Expansion of human pluripotent stem cell-induced nephron progenitor cells (iNPCs) and the generation of nephron organoids from iNPCs

Abstract

Nephron progenitor cells (NPCs) play a central role in kidney organogenesis: they self-renew and differentiate into nephrons, the functional units of the kidney. Human pluripotent stem cells (hPSCs) can transiently induce nephron progenitor-like cells (iNPCs) which then differentiate into nephron organoids. Here, we describe a protocol to purify and expand the hPSC-derived iNPCs in a regular monolayer culture format with an optimized iNPC culture medium. Under this culture condition, iNPCs are programmed to a state with their transcriptome much closer to primary human NPCs than the transient hPSC-derived iNPCs. Following this protocol, iNPC lines can be derived from any hPSC lines, exhibiting stable cell proliferation rate and retain NPC marker gene expression over long-term culture. We also describe a protocol to generate nephron organoids from the iNPC lines. These iNPC-derived nephron organoids show minimal off-target cell types compared to hPSC-derived kidney organoids, with enhanced podocyte maturity. This protocol consists of a modified 10-day protocol to generate iNPCs from hPSCs, an iNPC expansion phase with a unique chemically-defined iNPC expansion medium called hNPSR-v2, and a stepwise 21-day differentiation protocol to generate nephron organoids from iNPCs on an air-liquid interface. Experiences in culturing and differentiating hPSCs are required to conduct this protocol, which can be executed within 1.5 to 2 months.

Editorial summary:

Protocol to purify and expand hPSC-derived induced nephron progenitor cells (iNPCs) for long term culture in a regular monolayer culture format, and for the generation of nephron organoids.

Proposed tweet:

Expansion of human pluripotent stem cell-induced nephron progenitor cells (iNPCs) and the generation of nephron organoids from iNPCs

Proposed teaser:

Long-term culture of nephron progenitor-like cells

Introduction

Nephrons are the functional units of the kidney. On average, 1 million nephrons are present in one human kidney. Each nephron consists of more than 30 different cell types that are spatially organized to perform its diverse kidney functions from glomerular filtration to tubular reabsorption and secretion^1–4. Six2⁺ nephron progenitor cells (NPCs) play a central role in kidney organogenesis: they self-renew and give rise to all the major nephron cell types⁵. Over the past decade, kidney organoids have been developed from human pluripotent stem cells (hPSCs) by recapitulating normal kidney organogenesis^6–22. To develop nephron organoids, hPSCs transition sequentially through mesoderm, intermediate mesoderm, and posterior intermediate mesoderm to generate a transient hPSC-induced NPC (iNPC) population. These transient iNPCs then further develop into nephron cell types in the organoids. Those pioneering in vitro human kidney models have enhanced our understanding of human kidney development and disease mechanism²³. Despite the progress, cellular immaturity and the presence of large numbers of off-target cell types in hPSC-derived kidney organoids have hindered the development of safe and effective kidney replacement therapies and prevented the accurate modeling of kidney diseases, especially adult-onset diseases^23–27. In this protocol, we describe in detail our recently published methodologies for deriving long-term expandable human iNPC lines from hPSCs. These iNPC lines exhibit a stable cell proliferation rate, retain NPC marker gene expression over long-term culture, and can be directly used for the generation of nephron organoids, demonstrating minimal off-target cell types with enhanced organoid maturity²⁸ (Fig. 1).

Fig. 1 |. Overview of the protocol.

Schematic diagram of the four major stages of the protocol including 1) hPSC thawing and passaging (blue box), 2) hPSC-to-iNPC differentiation (green box), 3) iNPC line derivation (orange box), and 4) generation of nephron organoids from iNPC lines (yellow box). Key culture medium components for each stage are listed in the lower parts of the boxes. *, for hPSC lines with a SIX2 reporter to purify SIX2⁺ iNPCs, 5 days are needed to derive the iNPC line and perform the basic quality-control characterization; for hPSC lines without SIX2 reporter, 17 days are needed to derive the iNPC line via serial passaging in hNPSR-v2 medium.

Development of the protocol

To track and purify hPSC-derived iNPCs, we first used CRISPR/Cas9 system to engineer hPSCs with a SIX2-GFP; PAX2-mCherry dual reporter system^28,29. The protocol to induce transient iNPCs from hPSCs was optimized from a previously published Morizane protocol^7,30, using a series of different combinations of growth factors and small molecules at each stage of hPSC differentiation to mirror the respective signals activated during kidney organogenesis. In the first stage to generate primitive streak from hPSCs, a combination of WNT agonist (CHIR99021) and bone morphogenetic protein (BMP) inhibitor (noggin or dorsomorphin) was used in the original Morizane protocol. Here, we use a different BMP inhibitor LDN193189, commonly used for inhibiting BMP signaling. During stage two to generate posterior intermediate mesoderm from primitive streak (D4 to D7), we noticed dramatic cell death following the original protocol which eventually led to a failed differentiation. We found that incorporation of a Rho-kinase inhibitor (Y-27632) was able to improve cell survival at this stage and thus Y-27632 is added in stage two, in addition to Activin A from the original protocol. At the third stage of differentiation from posterior intermediate mesoderm to NPCs, we use 50 ng/ml fibroblast growth factor 9 (FGF9) instead of the original 10 ng/ml since this change significantly increased SIX2⁺/PAX2⁺ iNPC induction efficiency based on the dual reporter expression²⁸. Following this optimized hPSC-to-iNPC differentiation protocol, typically 30–50% of the cells will be SIX2⁺ (10–20% will be SIX2⁺/PAX2⁺) based on fluorescence-activated cell sorting (FACS) analysis at the end of stage three²⁸.

FACS-purified SIX2⁺/PAX2⁺ iNPCs are then cultured in a chemically defined human nephron progenitor self-renewal-v2 medium (hNPSR-v2) for expansion²⁸. The hNPSR-v2 medium was developed from further optimizing our previously described culture medium that can expand primary mouse NPCs in 3D culture²⁹. The rationale for the development of NPC culture condition was to mirror the nephrogenic niche environment that promotes the self-renewal of the proliferating NPCs in vivo. Based on our previously described mNPSR-v1 medium recipe to culture mouse NPCs as 3D-aggregates^29,31, which include fibroblast growth factor 2 (FGF-2) that promotes NPC survival, bone morphogenetic protein 7 (BMP-7) and mouse leukemia inhibitory factor (LIF) that maintain NPC survival and stemness, CHIR99021 that mirrors the Wnt11 signal in vivo critical for maintaining NPC self-renewal, Y-27632 (ROCK inhibitor), Heparin (FGF cofactor), A83–01 (TGF-β signaling inhibitor), and LDN193189 (BMP signaling inhibitor), we further screened culture conditions and developed mNPSR-v2 medium that allows clonal expansion of mouse NPCs in regular monolayer culture format instead of 3D aggregate culture²⁸. Key to the transition from 3D-to-2D culture is the use of two additional small molecules SB202190 (p38 MAPK inhibitor) and DAPT³² (Notch signaling inhibitor). CHIR99021 concentration was also adjusted from 1 μM in 3D culture to 1.5 μM in 2D culture. To develop optimal human iNPC culture condition, we first replaced mouse LIF in mNPSR-v2 with human LIF to formulate human nephron progenitor self-renewal-v1 medium (hNPSR-v1), since mouse LIF does not activate human LIF receptors. However, human iNPCs cultured in hNPSR-v1 were only able to maintain their NPC identity for 2 weeks before a gradual decline of cell proliferation activity and key NPC marker gene expression was observed. YAP activity has been reported to play critical roles in NPC self-renewal in vivo³³. Upon observation of decreased YAP activity in the iNPCs cultured with hNPSR-v1, we supplemented TRULI, a small molecule YAP agonist³⁴, to hNPSR-v1 to formulate hNPSR-v2. The hNPSR-v2 allows long-term expansion of the iNPCs over several months with retained NPC marker gene expression and nephrogenic potential²⁸. Importantly, the hNPSR-v2 medium can enrich the transient iNPCs from hPSC differentiation over serial passages, even if the iNPCs were not purified by FACS at the beginning of culture²⁸. This feature allows the derivation of iNPC lines from any hPSC line without prior genome editing to knock in the SIX2/PAX2 dual reporter system, greatly broadening the applications.

Long-term expanded iNPCs in hNPSR-v2 medium retain their developmental potential to undergo their nephron fate²⁸. First, the iNPCs are dissociated into single cells and reaggregated to form iNPC aggregates in 96-well low-attachment U-bottom plates. The iNPC aggregates are then transferred to Transwell culture at the air-liquid interface, a condition used for decades for mouse kidney explant culture^35,36 and for kidney organoid development^6–8. To mirror mesenchymal-to-epithelial transition (MET), the initiation step of nephron induction from NPCs, CHIR99021^7,8 is used to mimic the nephron-inducing Wnt9b signal from the developing ureteric bud in vivo³⁷. Upon the initial Wnt signaling activation, iNPCs will differentiate into nephron structures within 2–3 weeks. Transitioning from APEL2 basal medium to advanced RPMI 1640 medium on day 5 of organoid development can better support the structural integrity of the organoid, especially the maintenance of nephron tubule architecture. Supplementation of A83–01 should result in increased organoid maturity, as observed by specific collagen markers in the podocytes and megalin (LRP2) in the proximal tubules²⁸. Thus, these parameters are included in the iNPC-to-nephron organoid differentiation procedures. Following this protocol, major nephron segments are induced within 2 weeks of iNPC differentiation, with more maturity observed after 3 weeks of differentiation.

Alternative Methods

Multiple protocols have described the generation of hPSC-derived iNPCs, transitioning sequentially through mesoderm, intermediate mesoderm, and posterior intermediate mesoderm, recapitulating normal kidney organogenesis^7,8,22. However, in these protocols, these iNPCs are transient, and are induced to undergo MET to generate nephron structures immediately after they are formed. Direct reprogramming³⁸ (or trans-differentiation) from fibroblasts to nephron progenitor-like cells through the forced expression of NPC-specific transcription factors has also been reported^39,40. In addition, culture conditions have been described to expand hPSC-derived iNPCs for a short period of time (up to 2 passages, or 14 days)^41,42. Compared to these alternative methods to produce nephron progenitor-like cells in vitro, the protocol described here can stably expand hPSC-derived iNPCs for several months with high purity (90–95% SIX2⁺) and retained nephrogenic potential, allowing scalable manufacturing of high-quality human iNPCs for regenerative medicine and other applications. Importantly, transcriptome analysis of the iNPCs cultured in hNPSR-v2 indicated better resemblance to primary human NPCs in vivo, as compared to the transient iNPCs generated from hPSC differentiation. Nephron organoids have been generated from hPSCs transitioning through the transient iNPCs^6–22. Compared to these hPSC-derived nephron organoids, cultured iNPC-derived nephron organoids show minimal off-target cell types and increased nephron maturity, such as the formation of COL4A3⁺/COL4A4⁺ mature podocytes²⁸. A recent publication⁴³ used an improved iNPC specification step from standard nephron organoid protocol⁸ and demonstrated significant enhancement of proximal tubule segmentation and maturity, which is consistent with our observation that NPCs with higher quality will be able to generate more mature nephrons.

Application

The ability to manufacture near-pure human iNPCs presents an unprecedented opportunity to study human kidney development, disease, and regeneration. We showed in a proof-of-concept genome-wide CRISPR screen in the cultured mouse NPCs, that candidate genes regulating NPC self-renewal can be unbiasedly identified, with implications in congenital kidney disease and Wilms tumor development²⁸. Similar genome-scale screening or omics approaches can be applied to the in vitro accessible human iNPCs to understand human NPC biology. We showed that genome-editing can be performed directly in the iNPC lines, allowing rapid genetic modifications in the iNPCs and assessment of their functional consequences in nephron organoids. As an example, we showed polycystic kidney disease 2 gene knockout (PKD2^−/−) iNPCs are expandable and can reproducibly and highly efficiently generate cystic nephron organoids recapitulating the disease phenotype²⁸. Following similar approach, other disease-related genetic modifications can be introduced to the iNPC lines to generate novel models of kidney diseases. We also showed that hNPSR-v2 medium was able to reprogram hPSC-derived podocytes, or primary podocytes isolated from human fetal kidneys to an NPC-like state, revealing previously unknown podocyte plasticity²⁸. This in vitro model offers an opportunity to understand the detailed molecular mechanisms underlying kidney cell plasticity in the future. Compared to hPSC-derived nephron organoids, podocytes generated from the iNPC-derived nephron organoids show higher expression of mature podocyte marker genes such as COL4A3 and COL4A4, offering a potential tool to model glomerular diseases that cannot be recapitulated with current podocyte models that do not express these genes. However, it is important to consider the following limitations before using this model to study glomerular diseases: 1) These iNPC-derived nephron organoids are not vascularized, preventing the modeling of glomerular filtration as in a perfused glomerulus in vivo; 2) Whether specialized podocyte structures (e.g. slit diaphragm) are properly formed in this in vitro model remains to be determined.

Limitations

It is important to note that although cultured iNPCs are similar to primary human NPCs in global gene expression and in developmental potential, some differences still exist. For example, upon long-term culture, iNPCs tend to decrease the expression of PAX2, a transcription factor that is well-established in kidney development based on mouse genetics studies^1,44. Interestingly, reduced expression of PAX2 appears not to affect iNPC differentiation into nephron organoids following this protocol on Transwell. This is consistent with a prior observation that PAX2 knockout hPSCs can differentiate into nephron organoids⁴⁵. PAX8, a paralog of PAX2 that shares similar transcriptional activity⁴⁶, is highly expressed in the iNPCs, likely compensating for PAX2 reduction overtime. Nevertheless, limitations may exist for utilizing iNPC model to study the function of PAX2 in human kidney development and its dysfunction in the development of congenital kidney diseases.

Compared to standard hPSC-derived nephron organoids^7,8 without NPC purification step, purified iNPC line-derived nephron organoids show dramatically reduced off-target cells as expected (0.67% as shown by single-cell multiome analysis²⁸). Interestingly, podocytes reproducibly dominate the nephron cell types found in iNPC-derived nephron organoids (70–90% are podocytes while 10–30% are tubules based on different batches of experiments). Since this biased podocyte differentiation is evident in iNPC lines at both early and late passages, this phenomenon likely reflects an intrinsic bias from the use of purified iNPCs for differentiation. Future efforts are warranted to understand the underlying mechanisms and to modify the iNPC differentiation protocol to generate a nephron organoid with the presence of balanced nephron cell types, especially the improvement of nephron tubule formation. Thus, current iNPC-derived nephron organoids are not ideal for modeling diseases where tubules are the primary sites of pathology.

As compared to a complex kidney in vivo, both iNPC-derived nephron organoids and hPSC-derived nephron organoids share a few common limitations, such as insufficient nephron patterning as seen in vivo (e.g. frequent formation of scattered but not continuous nephron segments, and lack of cortical-medullary axis), immaturity of nephron tubules (e.g. proximal tubule cells do not express high levels of transporters essential for kidney functions, such as the organic anion/cation transporters, and loop of Henle cells do not express uromodulin/UMOD), and the lack of major kidney cell types within the nephron lineage (e.g. SLC12A3⁺ distal convoluted tubule) and beyond the nephron lineage (collecting duct, stroma, vasculature, and neuronal systems).

Overview of the procedure

hPSCs are routinely cultured in mTeSR Plus medium (Steps 1–9) and can differentiate into iNPCs using a three-stage protocol in 10 days (Steps 10–30). For hPSC lines that have NPC-specific reporter (e.g. SIX2-GFP; PAX2-mCherry dual reporter), differentiated iNPCs can be purified by FACS (Step 31 Option A); for hPSC lines without NPC-specific reporter, differentiated cells can be cultured in hNPSR-v2 which will lead to enrichment of iNPC population over a few passages (Step 31 Option B); for hPSC lines without NPC-specific reporter and the differentiated cells have a lot of off-target cells, cell surface marker integrin subunit alpha 8 (ITGA8) can be used to enrich iNPCs (Step 31 Option C). The purified or enriched iNPCs can be cultured stably in hNPSR-v2 medium for expansion (Steps 32–41) or cryopreserved for long-term storage (Steps 42–44). Cultured iNPCs are routinely characterized by immunostaining every 4–5 passages (2–3 weeks) to verify iNPC identity and purity (Steps 45–52). Cultured iNPCs can differentiate into nephron organoids in a 6-well Transwell plate in three phases within 21 days (Steps 53–64). Quality of nephron organoid generation can be assessed by immunostaining and RT-qPCR (Step 64).

Experimental design

Maintenance of hPSC

The hPSCs are routinely maintained in feeder-free conditions in commercially available mTeSR Plus medium (STEMCELL Technologies). Routine testing for mycoplasma is performed and hPSCs are discarded if tested positive. Extracellular matrix Matrigel, and various Matrigel alternatives, have been used to coat the plates for the expansion of hPSCs. In this manuscript, although we still use the term Matrigel to indicate the extracellular matrix, actually a Matrigel alternative, Cultrex (R&D Systems), is used in our lab, rather than the traditional Matrigel (BD Biosciences). No differences between the two extracellular matrixes are observed in supporting hPSC expansion. The hPSCs are passaged using a gentle dissociation method using Versene Solution (or 0.5mM EDTA solution) to get small clumps for replating. If hPSCs are thawed for experimental use, it is highly recommended to let hPSCs recover for 2–3 passages before proceeding for differentiation. We recommend using hPSC lines with no more than 75 passages.

Differentiation of hPSCs to iNPCs

The induction of NPCs from hPSCs has been optimized based on the previous studies^7,30. The modified iNPC differentiation described has been demonstrated to be reproducible in two hESC cell lines: H1 and H9²⁸. Each stage medium is tailored to capture each developmental stage that sequentially gives rise to iNPCs. The Stage I medium initiates hPSC differentiation to the late primitive streak stage. The Stage II medium then specifies the posterior intermediate mesoderm from primitive streak. Finally, the Stage III medium is to enrich the NPC populations in the presence of a high concentration of FGF9. On the last day of the differentiation, the differentiating cells are dissociated to single cells for FACS to purify/enrich iNPCs. We use a dual reporter of SIX2-GFP/PAX2-mCherry to collect the iNPC population with high expression of GFP and mCherry as well as other lines with SIX2-GFP so sorting can be done using the specific marker of SIX2. For hPSC lines that do not have the NPC-specific reporter system, differentiated cells containing iNPCs can be cultured without FACS in the hNPSR-v2 medium. Continuous culture in hNPSR-v2 will enrich the iNPC population over 2–3 passages, reaching ~90% SIX2 positivity by immunostaining. Alternatively, if there are large populations of off-target cell types following hPSC-iNPC differentiation, can sort for ITGA8 via FACS to further purify.

Expansion of iNPCs with hNPSR-v2 and cryopreservation of iNPCs

Once the hPSC-derived iNPCs have been purified via FACS, they are immediately cultured in hNPSR-v2. Within 2–3 days, these iNPCs form clusters in culture as observed for the culture of primary human NPCs. Transcriptomes of the iNPCs cultured in hNPSR-v2 are similar to primary NPCs²⁸. hNPSR-v2 is refreshed every 1–2 days. Once the iNPCs reach a confluency of 80–90%, they are dissociated into single cells with Accumax and passaged at a 1:10 split ratio on Matrigel (Cultrex)-coated plates. Efficient freeze-and-thaw can be achieved for cultured iNPCs with commercially available freezing medium Bambanker. iNPC lines can also be derived without prior FACS purification, which rely on hNPSR-v2 to enrich the iNPC population over serial passages. These iNPC lines share similar properties with the FACS-purified iNPC lines described above and can also be passaged and cryopreserved.

Generation of Nephron organoids from iNPCs

The expandable iNPCs can be used for nephron organoid formation. Once the iNPCs have reached a confluency of 80%-90%, they are dissociated into single cells and reaggregated at 30,000 cells per aggregate to form iNPC aggregates overnight in 96-well U-bottom low-attachment plates. iNPC aggregates are then gently transferred to a 6-well Transwell plate for air-liquid-interface culture. The aggregates are treated with 6 μM CHIR99021 for 1 hour (Phase I medium) which mimics the natural epithelization signal in vivo. For the first five days, the aggregates are cultured in Phase II medium containing FGF9. Starting from day 5, the resulting organoids will undergo clear morphological changes that likely reflect the initial nephrogenesis stages transitioning through renal vesicle (RV), coma-shaped body (CSB), and S-shaped body (SSB). On day 5, culture medium is switched to Phase III medium which supports the maturation of nephron cell types until day 21. At the day of harvest the organoids can be prepared for various assays such as whole-mount staining, RNA and protein extraction for multi-omics analysis and/or assays to determine physiological functions. We usually use iNPC lines that are cultured no more than 2 months but iNPC lines cultured for 100 days can still differentiate into nephron organoids²⁸.

Materials

Biological Materials

• Human embryonic stem cells (H1, RRID #CVCL_9771, and H9, RRID #CVCL_UM37, cell lines). Details for generating their derivative SIX2-GFP;PAX2-mCherry dual reporter hPSC line are described in our prior publication²⁸. This cell line is available upon a completed Materials Transfer Agreement.

! CAUTION Institutional and federal regulations must be followed when using hPSC lines. The experiments using hPSC lines in this study were approved by the University of Southern California Stem Cell Research Oversight Committees guidelines and regulations (SCRO protocol # 2018–2).

! CAUTION The cell lines used in your research should be regularly checked to ensure they are authentic and that no cell line misidentification or cross-contamination has occurred. Check all cell cultures for mycoplasma regularly using PCR testing or other commercial kit-based testing.

Reagents

• NPC-specific primary antibodies (see also Table 5)

  • Rabbit Polyclonal anti-SIX2 (Proteintech, Cat# 11562–1-AP, RRID: AB_2189084)
  • Mouse Monoclonal anti-SALL1 (R&D systems, Cat# PP-K9814–00, RRID: AB_2183228)
  • Rabbit Monoclonal anti-WT1 (ABCAM, Cat# ab89901, RRID: AB_2043201)
  • Rabbit Polyclonal anti-PAX2 (BioLegend, Cat# 901001, RRID: AB_2565001)
  • Goat Polyclonal anti-ITGA8 (R&D Systems, Cat# AF4076, RRID: AB_2296280)
  • Donkey Polyclonal Secondary, Alexa Fluor^™ 647 (Thermo Fisher Scientific, Cat# A-21447, RRID: AB_2535864)
• Nephron-specific primary antibodies (see also Table 6)

  • Mouse Monoclonal anti-PODXL (human) (R&D Systems, Cat# MAB1658, RRID: AB_2165984)
  • Sheep polyclonal anti-Nephrin (R&D Systems, Cat# AF4269 RRID: AB_2154851)
  • Rabbit polyclonal anti-NPHS2 (Abcam, Cat #ab 50339, RRID: AB_882097)
  • Mouse Monoclonal anti-MAFB (R&D Systems, Cat# MAB3810, RRID: AB_2137675)
  • Biotinylated Lotus Tetragonolobus Lectin (LTL) (Vector laboratories, Cat# B-1325, RRID: AB_2336558)
  • Mouse Monoclonal anti-LRP2 (MyBioSource, Cat# MBS690201, RRID: AB_3677304)
  • Mouse Monoclonal anti-HNF4 alpha (R&D Systems, Cat# MAB4605, RRID: AB_3076456)
  • Rabbit Monoclonal anti-AQP1 (human) (Abcam, Cat# ab168387, RRID: AB_2810992)
  • Goat Polyclonal anti-SLC12A1 (Abcam, Cat# ab240542, RRID: AB_2910116)
  • Goat polyclonal anti-JAG1 (R&D Systems, Cat# AF599, RRID: AB_2128257)

• Accumax Cell Dissociation Solution (Innovative Cell Technologies, cat. no. AM105)

• Activin A (R&D Systems, cat. no. 338-AC-010)

• Advanced RPMI 1640 Medium (Thermo Fisher Scientific, cat. no. 12633–012)

• A83–01 (Cayman Chemical, cat. no. 9001799)

• Bambanker Cell Freezing Medium (Bulldog Bio, cat. no. BB01)

• BMP-7 (R&D Systems, cat. no. 354-BP-010)

• Bovine Serum Albumin, powder, BioXtra (Sigma-Aldrich, cat. no. A3311–100G)

• B-27 Supplement (50 X), minus vitamin A (Thermo Fisher Scientific, cat. no. 12587010)

• CHIR99021 (Selleck Chemicals, cat. no. S1263)

• Cultrex RGF Basement Membrane Extract (R&D Systems, cat. no. 3433-010-01)

• DAPI (Thermo Fisher Scientific, cat. no. D1306)

• DAPT (Cayman Chemical, cat. no. 13197)

• DMEM/F12, with HEPES (Gibco, cat. no. 11330–032)

• DMEM, high glucose, pyruvate (Thermo Fisher Scientific, cat. no. 11995065)

• DMSO (Corning, cat. no. 25–950-CQC)

• Fetal Bovine Serum (FBS) (Thermo Fisher Scientific, cat. no. 26140079)

• FGF-2 (Peprotech, cat. no. 100–18B)

• FGF9 (R&D Systems, cat. no. 273-F9–025)

• Fluoromount-G^® Mounting Medium, Liquid (SouthernBiotech, cat. no. 0100–01)

• GlutaMAX-I (100 X) (Invitrogen, cat. no. 35050–079)

• Heparin (Sigma, cat. no. H3149–100KU)

• Human insulin (Sigma, cat. no. 91077C-100MG)

• Human LIF (Millipore, cat. no. LIF1050)

• LDN193189 (Selleck Chemicals, cat. no. S2618)

• MEM NEAA (100 X) (Invitrogen, cat. no. 11140–050)

• mTeSR^™ Plus Kit (STEMCELL Technologies, cat. no. 100–0276)

• Pen Strep (100 X) (Invitrogen, cat. no. 15140–122)

• Paraformaldehyde 4% Aqueous solution (EMS cat. no. 157–4)

• Phosphate-Buffered Saline (PBS), 1X without Calcium and Magnesium (VWR, cat. no. 45000–446)

• Quick-RNA Microprep (Zymo, cat. no. R1051)

• RT-qPCR Primers/Oligos (Integrated DNA Technologies, see also Table 7)

• SB202190 (Axon Medchem, cat. no. 1364)

• Sodium selenite (Sigma, cat. no. S5261–10G)

• STEMdiff^™ APEL^™2 Medium (STEMCELL Technologies, cat. no. 05270)

• Transferrin, Apo-, Human Plasma (Sigma, cat. no. 616395–100MG)

• Triton^™ X-100 (Sigma-Aldrich, cat. no. X100–500ML)

• TRULI/LATS-IN-1 (Cayman Chemical, cat. no. 36623)

• UltraPure^™ 0.5M EDTA, pH 8.0 (Thermo Fisher Scientific, cat. no. 15575020)

• Versene Solution (Thermo Fisher Scientific, cat. no. 15040–066)

• Y-27632 (Selleck Chemicals, cat. no. S1049)

• 2-Mercaptoethanol (55 mM) (Invitrogen, cat. no. 21985–023)

• 4% Paraformaldehyde (PFA), EM Grade (Electron Microscopy Sciences, cat. no. 157–4)

Table 5.

Validated primary antibodies for NPC marker genes

Antibody	Supplier	Catalog number	RRIDs	Dilution ratio
Rabbit Polyclonal anti-SIX2	Proteintech	Cat# 11562–1-AP	AB_2189084	1: 500
Mouse Monoclonal anti-SALL1	R&D Systems	Cat# PP-K9814–00	AB_2183228	1: 500
Rabbit Monoclonal anti-WT1	Abcam	Cat# ab89901	AB_2043201	1: 500
Rabbit Polyclonal anti-PAX2	BioLegend	Cat# 901001	AB_2565001	1: 500
Goat Polyclonal anti-ITGA8	R&D Systems	Cat# AF4076	AB_2296280	1: 200

Table 6.

Validated primary antibodies for identifying various major nephron segments

Antibody	Supplier	Catalog number	RRIDs	Dilution ratio	Identified nephron segment
Mouse Monoclonal anti-PODXL (human)	R&D Systems	Cat# MAB1658	AB_2165984	1: 400	Podocyte
Sheep polyclonal anti-Nephrin	R&D Systems	Cat# AF4269	AB_2154851	1: 400
Rabbit polyclonal anti-NPHS2	Abcam	Cat# ab50339	AB_882097	1: 400
Mouse Monoclonal anti-MAFB	R&D Systems	Cat# MAB3810	AB_2137675	1: 400
Biotinylated Lotus Tetragonolobus Lectin (LTL)	Vector laboratories	Cat# B-1325	AB_2336558	1: 100	Proximal tubule
Mouse Monoclonal anti-LRP2	MyBioSource	Cat# MBS690201	AB_3677304	1: 200
Mouse Monoclonal anti-HNF-4 alpha	R&D Systems	Cat# MAB4605	AB_3076456	1: 200
Rabbit Monoclonal anti-AQP1 (human)	Abcam	Cat# ab168387	AB_2810992	1: 400	Loop of Henle
Goat Polyclonal anti-SLC12A1	Abcam	Cat# ab240542	AB_2910116	1: 400
Rabbit polyclonal anti-POU3F3	Thermo Fisher Scientific	Cat# PA5–64311	AB_2645790	1: 400	Distal nephron
Rabbit Monoclonal anti-CDH1	Cell Signaling Technology	Cat# 3195	AB_2291471	1: 400
Mouse Monoclonal anti-CDH1	BD Biosciences	Cat# 610182	AB_397581	1: 400
Goat polyclonal anti-JAG1	R&D Systems	Cat# AF599	AB_2128257	1:200	SSB (intermediate segment)

Table 7.

Validated RT-qPCR primer sequences for late podocyte marker genes

Targeted gene	Forward primer	Reverse primer
COL4A3	AGCAAGGGTTGTGTCTGTAAA	CAGAAAATCCTGGCAATCCACT
COL4A4	AGGCTCAACTGGTCTAAGAGG	GCAGGGTCACCTTTGTTTCC
COL4A5	AACCATCGGTGATATGGGTTTTC	TCCCACAGAACCTTTGATACCA
PLA2R1	GCATACAATCAAAGGGAACACCC	TCGTGGCACACCACAGTAAG

The supplier for all the oligos is Integrated DNA Technologies.

! CAUTION Formaldehyde/paraformaldehyde are moderately acutely toxic by all routes of exposure, but the more concerning health hazards in a workplace setting are the chronic health hazards arising from them being a carcinogen, mutagen, and potent sensitizer. 4% PFA must be handled in a fume hood.

Equipment

• BD FACSAria^™ III Cell Sorter (BD Biosciences)

• Beckman Coulter Allegra X-12R Refrigerated Benchtop Centrifuge (Beckman Coulter, cat. no. 392302)

• Beckman Coulter Microfuge 16 Centrifuge (Beckman Coulter, cat. no. A46474)

• Biological safety cabinet (Thermo Fisher Scientific, cat. no. 13-261-304)

• Cell Counting Slides for TC10^™/TC20^™ Cell Counter (Bio-Rad, cat. no. 1450016)

• CO2 incubator (Thermo Fisher Scientific, Heracell^™ VIOS 160i, cat. no. 51033557)

• Falcon^® Round-Bottom Tubes, Polystyrene (Corning, cat. no. 352057)

• Mini Microcentrifuges (Corning, cat. no. CLS6770)

• Nalgene^® SYSTEM 100^™ Cryogenic Vials, 1.5 mL (Thermo Fisher Scientific, cat. no. 5000–1020)

• Needles (BD PrecisionGlide^™ Needle, cat. no. 305106)

• Nunclon Sphera 96U-Well Round Bottom Plate (Thermo Fisher Scientific, cat. no. 174929)

• Olympus CKX53 Microscope (Olympus Microscope, cat. no. CKX53 Inverted)

• Pipettes (P2.5, P20, P200, P1000) (Eppendorf, cat. no. 3123000012, 3123000098, 3123000055, 3123000063)

• Pipette tips (P10, P200, P1000) (USA Scientific, cat. no. 1121–3810, 1120–8810, 11267810)

• Serological pipette controller (Drummond, cat. no. 4-000-101)

• TC20^™ Automated Cell Counter (Bio-Rad, cat. no. 1450102)

• 10 mL Polystyrene Serological Pipets (Greiner Bio-One, cat. no. 607180)

• 12-Well Cell Culture Plates (Genesee Scientific, cat. no. 25–106)

• 15 mL conical tubes (Bioland Scientific, cat. no. TUBE0150–02)

• 1.7 mL microcentrifuge tubes (VWR, cat. no. 53550–937)

• 5 mL centrifuge tubes (Bioland Scientific, cat. no. TUBE05–03CS)

• 5 mL Polystyrene Serological Pipets (Greiner Bio-One, cat. no. 606180)

• 6-Well, Flat Bottom Tissue Culture Plate (Genesee Scientific, cat. no. 25–105)

• 24 mm Transwell^® with 0.4 μm Pore Polyester Membrane Insert (Corning, cat. no. 3450)

• 50 mL centrifuge tubes (VWR, cat. no. 89039–658)

Reagent setup

Activin A (50 μg/mL stock)

Resuspend lyophilized Activin A (10 μg) in 200 μL 4 mM hydrochloride (HCl) supplemented with 0.1% FBS (vol/vol) to make a stock solution of 50 μg/mL. Dispense as 10 μL aliquots into microcentrifuge tubes and store at −80 °C for up to 12 months.

A83–01 (10 mM stock)

Add 1.186mL of DMSO to 5 mg A83–01 powder to make a 10 mM stock solution. Dispense as 20 μL aliquots of A83–01 stock into microcentrifuge tubes and store at −80 °C for up to 12 months.

BMP7 (100 μg/mL stock)

Resuspend lyophilized BMP7 (500 μg) in 5 mL of 4 mM HCl supplemented with 0.1% FBS (vol/vol) to make a stock solution of 100 μg/mL. Dispense as 20 μL aliquots into microcentrifuge tubes and store at −80 °C for up to 12 months.

CHIR99021 (50 mM stock)

Add 1.075mL of DMSO to 25mg CHIR99021 powder to make a 50 mM stock solution (1^st stock). Make 50μL aliquots in microcentrifuge tubes and store at −80 °C for up to 12 months. 50 μL 50 mM stock solution is added to 200 μL of DMSO to make a 10 mM stock solution (2^nd stock). Dispense as 15 μL aliquots of 2^nd CHIR99021 stock into microcentrifuge tubes and store at −20 °C for up to 6 months.

DAPT (10 mM stock)

Add 2.312mL of DMSO to 10 mg DAPT powder to make a 10 mM stock solution. Dispense as 50 μL aliquots of DAPT stock into microcentrifuge tubes and store at −80 °C for up to 12 months.

FGF2 (100 μg/mL stock)

Resuspend lyophilized FGF2 (1mg) in 10 mL of 5 mM Tris supplemented with 0.1% FBS (vol/vol) to make a stock solution of 100 μg/mL. Dispense as 50 μL aliquots into microcentrifuge tubes and store at −80 °C for up to 12 months.

FGF9 (100 μg/mL stock)

Resuspend lyophilized FGF9 (25 μg) in 250 μL sterile PBS supplemented with 0.1% FBS (vol/vol) to make a stock solution of 100 μg/mL. Dispense as 15 μL aliquots into microcentrifuge tubes and store at −80 °C for up to 12 months.

Heparin (1 mg/mL stock)

Reconstitute heparin powder with ultrapure water and filter sterilize using a PES 0.22 μm syringe-driven filter unit. Aliquot 1mL into microcentrifuge tubes and store at −80 °C for up to 2 years.

Human insulin (10 mg/mL stock)

Resuspend lyophilized human insulin (100 mg) in 10 mL of 5 mM HCl to make a stock solution of 10 mg/mL, then put it at 4°C for overnight. On second day, put it in water bath to completely dissolve it, then prepare 250 μL aliquots and store at −80 °C for up to 12 months.

LDN193189 (200 μM stock)

Add 2.46 mL of DMSO to 5mg LDN193189 powder to make a 5 mM stock solution (1^st stock). Make 100 μL aliquots in microcentrifuge tubes and store at −80 °C for up to 12 months. 100 μL 5 mM stock solution is added to 2.4mL of DMSO to make a 200 μM stock solution (2^nd stock). Dispense as 100 μL aliquots of 2^nd LDN193189 stock into microcentrifuge tubes and store at −20 °C for up to 6 months.

SB202190 (50 mM stock)

Add 604 μL of DMSO to 10 mg SB202190 powder to make a 50 mM stock solution. Dispense as 10 μL aliquots of SB202190 stock into microcentrifuge tubes and store at −80 °C for up to 12 months.

Sodium selenite (50 μg/mL)

Add 10 mL of ultrapure water to 500 mg sodium selenite powder to make a 50 mg/mL stock solution (1^st stock). Make 100 μL aliquots in microcentrifuge tubes and store at −80 °C for up to 2–3 years. 10 μL 50 mg/mL stock solution is added to 10 mL of ultrapure water to make a 50 μg/mL stock solution (2^nd stock). Dispense as 250 μL aliquots of 2^nd sodium selenite stock into microcentrifuge tubes and store at −80 °C for up to 12 months.

Transferrin, Apo-, Human Plasma (5.5 mg/mL stock)

Resuspend the whole bottle of lyophilized transferrin (100 mg) in 1ml of ultrapure water before transferring to a 50 mL falcon tube with another 17.182 mL ultrapure water (in total 18.182 mL water) to make a 5.5mg/mL stock solution. Prepare 250 μL aliquots of transferrin stock and store at −80 °C for up to 12 months.

TRULI/LATS-IN-1 (10 mM stock)

Add 2.99 mL of DMSO to 10 mg TRULI powder to make a 10 mM stock solution. Prepare 15 μL aliquots of TRULI stock into microcentrifuge tubes and store at −80 °C for up to 12 months.

Y27632 (ROCKi; 10 mM stock)

Add 3.123 mL of ultrapure water to 10 mg Y27632 powder to make a 10 mM stock. Prepare 100 μL aliquots into microcentrifuge tubes and store at −80 °C for up to 12 months.

0.5 mM EDTA Dissociation Solution

Using a brand new unopened 500 mL Phosphate-Buffered Saline (PBS), 1X without Calcium and Magnesium bottle, add 500 μL of UltraPure^™ 0.5M EDTA to make the 0.5mM EDTA dissociation solution for hPSC passaging. The bottle can be stored at room temperature (20–22 °C) for up to 12 months.

hNPSR-v2 medium

Once the individual component stocks are properly prepared according to the protocols outlined above, thaw the aliquoted component stocks and use them to prepare 100 mL complete hNPSR-v2 medium referring to Table 1. All individual aliquoted component stocks can be directly used for the preparation of 100 mL complete hNPSR-v2 medium, except for the A83–01. 1 μL 10 mM A83–01 stock (1^st stock) is added into 199 μL DMEM/F12 medium to make a 50 μM A83–01 stock solution (2^nd stock). The thawed stock medium components have different shelf-lives. For growth factors, it is best to store them in 4°C and use them within 2 weeks. For small molecules, including the 2^nd stock of A83–01, they are good for up to one month at 4°C. The complete hNPSR-v2 medium can be stored at 4°C for 2 weeks.

Table 1|.

Preparation of 100mL complete hNPSR-v2 medium

Component	Cat no. (supplier)	Stock conc.	Final conc.	Added volume
DMEM/F12	11330–032 (Invitrogen)			93.05 mL
GlutaMAX-I (100 X)	35050–079 (Invitrogen)	100 X	1 X	1 mL
MEM NEAA (100 X)	11140–050 (Invitrogen)	100 X	1 X	1 mL
Pen Strep (100 X)	15140–122 (Invitrogen)	100 X	1 X	1 mL
2-Mercaptoethanol (55 mM)	21985–023 (Invitrogen)	500 X	0.11 mM	200 μL
B-27 Supplement (50 X), minus vitamin A	12587010 (Thermo Fisher Scientific)	50 X	1 X	2 mL
Human insulin	91077C-100MG (Sigma)	10 mg/mL	10 μg/mL	100 μL
Transferrin, Apo-, Human Plasma	616395–100MG (Sigma)	5.5 mg/mL	5.5 μg/mL	100 μL
Sodium selenite	S5261–10G (Sigma)	50 μg/mL	5 ng/mL	10 μL
FGF-2	100–18B (Peprotech)	100 μg/mL	200 ng/mL	200 μL
Heparin	H3149–100KU (Sigma)	1 mg/mL	1μg/mL	100 μL
Y-27632	S1049 (Selleck Chemicals)	10 mM	10μM	100 μL
LDN193189	S2618 (Selleck Chemicals)	200 μM	200nM	100 μL
A83–01	9001799 (Cayman Chemical)	50μM (2nd stock)	50nM	100 μL
BMP-7	354-BP-010 (R&D Systems)	100 μg/mL	50 ng/mL	50 μL
DAPT	13197 (Cayman Chemical)	10 mM	5μM	50 μL
Human LIF	LIF1050 (Millipore)	100 μg/mL	10 ng/mL	10 μL
SB202190	1364 (Axon Medchem)	50 mM	5μM	10 μL
CHIR99021	S1263 (Selleck Chemicals)	10 mM	1.5μM	15 μL
TRULI	36623 (Cayman Chemical)	10 mM	1.5μM	15 μL

10% FBS medium:

10% FBS (vol/vol) medium is used for neutralizing Accumax dissociation reaction during iNPC passaging. An example of the preparation of 500 mL complete 10% FBS medium is shown in Table 2. The complete 10% FBS medium can be stored at 4°C for 2 months.

Table 2|.

Preparation of 500 mL complete 10% FBS medium

Component	Cat no. (supplier)	Stock conc.	Final conc.	Added volume
DMEM, high glucose, pyruvate	11995065 (Thermo Fisher Scientific)			434 mL
GlutaMAX-I (100 X)	35050–079 (Invitrogen)	100 X	1 X	5 mL
MEM NEAA (100 X)	11140–050 (Invitrogen)	100 X	1 X	5 mL
Pen Strep (100 X)	15140–122 (Invitrogen)	100 X	1 X	5 mL
2-Mercaptoethanol (55 mM)	21985–023 (Invitrogen)	500 X	0.11 mM	1 mL
FBS (Fetal Bovine Serum)	26140079 (Thermo Fisher Scientific,)	100%	10%	50mL

FACS medium:

PBS supplemented with 2% FBS (vol/vol). For example, to prepare 100 mL FACS medium, add 2 mL FBS into 98 mL PBS and mix well.

Matrigel stock

Thaw the whole bottle of 5 mL Cultrex RGF Basement Membrane Extract (R&D Systems, cat. no. 3433010–01) on ice overnight. On the second day, when the Matrigel is completely thawed, aliquot the Matrigel stock on ice in the cell culture hood, dispense 58.3 μL (1mg) aliquots of Matrigel stock into 1.7 mL microcentrifuge tubes and store at −80 °C for up to 12 months.

Matrigel-coated 12-well plate for the derivation of iNPC lines and iNPC culture

Use a serological pipette controller to transfer 25 mL of cold DMEM/F12 into a 50 mL centrifuge tube, then take 1 mL of cold DMEM/F12 to directly dissolve one aliquoted Matrigel stock (1 mg). Dissolve the Matrigel by pipetting up and down several times until completely dissolved. Transfer the 1 mL dissolved Matrigel into the remaining 24 mL of cold DMEM/F12, mix the 50 mL centrifuge tube well by inverting several times, then transfer 1 mL of the cold Matrigel solution into one well of a 12-well plate. Place the plate into the incubator for a minimum of 1 hour before use. The coated plate can be stored in the incubator for up to 10 days.

PBST buffer

Add 1.5 mL Triton^™ X-100 (Sigma-Aldrich) into 500 mL PBS solution and then mix well through upside down for several times until Triton^™ X-100 is completely dissolved. This makes PBST buffer with 0.03% final concentration of Triton^™ X-100. PBST can be stored at room temperature for up to 6 months.

Preparation of medium for hPSC-to-iNPC differentiation

Once the individual component stocks are properly prepared according to the protocols outlined above, thaw the aliquoted component stocks and use them to prepare Phase I, II, and III medium for hPSC-to-iNPC differentiation referring to Table 3. The prepared medium can be stored in 4°C for two weeks.

Table 3|.

Preparation of 10mL Phase I, II, III medium for hPSC-to-iNPC differentiation

Component	Catalog number (supplier)	Stock conc.	Final conc.	Added volume
Phase I medium
Advanced RPMI 1640 Medium	12633–012 (Thermo Fisher Scientific)			9.791mL
GlutaMAX-I (100 X)	35050–079 (Invitrogen)	100 X	1 X	100 μL
Pen Strep (100 X)	15140–122 (Invitrogen)	100 X	1 X	100 μL
CHIR99021	S1263 (Selleck Chemicals)	10 mM	8 μM	8 μL
LDN193189	S2618 (Selleck Chemicals)	10 μM (2nd stock)	10nM	1 μL
Phase II medium
Advanced RPMI 1640 Medium	12633–012 (Thermo Fisher Scientific)			9.788mL
GlutaMAX-I (100 X)	35050–079 (Invitrogen)	100 X	1 X	100 μL
Pen Strep (100 X)	15140–122 (Invitrogen)	100 X	1 X	100 μL
Y-27632	S1049 (Selleck Chemicals)	10 mM	10uM	10 μL
Activin A	338-AC-010 (R&D Systems)	50ug/mL	10ng/mL	2 μL
Phase III medium
Advanced RPMI 1640 Medium	12633–012 (Thermo Fisher Scientific)			9.795mL
GlutaMAX-I (100 X)	35050–079 (Invitrogen)	100 X	1 X	100 μL
Pen Strep (100 X)	15140–122 (Invitrogen)	100 X	1 X	100 μL
FGF9	273-F9–025 (R&D Systems)	100ug/mL	50ng/mL	5 μL

Note: 1uL 200μM LDN193189 stock (1^st stock) is added into 19 uL DMSO medium to make a 10μM LDN193189 stock solution (2^nd stock). The complete Phase I, II, III medium can be stored at 4°C for 2 weeks.

Preparation of medium for iNPC differentiation into nephron organoid

Once the individual component stocks are properly prepared according to the protocols outlined above, thaw the aliquoted component stocks and use them to prepare Phase I, II, and III medium for iNPC differentiation into nephron organoid referring to Table 4. The prepared medium can be stored in 4°C for two weeks.

Table 4|.

Preparation of 10 mL Phase I, II, III medium for generation of iNPC-derived nephron organoids

Component	Catalog number (supplier)	Stock conc.	Final conc.	Added volume
Phase I medium
STEMdiff™ APEL2™ medium	05270 (STEMCELL Technologies)			9.894mL
Pen Strep (100 X)	15140–122 (Invitrogen)	100 X	1 X	100 μL
CHIR99021	S1263 (Selleck Chemicals)	10 mM	6 μM	6 μL
Phase II medium
STEMdiff™ APEL2™ medium	05270 (STEMCELL Technologies)			9.885mL
Pen Strep (100 X)	15140–122 (Invitrogen)	100 X	1 X	100 μL
FGF9	273-F9–025 (R&D Systems)	10μg/mL	50ng/mL	5 μL
Heparin	H3149–100KU (Sigma)	1 mg/mL	1μg/mL	10 μL
Phase III medium
Advanced RPMI 1640	12633–012 (Thermo Fisher Scientific)			9.5mL
GlutaMAX-I (100 X)	35050–079 (Invitrogen)	100 X	1 X	100 μL
Pen Strep (100 X)	15140–122 (Invitrogen)	100 X	1 X	100 μL
B-27 Supplement (50 X), minus vitamin A	12587010 (Thermo Fisher Scientific)	50 X	1 X	200 μL
A83–01	9001799 (Cayman Chemical)	200μM (2nd stock)	200nM	10 μL

Note: 1uL 10mM A83–01 stock (1^st stock) is added into 49uL DMSO to make a 200uM A83–01 stock solution (2^nd stock). The complete Phase I, II, III medium can be stored at 4°C for 2 weeks.

Preparation of blocking buffer for immunostaining

Prepare PBST solution as detailed above. Supplement PBST with 2% bovine serum albumin (w./vol.) – i.e. 2 grams of bovine serum albumin in 100 mL of PBST. Mix well.

Procedure

hPSC passaging and expansion in preparation for hPSC-to-iNPC differentiation ● TIMING 9d

CRITICAL hPSCs are ready for passaging when they have reached a confluency of 75–90%. If starting from thawed hPSCs, the cells should be passaged at least twice to recover from the freeze-thaw process. This will ensure high differentiation efficiency.

• 1Day 0: Incubate a Matrigel-coated 12-well plate (1 mL per well) at 37°C for a least 1 hour before use.
• 2Confirm hPSCs have reached a confluency of 75–90%.

◆ TROUBLESHOOTING

! CAUTION When working with multiple cell lines at the same time it’s very important to ensure not to misidentify the different cell lines and avoid the possibility of cross-contaminating.

• 3Aspirate the mTeSR Plus culture medium, wash the cells with 1 mL room temperature PBS. After aspirating the PBS, add 500 μL pre-warmed Versene solution (or room temperature 0.5mM EDTA) and incubate at 37°C incubator for 5 to 6 minutes.
• 4After the incubation time is up, carefully observe the cell morphology under the microscope. Expect to see the light penetrating through the condense regions of the cells.
• 5Once majority of the well is bright, carefully aspirate the dissociation medium.
• 6Using a P1000 pipette, use 1 mL of mTeSR Plus medium to gently detach the cells and break up hPSC colonies to small clusters. Then transfer the cells to a 1.7 mL Eppendorf tube.

! CAUTION Gently pipette no more than 5 times as the mechanical stress can induce spontaneous differentiation. It is normal to have clusters of cells with different sizes, which will not affect hPSC expansion.

• 7In a new 1.7 mL Eppendorf tube prepare 1 mL of mTeSR Plus for one well of a 12-well plate. Seed the cells at a 1:12 ratio to the newly prepared mTeSR.
• 8Aspirate the Matrigel-coating medium from the well and add your passaged cells in mTeSR Plus to the well. Return to the incubator.

▲ CRITICAL STEP Once the cells have been plated, gently jolt the plate up-and-down, and left-and-right to equally distribute the cells in each well.

• 9Day 2–5: Starting on Day 2 (Day 0 is the day of cell seeding in Step 8), change medium every other day with fresh mTeSR Plus medium (no medium change is needed on Day 1). Healthy hPSCs will reach a confluency of 80–90% 4–5 days after passage. This suggests their cell proliferation rates are following the normal logarithmic growth. Also, this indicates that the cells are ready to proceed for NPC differentiation.
• 10Pretreat hPSCs with 1mL mTeSR Plus medium supplemented with 10 μM Y27632 for 1 hour. Then aspirate the medium and wash the cells with 1 mL PBS.

▲ CRITICAL STEP This pretreatment step can inhibit cell death of hPSCs in single cell passaging.

• 11Aspirate 1mL PBS and add 0.5mL Accumax solution (pre-warmed to 37 °C) and put the plate in incubator for 12–18 minutes. Every 3 to 4 minutes, take the plate out of the incubator and tap gently to facilitate hPSC dissociation. The dissociation is considered complete when the majority of the hPSCs are detached from the plate with most of the floating hPSCs as either single cells or small clusters with <5 cells.

▲ CRITICAL STEP Complete dissociation of hPSC into single cells is very important for accurate hPSCs seeding, which will have significant effects in the efficiency of hPSC-to-iNPC differentiation.

• 12After Accumax dissociation, add 0.5mL mTeSR Plus medium supplemented with 10 μM Y27632 to neutralize the digestion reaction. Now, the total volume of cell solution is around 1mL.
• 13Pipette up and down gently 10 times to break down the cell clusters into a single cell solution.
• 14Transfer the cell solution into one 1.7 mL tube and centrifuge at 300g for 5 mins.
• 15Aspirate the supernatant and use 1 mL mTeSR Plus medium supplemented with 10 μM Y27632 to resuspend the cell pellet by pipetting gently up and down 5–6 times.
• 16Count the cells with TC20 Automated Cell Counter.
• 17Seed 40,000 hPSCs in one Matrigel-coated well of a 12-well plate with 1mL mTeSR Plus medium supplemented with 10 μM Y-27632.

▲ CRITICAL STEP Accurate initial hPSCs seeding number is very critical for differentiation.

▲ CRITICAL STEP It’s important to add 10 μM Y-27632 to increase the survival of the hPSC during seeding.

• 1824 hours after hPSC seeding, change medium with 1mL fresh mTeSR Plus medium without Y27632.
• 19Usually 2–3 days after hPSC seeding (designated as hPSC-to-iNPC differentiation D0 in Fig. 2a), the hPSC colonies are big enough in size to initiate iNPC differentiation.

Fig. 2 |. Directed differentiation from hPSCs to iNPCs.

a, Representative time-course bright-field images of hPSCs undergoing hPSC-to-iNPC differentiation. b, Representative bright-field (left panel) and GFP fluorescent images (middle panel) of differentiated hPSCs on day 10 of hPSC-to-iNPC differentiation from SIX2-GFP/PAX2-mCherry hPSC line. Scale bars, 100 μm. Boxed area in the left panel is enlarged and shown in the right panel to highlight the signature cluster morphology of hPSC-derived iNPCs. Note the strong SIX2-GFP expression from these clusters. c, Representative flow cytometry gating plot showing the isolation of SIX2-GFP⁺/PAX2-mCherry⁺ iNPCs from the differentiated cells shown in (b). d, Bright-field, GFP, and mCherry fluorescent images of an iNPC aggregate from FACS-purified SIX2-GFP⁺/PAX2-mCherry⁺ iNPCs in (c). Scale bars, 100 μm.

▲ CRITICAL STEP The size of hPSC colony is critical for successful differentiation. If the hPSC colonies are too small CHIR99021 will cause drastic cell death leaving very few cells, and if the starting hPSC colonies are too big the cells will over grow and begin to peel off resulting in a failed differentiation.

hPSC-to-iNPC differentiation and enrichment of iNPCs ● TIMING 10d

• 20Day 0: Before initiating the differentiation, first aspirate the culture medium and wash with 1mL of PBS, before adding 1mL of the Phase I medium (Table 3).

▲ CRITICAL STEP The washing step with PBS is critical because mTeSR Plus medium contains growth factors (TGF-β1 and FGF2) that could potentially have some lingering side-effects during differentiations.

• 21Day 2 and 3: Replace with 1.2 mL fresh Phase 1 medium.

▲ CRITICAL STEP Do not change medium on Day 1 with Phase I medium. Excessive WNT signaling activation by CHIR99021 will induce dramatic cell death.

▲ CRITICAL STEP After Day 2, the medium will turn bright yellow overnight indicating the metabolic activity is high. It’s important to change medium on both Day 2 and 3. Otherwise, drastic cell death will lead to a failed differentiation.

• 22On Day 4, aspirate the Phase I medium and add 1.2 mL of Phase II medium in Table 3.
• 23Day 5 and 6: Renew the medium with 1.2 mL fresh Phase II medium.

! CAUTION If you note the cells are starting to peel off the plate its best to discontinue and restart the differentiation, because it will just get worse over time.

◆ TROUBLESHOOTING

• 24On Day 7, aspirate the Phase II medium and add 1.2 mL Phase III medium in Table 3.
• 25Day 8 and 9: Renew the medium with 1.2 mL fresh Phase III medium.
• 26Day 10: Observe cells under a microscope. iNPCs on Day 10 of differentiation should exhibit their signature cluster morphology in which they condense together and show bright SIX2-GFP (Fig. 2a and b). The differentiated cells are now ready for dissociation and FACS to purify the iNPCs.

◆ TROUBLESHOOTING

• 27Day 10: Aspirate the Phase III medium and gently wash the cells with 1 mL PBS.
• 28Remove PBS, add 0.5mL Accumax (pre-warmed to 37°C) into the well, and then put the plate in 37°C incubator for 12 minutes. 6 minutes after incubation, remove the plate from the incubator and tap the plate to help the cells detach and better dissociate.
• 29After Accumax dissociation, add 0.5mL 10% FBS medium to neutralize the dissociation reaction and pipette up and down gently 10 times to break down the cell clusters into single cells.
• 30Transfer the cell solution into a 1.7 mL tube and centrifuge at 300g for 5 mins.
• 31
  If using cells with an NPC-specific reporter such as the SIX2-GFP;PAX2-mCherry dual reporter, follow Option A. For iNPC line derivation from hPSC lines that have no NPC-specific reporters for FACS, follow Option B. Alternatively, if there are large populations of off-target cells following hPSC-to-iNPC differentiation, follow Option C to sort for cell surface marker ITGA8 via FACS.

  1. FACS with NPC-specific reporter

     1. Remove the supernatant. Use a P1000 pipette to add 1mL FACS medium containing 0.33 μl Hoechst 33342 at a ratio of 1:3000 (serving as a viability marker for FACS) and resuspend the cell pellet by pipetting up and down gently for 3–5 times.
     2. Filter the cell solution through a strainer cap of a Falcon^® Round-Bottom Tube.
     3. FACS iNPCs through BD FACSAria^™ III Cell Sorter. For the SIX2-GFP;PAX2-mCherry dual reporter hPSC line, GFP⁺;mCherry⁺ iNPCs are sorted as shown in Fig. 2c. See also Supplementary Fig. 1a for an example of full FACS gating plots.
  2. No NPC-specific reporter

     1. Remove the supernatant. Use a P1000 pipette to add 1mL hNPSR-v2 medium, and resuspend the cell pellet by pipetting up and down gently for 3–5 times.
     2. Count the cells with a TC20 Automated Cell Counter and seed 120,000 cells into one well of a 12-well plate coated with Matrigel and culture in hNPSR-v2 medium. hNPSR-v2 medium will further expand and enrich the iNPC population (~90% SIX2⁺) over 2–3 passages by repeating steps 34–41.
  3. FACS for ITGA8

     • i
       Remove the supernatant and resuspend the pellet with 200 μl FACS medium with 2 μl primary antibody against ITGA8 (1:100 dilution of the ITGA8 antibody).
     • ii
       Incubate the cells with ITGA8 antibody at 4°C for 1 hour.

▲ CRITICAL STEP It’s critical to incubate for 1 hour but not for a shorter time.

• iiiAfter incubation, centrifuge at 300g for 5 minutes to pellet the cells, then remove the supernatant, and resuspend the cell pellet with 500 μl FACS medium.
• ivCentrifuge at 300g for 5 minutes to pellet the cells and then resuspend the cell pellet in 300 μl FACS medium containing 0.3 μl secondary antibody (Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor^™ 647). Incubate the cells with the secondary antibody for 30 mins at 4°C protected from light.
• vAfter incubation, centrifuge at 300g for 5 minutes to pellet the cells, then remove the supernatant, and resuspend the cell pellet with 500 μl FACS medium.
• viCentrifuge at 300g for 5 minutes to pellet the cells and then resuspend the cell pellet with 300 μl FACS medium containing 0.1 μl Hoechst 33342.
• viiFACS iNPCs through BD FACSAria^™ III Cell Sorter. See also Supplementary Fig. 1b for an example of full FACS gating plots.

◆ TROUBLESHOOTING

iNPC expansion in hNPSR-v2 medium and passaging ●TIMING 4d

• 32Day 0: If continuing after FACS (Step 31 Options A or C) count cells with a TC20 Automated Cell Counter and seed around 120,000 cells per well to one Matrigel-coated well of a 12-well plate with 1 mL hNPSR-v2 medium. (Based on our experiences, FACS from one well of a 12-well plate can lead to the isolation of 200,000–300,000 SIX2⁺ iNPCs. Please scale up or down as needed.)
• 33Return cultures to the incubator. Typically, it takes four days for each sorted iNPC passage cycle at the split ratio of 1-to-10 (Fig. 3a). (Based on our experiences, a confluent well of a 12-well plate can produce 1–1.5 million iNPCs.)

Fig. 3 |. Expansion and characterization of iNPCs cultured in hNPSR-v2.

a, Bright-field images showing time-course iNPC expansion during one typical 4-day passage cycle. Scale bars, 100 μm. b and c, Immunofluorescence images (b) and quantification of percentage of double positive cells (SIX2⁺/YAP⁺; PAX2⁺/SALL1⁺; WT1⁺/ITGA8⁺). For immunostaining quantification, 3 different fields of view were randomly selected to count the number of positively stained cell numbers and total cell numbers (as determined by DAPI signals). At least 500 cells per field of view were included. Error bars represent standard derivation between different fields of view. (c) of cultured iNPCs for human NPC marker genes SIX2, PAX2, SALL1, WT1, ITGA8 and YAP. Scale bars, 50 μm. d. PCA plots of bulk RNA-seq data of SIX2- primary non-NPC, SIX2+ primary NPC, iNPC without culture, iNPC cultured with hNPSR-v1 and hNPSR-v2. The data shown in (d) was previously published in Huang et al., Cell Stem Cell, 2024²⁸.

◆ TROUBLESHOOTING

• 34Day 1: Observe iNPCs under the microscope to ensure cells are attached to the plate. It is common to find dead cells floating which is normal from FACS. No medium change is needed.
• 35Day 2: Change medium to 1 mL fresh hNPSR-v2 medium.
• 36Day 4: Observe iNPCs under the microscope to check confluence. iNPCs should have reached 80–90% confluence and will be ready for passaging or cryopreservation (D4 in Fig. 3a).

▲ CRITICAL STEP Some iNPC lines might grow faster. On Day 3, if the medium turns yellow. Change the medium with fresh hNPSR-v2 medium.

▲ CRITICAL STEP iNPC overgrowth (>100% confluency) leads to dramatic cell death and decreased iNPC quality.

• 37Aspirate the used hNPSR-v2 medium and wash the cells with 1 mL PBS.
• 38Remove PBS, add 0.5 mL Accumax, and incubate at 37°C for 8 minutes.
• 39
  After Accumax dissociation, add 0.5 mL 10% FBS medium to neutralize the dissociation reaction and gently pipette up and down 3–5 times to mix the cells. Continue to Step 40 to maintain iNPCs in culture. Alternatively:

  • To cryopreserve cells, proceed to Step 42.
  • To characterize iNPC line, proceed to Step 45.
  • To generate nephron organoids, proceed to Step 53.
• 40Transfer the 1 mL single cell suspension into a 1.7 mL Eppendorf tube and take 100 μL (1:10 ratio) to another 1.7mL tube, then centrifuge at 300g for 5 mins.
• 41
  Remove the supernatant from the tube with 100 μL cells and use 1 mL hNPSR-v2 medium to resuspend the iNPC pellet. Seed the cells into one Matrigel-coated well of a 12-well plate and repeat passaging steps (Steps 34–41) for long term culture.

  • Note that if no NPC-specific reporter was used and cells were not enriched by FACS (Step 31 Option B) passaging steps must be repeated 2–3 times to enrich the iNPC population.

iNPC cryopreservation ●TIMING 1d

• 42200,000–1,000,000 cells can be frozen in 0.5 mL Bambanker Cell Freezing Medium per cryovial (1.5mL Nalgene^® SYSTEM 100^™ Cryogenic Vial). To do so, after Step 39, first count the total number of cells harvested.
• 43Then, calculate the number of cryovials needed based on the total number of cells. Centrifuge the cells at 300g for 5 min, resuspend the cell pellet with appropriate volume of Bambanker Cell Freezing Medium and aliquot 0.5 mL to cell suspension into each cryovial. As an example, if counted total cell number is 2,000,000 cells from Step 42 and the plan is to freeze 200,000 cells in each cryovial, then you will need to resuspend the cells in 5 mL Bambanker Cell Freezing Medium then aliquot 0.5 mL per cryovial, leaving a total of 10 cryovials with 200,000 cells each.
• 44Transfer the cryovials into −80 °C freezer.

PAUSEPOINT The cells can be stored in – 80°C for up to 1 year. For long-term storage, transfer the cryovials from −80 °C freezer to liquid nitrogen tank.

Characterization of iNPC line using immunostaining ●TIMING 1d

• 45iNPC quality can be regularly checked using immunostaining every 4–5 passages (2–3 weeks). For that, after dissociating cells (Step 39), count the cell density and seed 100,000 cells into one 1.7 mL Eppendorf tube and then centrifuge at 300g for 5 mins. Resuspend the pellet with 100 μl hNPSR-v2 medium and seed into one well of a Matrigel-coated 96-well plate. Scale up if multiple wells are needed for immunostaining. The next day, these cells will attach to the plate and are ready for immunofluorescence staining directly in the 96-well plate.
• 46Aspirate the culture medium and add 50 μL 4% Paraformaldehyde Aqueous Solution (4% PFA) to fix the cells for 10 mins in room temperature.

! CAUTION Formaldehyde/paraformaldehyde are moderately acutely toxic by all routes of exposure, but the more concerning health hazards in a workplace setting are the chronic health hazards arising from them being a carcinogen, mutagen, and potent sensitizer. 4% PFA must be handled in a fume hood.

• 47Aspirate the 4% PFA fixative from the well and wash the well with 100 μL PBS for three times.
• 48Aspirate the PBS after the last wash and add 100 μL blocking buffer for 20 mins.
• 49Aspirate the blocking buffer and add 60 μL blocking buffer containing desired primary antibodies for 1 hour. Information of our commonly used and validated antibodies for NPC characterization and their dilution ratios is listed in Table 5.
• 50Aspirate the primary antibody solution and add 100 μL PBST to wash the well for three times.
• 51Aspirate the PBST after the last wash and add 60 μL blocking buffer containing desired secondary antibodies for 30 mins.
• 52Aspirate the secondary antibody solution and then wash the well with 100 μL PBST for three times. The samples are now ready for imaging using epifluorescence microscopy or confocal microscopy of choice. High-quality iNPC line should display >90% positivity for all these marker genes listed in Table 5 except for PAX2, which will decrease over passages as described in our original publication²⁸ (Fig. 3b and c).

Generation of nephron organoids from hNPSR-v2-cultured iNPCs ●TIMING 22d

• 53Day -1: Following dissociation to single cells (Steps 37–39), count the cells utilizing the TC20 Automated Cell Counter.
• 54Centrifuge at 300g for 5 mins. Remove the supernatant and resuspend the cell pellet with appropriate volume of hNPSR-v2 so that each 100 μl of medium will contain 25,000–30,000 iNPCs.
• 55Seed around 25,000 to 30,000 iNPCs into one well of a 96-Well U-bottom low-attachment plate in 100 μL hNPSR-v2 medium and then centrifuge the plate at 300g for 5 mins.

▲ CRITICAL STEP We suggest adding PBS to the outer boundary wells of the 96-well U-bottom plate to minimize evaporation.

• 56After centrifugation, place the plate in the incubator to allow the cells to aggregate overnight.
• 57Day 0: The iNPC aggregates are transferred to the membrane of a Transwell for air-liquid interface culture. First, in a 6-well Transwell plate, add 1 mL of Phase I medium (Table 4) to the bottom chamber of each well. The other unused Transwell inserts from the Transwell plate can be transferred to another regular sterile 6-well cell culture plate for future use.
• 58To transfer the aggregates without compromising their spherical structure, cut the tip of a P200 pipette tip to carefully pick up and place the iNPC aggregates on Transwell membrane.
• 59Use a new uncut P200 pipette tip to carefully pipette out the surrounding medium that lingered from the transfer so the aggregates can attach to the membrane.

▲ CRITICAL STEP We recommend placing no more than six iNPC aggregates onto each well of a Transwell membrane to ensure enough space and medium nutrients for the nephron organoids to develop.

• 60Place the Transwell plate in the incubator for 1 hour. After 1 hour, remove the Phase I medium and directly add 1 mL Phase II medium in Table 4 into the bottom chamber of Transwell plate.

▲ CRITICAL STEP It’s critical to remove most of the Phase I medium as residual CHIR99021 could have some detrimental side-effects to the iNPC aggregates. When removing the Phase I medium, carefully lift up the Transwell insert and aspirate the well and the bottom area of the membrane without damaging the membrane.

• 61Day 2 and 4: Change medium with 1mL fresh Phase II medium.
• 62Day 5: Remove the Phase II medium and add 1 mL Phase III medium in Table 4 into the bottom chamber of the Transwell plate.
• 63Day 7–19: Starting on Day 7, change medium with 1 mL fresh Phase III medium every other day. Note the dramatic morphological changes as nephron organoids develop (Fig. 4a). Specifically, look for the formation of RV/CSB/SSB-like structures in the organoids from days 5–8 (Fig. 4a and b), and the formation of tubule-like structures from days 12–21 indicating further nephron development (Fig. 4a and c).

Fig. 4 |. Generation and characterization of iNPC-derived nephron organoids.

a, Representative time-course bright-field images of iNPCs undergoing nephron organoid differentiation. Yellow boxed area on D5 is enlarged and shown on the lower left corner. Red circle indicates a single renal vesicle (RV) structure. Scale bars, 200 μm. b and c, Immunofluorescence images of nephron organoid differentiation on day 8 (b) and day 21 (c) showing the formation of SSB (b) and nephron structures (c), respectively. Scale bars, 200 μm (b) and 50 μm (c). SSB, S-shaped body. d, RT-qPCR analysis of the expression of mature podocyte marker genes in day 28 (D28) iNPC-derived nephron organoid, an 11.2 week (wk) human fetal kidney, and a 4-year-old (4yr) human kidney. e, Proportions of cell types identified in iNPC-derived kidney organoid and hPSC-derived kidney organoids. Morizane protocol^7,50: TT.r1 and TT.r2; Takasato protocol^8,27: AN1.1, BJFF, and H9. f, Dot plot of snRNA-seq data showing early and late podocyte gene expression in podocytes derived from iNPC-derived kidney organoid and hPSC-derived kidney organoids. g, Expression of NPHS1 (podocyte marker gene) in different types of kidney organoids through a violin plot. h, Genome browser views of snATAC-seq open chromatin regions of selected genes in iNPC-derived podocyte (COL4A3, COL4A4, and NPHS1), as compared with adult kidney’s podocyte. The data shown in (c, e-h) was previously published in Huang et al., Cell Stem Cell, 2024²⁸.

◆ TROUBLESHOOTING

• 64
  Day 21: Harvest the iNPC-derived nephron organoids for various assays to characterize the organoids (Step 65)

  • Note: iNPC-derived nephron organoids can be harvested for various assays at any timepoint of the differentiation for different purposes. Extended organoid culture in Phase III medium beyond D21 is not recommended. The organoids might be unhealthy after D21.

Characterization for iNPC-derived nephron organoid ●TIMING 2d

• 65
  At the end of Phase III (Day 21), iNPC-derived nephron organoids are ready for characterization: follow Option A for immunofluorescence staining and Option B to prepare samples for reverse transcription-quantitative polymerase chain reaction (RT-qPCR).

  • A
    Immunofluorescence staining

    • i
      To prepare samples for immunostaining, remove the Transwell insert from 6-well plate and peel the whole Transwell membrane off using fine forceps (organoids should stay on top of the membrane).
    • ii
      Use a blade or fine scissors to cut the Transwell membrane into smaller pieces (~5 mm) with each piece containing one organoid in the center.
    • iii
      Use forceps to transfer each Transwell membrane piece with an organoid into one 1.5mL Eppendorf tube containing 200 μL 10% FBS medium.

▲ CRITICAL STEP It’s important to use solution containing FBS to transfer the organoids. When basal medium without FBS or PBS is used, organoids can stick to the Eppendorf tube, leading to loss of samples.

• ivAspirate the 10% FBS medium and add 200 μL 4% PFA for fixation at room temperature for 12 mins.
• vAspirate the 4% PFA and wash the organoid with 500 μL PBS 3 times.
• viAspirate the PBS after the last wash. Add 500 μL blocking buffer and incubate for 30 mins in room temperature.
• viiAspirate the blocking buffer and add 200 μL blocking buffer containing desired primary antibodies for incubation overnight at 4°C. Information of our commonly used and validated antibodies for nephron organoid characterization and their dilution ratios is listed in Table 6.
• viiiAspirate the primary antibody solution and add 500 μL PBST to wash the well for three times.
• ixAspirate the PBST after the last wash and add 200 μL blocking buffer containing desired secondary antibodies for incubation overnight at 4°C.
• xAspirate the secondary antibody solution and then wash the well with 500 μL PBST for 3–5 times.
• xiUse forceps to hold the Transwell membrane piece and transfer the piece with organoid onto a microscope slide.
• xiiRemove excessive PBST and then add around 20 μl mounting medium.
• xiiiPut one microscope cover slip on the sample (avoid bubble formation). Note: This step only flattens the samples slightly but does not affect the overall organoid structure since the organoids are already flattened upon culture on Transwell.
• xivSeal the sample with nail polish surrounding the cover slip. The sample is now ready for imaging using epifluorescence microscopy or confocal microscopy. iNPC-derived nephron organoids should display NPHS1⁺/NPHS2⁺/PODXL⁺/MAFB⁺ podocyte, LTL⁺/LRP2⁺/HNF4A⁺ proximal tubule, SLC12A1⁺ Loop of Henle and POU3F3⁺/CDH1⁺ distal nephron.

• B
  Preparing samples for RT-qPCR

  1. For preparing samples for RT-qPCR to determine mature podocyte marker gene expression, detach organoids from Transwell membrane using fine needles.
  2. Cut 5 mm from a P1000 pipette tip to make a wide opening for the pipette tip.
  3. Wet the detached organoids (still on Transwell membrane but detached) with 10% FBS medium and transfer the organoids to an Eppendorf tube with 10% FBS medium.
  4. Aspirate as much of the residual 10% FBS medium as possible during transfer. Then, proceed with standard RNA extraction using any commercial kit of choice, followed by RT-qPCR following suppliers’ instructions. Our validated RT-qPCR primers (SYBR green-based) for mature podocyte genes are listed in Table 7. The representative data are shown in Fig. 4d.

Troubleshooting

Troubleshooting advice can be found in Table 8.

Table 8|.

Troubleshooting table

Problem	Step	Possible reason	Solution
Fibroblast-like spontaneously differentiated cells are observed in the hPSC culture.	2	Over-pipetting can induce mechanical stress that result in spontaneous differentiation.	If this issue arises it is best to thaw a new vial, or you can clean up by clone-picking and allowing the undifferentiated hPSC clone to grow in a new well.
Differentiating cells start to peel off from the plate.	23	Starting hPSC colony size is too big.	Titration of the initial hPSC seeding numbers from 20,000 to 30,000 to identify the optimal condition for specific hPSC line. Refer to Fig. 2a for the optimal hPSC colony size to start differentiation.
Signature condensed iNPC clusters are not observed on Day 10 of hPSC-to-iNPC differentiation.	26	Intrinsic hPSC line differences in cell proliferation rates can result in suboptimal starting hPSC colony size on Day 0 of differentiation. CHIR99021 concentration in Phase I is not optimal for this specific hPSC line.	Titration of the initial hPSC seeding numbers from 20,000 to 50,000 to identify the optimal condition for specific hPSC line. Refer to Fig. 2a for the optimal hPSC colony size to start differentiation. Titration of CHIR99021 concentrations in Phase I medium from 4 μM to 10 μM if the initial 8 μM does not work well.
No ITGA8 positive cells are observed during FACS	31	ITGA8 is weakly expressed due to poor hPSC-to-iNPC differentiation. Reduced efficiency of primary antibody binding.	Optimization of protocols for hPSC-to-iNPC differentiation might be required. Our suggestion is to titrate CHIR99021 concentration from 4–10 μM in the Phase I medium to identify the optimal concentration for specific hPSC line. Never reduce ITGA8 primary antibody incubation time in live cell staining. Our own experience is that 1 hour will be sufficient, but 30 minutes will result in complete failure of ITGA8 primary antibody binding to the cell surface for FACS. Some hPSC lines might express weak ITGA8 on day 10 of hPSC-to-iNPC differentiation. However, upon culture in hNPSR-v2, ITGA8 expression will be much higher. In this case, on day 10 of hPSC-to-iNPC differentiation, dissociate all the differentiated cells and culture the cells in hNPSR-v2 following procedures described in Step 31 Option B. After 2 passages in hNPSR-v2, perform ITGA8 staining followed by FACS to enrich the iNPCs.
Slowed down iNPC expansion (longer than 5 days to reach confluency in one passage cycle), loss of NPC marker gene expression, changed cell morphology, or cell death.	33	Too strong pipetting when handling iNPCs during passaging. Shear force will lead to compromised NPC health and loss of NPC progenitor identity. iNPCs overgrowth. Medium components are inactivated after extended storage in 4°C or upon repeated warm-up in 37 °C.	Accumax incubation is usually sufficient to dissociate iNPCs into single cells without mechanical pipetting. Only pipette up and down very gently after Accumax incubation (a couple of times should be sufficient) simply to mix the cells evenly. Always passage the cells when iNPC growth reaches 80–90% confluency. Discard the iNPCs that are overgrown and thaw new vials. Never prewarm hNPSR-v2 to 37 °C before use. It is not necessary. More importantly, FGF2 in the medium is easily inactivated in 37 °C. Medium components in hNPSR-v2 will also have compromised efficacy upon extended storage in 4°C. We do not use medium that is stored in 4°C beyond 2 weeks.
Compromised or failed nephron organoid differentiation (no renal vesicle structures observed 5–8 days after differentiation and/or no tubules observed beyond day 12 of differentiation)	63	1. iNPC quality is low. 2. Intrinsic differences of iNPC lines to respond to Wnt activation. 2. Inactivity of FGF9.	Culture and use of iNPCs beyond 100 days for nephron induction is not recommended. Prepare frozen vials of early-passage iNPCs and thaw a new vial when the culture reaches 100 days. Different iNPC lines derived from different hPSC lines might have intrinsic differences in responding to the initial CHIR99021 treatment to induce MET. If the standard 1-hour CHIR99021 treatment protocol does not result in optimal organoid formation, try titration with 3 μM CHIR99021 for 12, 24, and 48 hours in Phase I. FGF9 in the Phase II medium is very important for successful nephron organoid differentiation. It is important to use 50 ng/ml. Also ensure it is stored in 4°C for no more than 2 weeks. Thaw a new aliquot if stored in 4°C for longer than 2 weeks.

Timing

Steps 1–19, hPSC passaging and expansion in preparation for hPSC-to-iNPC differentiation: 9d

Steps 20– 31, hPSC-to-iNPC differentiation and purification of iNPCs: 10d

Steps 32– 44, iNPC expansion in hNPSR-v2 medium, passaging, and cryopreservation: 4–17d

Steps 45– 52, characterization of iNPC line: 1d

Steps 53–64, generation of nephron organoids from cultured iNPCs: 22d

Step 65, characterization of nephron organoids: 2d

Anticipated results

This protocol has been used to successfully derive iNPC lines from a diverse source of hPSC lines with or without NPC-specific reporter systems²⁸, including hPSC lines bearing SIX2-GFP only, or SIX2-GFP/PAX2-mCherry, reporters from the H1 hESC parental line, and MAFB-GFP⁴⁷ from the H9 hESC parental line. Multiple lab personnel from our lab and our collaborators’ labs have been able to successfully execute the protocol demonstrating its highly reproducibility.

Following the 10-day hPSC-to-iNPC differentiation protocol, on day 9–10, formation of morphologically distinct condensed NPC clusters can serve as a strong indicator for successful iNPC induction (Fig. 2a and b). When SIX2-GFP/PAX2-mCherry or SIX2-GFP reporter hPSC lines are used, these condensed NPC clusters will show bright SIX2-GFP, indicating their NPC identity (Fig. 2a and b). On day 10 of differentiation, typically 10–20% of the cells are SIX2-GFP⁺/PAX2-mCherry⁺ iNPCs based on FACS (Fig. 2c and d). FACS from cells differentiated in one well of a 12-well plate can lead to the isolation of 200,000–300,000 iNPCs. These purified iNPCs are collected and cultured in hNPSR-v2 medium for expansion. Upon expansion, one confluent well of a 12-well plate can produce 1–1.5 million iNPCs.

iNPCs can be expanded in hNPSR-v2 medium for more than three months. Typically, iNPCs are passaged once every 4–5 days at a ratio of 1-to-10 (Fig. 3a). iNPCs show mesenchymal cell morphologies and show uniform expression of several key NPC marker genes, such as SIX2, PAX2, SALL1, WT1, ITGA8 and YAP by immunofluorescence staining (Fig. 3b and c). Bulk RNA-seq analysis indicates gene expression of the iNPCs are similar to primary human NPCs from human fetal kidneys^48,49 (Fig. 3d). Immunostaining is recommended as a simple and reliable quality control assay to determine iNPC quality in culture every 2–3 passage. Except for a gradual decrease of PAX2 expression over time, the expression of SIX2, SALL1, WT1, ITGA8 should be consistent in the iNPCs all the time in hNPSR-v2 culture. Expanded iNPCs not only display uniform expression of several NPC marker genes as revealed by immunofluorescence staining but also resembles primary human NPCs in transcriptome based on bulk RNA-seq analysis²⁸.

Dramatic morphological changes are expected during nephron organoid formation from the iNPCs on air-liquid interface. Around differentiation days 5–8, hundreds of epithelialized renal vesicle (RV) structures are formed in the organoids, indicative of successfully MET and initiation of nephron induction (Fig. 4a). RV structures continue to self-organize into SSB (Fig. 4b) and nephron structures showing the expression of podocyte markers PODXL1 and NPHS2, proximal tubule marker LRP2 (localized on the apical side of the tubule lumen), loop of Henle marker SLC12A1 (localized on the apical side of the tubule lumen), and distal nephron marker CDH1 (Fig. 4a and c). Single cell multiome (10X Genomics) analysis confirmed the generation of various nephron cell types and indicated a biased generation of a dominant podocyte population in the iNPC-derived organoids as compared to standard hPSC-derived nephron organoids (Fig. 4e and g). These podocytes show decreased expression of immature podocyte markers and dramatically increased mature podocyte markers (e.g. COL4A3 and COL4A4) (Fig. 4d and f) with these mature marker genes’ open chromatin status similar to that of an adult kidney’s podocytes (Fig. 4h). For quality control, we recommend two checkpoints during differentiation: 1) the formation of morphological distinct RV and SSB structures 5–8 days after initiation of differentiation, and 2) the formation of major nephron segments revealed by immunostaining at the end point of organoid differentiation. To determine podocyte maturity, RT-qPCR can be used to confirm late podocyte marker gene expression (Fig. 4d and Table 7). Long-term cultured iNPCs (more than 3 months) still retain robust nephrogenic potential to differentiate into different nephron segments²⁸.

Key points:

• Protocol for the purification and expansion of hPSC-derived induced nephron progenitor cells (iNPCs) for long-term culture in a regular monolayer culture format, and their use for the generation of nephron organoids.

• These iNPCs have a transcriptome much closer to primary human NPCs than the transient hPSC-derived iNPCs. Also, the iNPC-derived nephron organoids show minimal off-target cell types compared to hPSC-derived kidney organoids, with enhanced podocyte maturity.

Data availability

The original research describing the development of the protocols can be accessed in a previous publication²⁸, as well as in Mendeley Data: https://doi.org/10.17632/7ch42j6767.1. Raw data of bulk RNA-seq and single-cell multiome relevant to the original publication are available at the Gene Expression Omnibus (accession no. GSE230707 and GSE251862). Source data are provided with this paper.