0002, 95% CI −14.95 to −9.716). No statistically significant differences were detected in any pathological endpoint between the ASIV and MTX groups (P > 0.05).

Safety Assessment of Liver and Kidney Function

The serum biochemical indicators related to liver and kidney functions in each group of the rats showed that (Figure 4A and B) liver (ALT, AST, and ALP) and kidney (CRE, URE, and UA) function indicators were all within the normal range. The pathological analysis of the liver and kidney tissues is shown in Figure 4C. The liver tissue structure of rats in each group was intact, with hepatocytes arranged regularly, a clear hepatic cord structure, and normal hepatic lobule morphology. Mitotic figures, lymphocyte exudation, abnormal necrosis, hyperplasia, or inflammatory cell infiltration were not observed. The kidney tissue structures in each rat group were normal. The renal tubular epithelial cells were arranged neatly, and the volume and structure of the glomeruli were normal, with no abnormal hyperplasia or inflammatory cell infiltration. These results indicate that no obvious hepatorenal toxicity of ASIV was observed in rats at the dose of 50 mg/kg/day over a 4-week intervention period. As this study is a short-term, small-sample observation without dose-gradient toxicity, long-term toxicity, or multi-organ toxicity indicators, comprehensive safety evaluation requires further validation with larger samples and extended observation periods.

Figure 4.

Hepatic and renal function parameters and histopathological assessment in rats of each experimental group. (A) Hepatic biochemical biomarkers: (Ai) AST, (Aii) ALT, (Aiii) ALP. (B) Renal biochemical biomarkers: (Bi) CRE, (Bii) UREA, (Biii) UA. The upper and lower dashed lines indicate the upper and lower limits of the normal reference range for each indicator, respectively. (C) H&E staining of liver and kidney tissues. Scale bar = 25 μm for liver sections (magnification, ×40); scale bar = 50 μm for kidney sections (magnification, ×20). All data are presented as mean ± SD, n = 3 rats per group.

mRNA Expression of the NAV2-Wnt/β-Catenin Pathway

The transcript levels of NAV2, Wnt3a, and β-catenin in spleen and ankle joint tissues were quantified by qRT-PCR, with results presented in Figure 5. Compared with the NOR group, the CIA group exhibited significant transcriptional upregulation of all three genes in both tissues (P < 0.001), indicating that activation of the NAV2-Wnt/β-catenin cascade is associated with RA pathological alterations. Relative to the CIA group, both treatments exerted significant inhibitory effects on pathway gene expression. For the ASIV group, all three transcripts were markedly downregulated in the spleen (P < 0.001); in the ankle joint, robust reductions were observed for Wnt3a and β-catenin (P < 0.001), along with a significant decrease in NAV2 (P < 0.01). The MTX group showed a consistent suppressive trend: all three genes were significantly downregulated in the spleen (P < 0.001); in the ankle joint, NAV2 and β-catenin were significantly reduced (both P < 0.01), with a statistically significant decrease also detected for Wnt3a (P < 0.05). Head-to-head comparison between the two treatment groups showed that, compared with the MTX group, the ASIV group had significantly higher mRNA expression of Wnt3a (P < 0.05) and β-catenin (P < 0.001) in the spleen, with no statistically significant difference in NAV2 mRNA. In ankle tissue, the mRNA expression of all three molecules in the ASIV group was significantly higher than in the MTX group, with statistical significance for NAV2 and Wnt3a (P < 0.01) as well as β-catenin (P < 0.05). These results suggest that activation of the NAV2-Wnt/β-catenin axis is associated with pathological changes in RA, and ASIV can downregulate the molecular expression of this axis at the transcriptional level.

Figure 5.

Relative mRNA expression of NAV2, Wnt3a and β-catenin in spleen and joint tissues of rats from each experimental group. (A) Relative mRNA levels of NAV2, Wnt3a and β-catenin in splenic tissues of each group. (B) Relative mRNA levels of NAV2, Wnt3a and β-catenin in joint tissues of each group. All data are presented as mean ± SD from three independent experiments, ^###P < 0.001 vs the NOR group; *P < 0.05, **P < 0.01, ***P < 0.001 vs the CIA group; ^&P < 0.05, ^&&P < 0.01, ^&&&P < 0.001 vs the MTX group.

Protein Expression of the NAV2-Wnt/β-Catenin Pathway

Western blot analysis of NAV2, Wnt3a and β-catenin protein levels in spleen and ankle joint tissues is presented in Figure 6A and B. Consistent with the transcriptional findings, the expression of all three proteins in both tissues was significantly upregulated in CIA rats compared with the NOR group (P < 0.001). Relative to the CIA group, ASIV significantly reduced the expression of pathway proteins: all three proteins were downregulated in splenic tissues (P < 0.01), while in ankle joint tissues, the expression of NAV2, Wnt3a (P < 0.01) and β-catenin (P < 0.001) was markedly decreased. MTX exerted a consistent inhibitory effect: in splenic tissues, the expression of NAV2 (P < 0.05), Wnt3a (P < 0.001) and β-catenin (P < 0.01) was reduced; in joint tissues, NAV2, β-catenin (P < 0.01) and Wnt3a (P < 0.001) were significantly downregulated. Head-to-head comparison revealed that the Wnt3a protein level in both spleen and ankle joint tissues of the ASIV group was significantly higher than that of the MTX group (P < 0.01), while no statistically significant differences were observed in NAV2 and β-catenin expression in either tissue between the two groups (P > 0.05). These findings were consistent with the mRNA expression trends, further verifying that ASIV downregulates the expression of proteins associated with the NAV2-Wnt/β-catenin pathway.

Figure 6.

Protein expression levels of NAV2, Wnt3a and β-catenin in spleen and joint tissues of rats from each experimental group. (Ai) Representative Western blot bands of spleen tissues from each group. (Aii) Relative protein level of NAV2, (Aiii) relative protein level of Wnt3a, (Aiii) relative protein level of β-catenin in spleen tissues. (Bi) Representative Western blot bands of joint tissues from each group. (Bii) Relative protein level of NAV2, (Biii) relative protein level of Wnt3a, (Biv) relative protein level of β-catenin in joint tissues. All data are presented as mean ± SD from three independent experiments. ^###P < 0.001 vs the NOR group; *P < 0.05, **P < 0.01, ***P < 0.001 vs the CIA group; ^&&P < 0.01 vs the MTX group.

Immunohistochemical Localization and Quantification of NAV2-Wnt/β-Catenin Pathway Proteins

IHC staining was performed to examine the localization and distribution of NAV2, Wnt3a and β-catenin in rat spleen and ankle joint tissues, followed by semi-quantitative analysis based on integrated optical density (IOD) values. The results are presented in Figure 7. Positive immunostaining of NAV2, Wnt3a and β-catenin was detected in both splenic and articular tissue cells across all experimental groups (Fig. 7Ai, 7Bi). Semi-quantitative analysis (Fig 7Aii–7Aiv, 7Bii–7Biv) showed that compared with the NOR group, the expression levels of all three proteins in both spleen and ankle joint tissues were significantly elevated in the CIA group, with statistically significant differences (P < 0.01, P < 0.001). Relative to the CIA group, ASIV intervention significantly downregulated pathway protein expression in both tissues. Specifically, in splenic tissues, ASIV markedly reduced the protein levels of NAV2 and β-catenin (P < 0.01), and exerted a stronger inhibitory effect on Wnt3a expression (P < 0.001); in ankle joint tissues, ASIV significantly downregulated all three target proteins (P < 0.001). The MTX positive control group showed a consistent suppressive effect on pathway proteins: in splenic tissues, MTX significantly downregulated NAV2 and Wnt3a (P < 0.001) and reduced β-catenin expression (P < 0.05); in ankle joint tissues, MTX also significantly suppressed the expression of all three proteins (P < 0.001). Head-to-head comparison revealed no statistically significant differences in the expression of all three proteins in either spleen or ankle joint tissues between the ASIV and MTX groups (P > 0.05).

Figure 7.

Immunohistochemical (IHC) protein localization and grayscale value analysis in spleen and joint tissues of rats from each group. (Ai) Representative IHC staining images for protein localization in rat spleen tissues from each group. (Aii) Grayscale value of NAV2, (Aiii) grayscale value of Wnt3a, (Aiv) grayscale value of β-catenin in spleen tissues. (Bi) Representative IHC staining images for protein localization in rat joint tissues from each group. (Bii) Grayscale value of NAV2, (Biii) grayscale value of Wnt3a, (Biv) grayscale value of β-catenin in joint tissues. All data are presented as mean ± SD from three independent experiments, ^##P < 0.01, ^###P < 0.001 vs the NOR group; *P < 0.05, **P < 0.01, ***P < 0.001 vs the CIA group. Scale bar = 250 μm (magnification, × 10).

The IHC results were fully consistent with the protein expression trends detected by Western blot, further confirming the dysregulation of the NAV2-Wnt/β-catenin signaling cascade in the RA model and verifying the regulatory effect of ASIV on this pathway.

Discussion

Our study demonstrated that ASIV, the primary bioactive saponin monomer of Astragalus membranaceus, significantly ameliorated joint swelling, reduced arthritis severity, and preserved subchondral bone microarchitecture in CIA rats, with no observable hepatorenal toxicity at the tested dose. These findings align with prior reports documenting the anti-inflammatory, chondroprotective and osteogenesis-regulating properties of ASIV in inflammatory arthritis models.^19,21,22 Previous mechanistic investigations have linked the anti-arthritic effects of ASIV to inhibition of classical NF-κB and MAPK inflammatory cascades and activation of the Nrf2/HO-1 antioxidant pathway, which collectively suppress pro-inflammatory mediator release and protect cartilage from degradation.²² Building on these established effects, our work further provides in vivo evidence that ASIV concurrently restores the balance of circulating pro- and anti-inflammatory cytokines and ameliorates systemic immune activation and local joint pathological damage, offering experimental support for the clinical application of Astragalus-associated traditional Chinese medicine formulas in RA management.

To further delineate the immunomodulatory mechanisms underlying the protective effects of ASIV, we profiled serum inflammatory cytokine levels. Cytokine imbalance represents a central driver of immune dysregulation and inflammatory progression in RA, and restoring the pro-/anti-inflammatory cytokine balance is a core therapeutic goal for RA immunomodulation. In line with the phenotypic improvements, ASIV significantly reduced serum concentrations of the pro-inflammatory cytokines TNF-α, IL-1β, and IL-6, while elevating the anti-inflammatory cytokines IL-10 and IL-13 in CIA rats. Consistently, histopathological assessment revealed that ASIV mitigated inflammatory cell infiltration, synovial hyperplasia, and cartilage degradation in both the spleen and joint tissues, and suppressed osteoclast activation, corroborating its ameliorative effects on RA-related inflammation and structural injury at the tissue level.

Aberrant activation of the Wnt/β-catenin signaling cascade is a well-recognized molecular event driving synovial hyperplasia, cartilage degradation and bone erosion in RA, primarily via promoting FLS overproliferation, invasiveness and osteoclast overactivation.^24,26,27 Targeted modulation of the Wnt/β-catenin pathway is therefore recognized as a critical strategy for RA intervention, and upstream regulators of this cascade have become attractive targets for natural product research. As an upstream regulator of this pathway, NAV2 has been shown to be upregulated in RA synovial tissue and to potentiate FLS inflammatory and invasive phenotypes by activating Wnt/β-catenin signaling; NAV2 silencing effectively blocks pathway activation and retards RA progression, highlighting it as a promising therapeutic target.^28,29

In this study, we examined the regulatory effect of ASIV on the NAV2-Wnt/β-catenin axis in both the spleen (a central immune organ) and ankle joint tissue (the primary lesion site) at both transcriptional and translational levels. Our data revealed that NAV2, Wnt3a and β-catenin were markedly upregulated in both tissues of CIA rats, and ASIV treatment consistently downregulated their mRNA and protein expression. These molecular changes were highly concordant with the observed improvements in inflammatory phenotypes and joint structural damage. Our findings are consistent with a previous network pharmacology prediction that ASIV may target the NAV2-Wnt/β-catenin pathway,³¹ and echo a recent report demonstrating that matrine ameliorates RA via targeting this same signaling axis.³⁰ Taken together, these data indicate that the protective effects of ASIV against RA are, at least in part, mediated by inhibition of the NAV2-Wnt/β-catenin signaling cascade.

Conclusion

This study shows that ASIV exerts preliminary protective effects against joint inflammation and structural damage in a rat CIA model, which is associated with inhibition of the NAV2-Wnt/β-catenin signaling cascade. No obvious hepatorenal toxicity was detected under short-term administration, but the current evidence is insufficient to support clinical translation. Further mechanistic, dose-response, pharmacokinetic, toxicological and translational studies are required to verify its therapeutic potential for rheumatoid arthritis.

Funding Statement

The work was supported by the National Natural Science Foundation of China (Grant No.: 81904034), and Fundamental Research Program of Shanxi Province (Grant No.: 202303021211172, 202403021221262), and China Postdoctoral Science Foundation (Grant No.: 2022M722004), and State Administration of Traditional Chinese Medicine of Shanxi Province (Grant No.: 2023ZYYC058, 2024ZYY2A015, 2024ZYY2A019), and the Open Project Research Fund of the Shanxi Provincial Key Laboratory of Jingfang Fuyang (Grant No.: 202104010910011), and the Scientific Research and Innovation Team Plan Project of Shanxi Bethune Hospital (Grant No.: 2024AOXIANG02), and innovative Research Project for Postgraduates of Shanxi University of Chinese Medicine (Grant No.: X2025KY010).

Abbreviations

ALP, alkaline phosphatase; ALT, alanine transaminase; ASIV, astragaloside IV; AST, aspartate transaminase; BCA, bicinchoninic acid; BMD, bone mineral density; BV/TV, bone volume fraction; CIA, collagen-induced arthritis; CRE, creatinine; DAB, diaminobenzidine; EDTA, ethylenediaminetetraacetic acid; ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocytes; H&E, hematoxylin-eosin; IL-1β, interleukin-1β; IL-6, interleukin-6; IL-10, interleukin-10; IL-13, interleukin-13; IL-17A, interleukin-17A; Micro-CT, Micro-computed tomography; NC, nitrocellulose; PBS, phosphate-buffered saline; RA, rheumatoid arthritis; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; Streptavidin-HRP, Streptavidin-horseradish peroxidase; TCM, traditional Chinese medicine; Tb.Sp, trabecular separation; Tb.Th, trabecular thickness; TNF-α, tumor necrosis factor-α; TRAP, tartrate-resistant acid phosphatase; UA, uric acid; qRT-PCR, quantitative reverse transcription polymerase chain reaction.

Data Sharing Statement

Data are available upon reasonable request to the corresponding author.

Ethics Approval and Consent to Participate

All animal procedures were conducted in accordance with the National Standards for Laboratory Animal Welfare of China (GB/T 35892-2018), the Guide for the Care and Use of Laboratory Animals, and the ARRIVE guidelines 2.0. The study protocol was approved by the Animal Ethics Committee of Shanxi University of Chinese Medicine (Approval No.: AWE202302079; Date: February 7, 2023). This study did not involve human participants, thus consent to participate was not applicable.

Author Contributions

Yao Ma: Conceptualization, Investigation, Formal analysis, Data curation, Visualization, Writing – original draft. Qianyu Guo: Methodology, Investigation, Validation, Writing – review & editing. Meie Liang: Formal analysis, Data curation, Resources, Writing – review & editing. Zhen Li: Conceptualization, Supervision, Funding acquisition, Project administration, Writing – review & editing. Liyun Zhang: Conceptualization, Supervision, Funding acquisition, Resources, Writing – review & editing. All authors gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

Disclosure

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this article.