Differentiation potential of human amniotic fluid derived-mesenchymal stem cells into dopaminergic neurons

Abstract

Stem cell-based therapies have emerged as promising alternatives for disease modification and cell replacement, aiming to improve the quality of life in patients with Parkinson’s disease. Human amniotic fluid mesenchymal stem cells (hAF-MSCs) represent a viable source due to their self-renewal ability, high proliferative capacity, and multipotent differentiation potential. This study aimed to evaluate the in vitro differentiation potential of hAF-MSCs into dopaminergic neurons. Flow cytometry and Alamar blue assays were employed to confirm mesenchymal stem cell characteristics. The hAF-derived cells fulfilled the established MSCs criteria, including fibroblast-like morphology, surface marker expression, and proliferative capacity. Upon induction with dopaminergic differentiation factors, the cells acquired neuron-like morphology. RT-qPCR analysis revealed significantly upregulated expression of neuronal and dopaminergic-specific genes (nestin, β-III-tubulin, and tyrosine hydroxylase), further supported by immunofluorescent staining showing the presence of neuron-related proteins. These findings demonstrate the potential of hAF-MSCs to differentiate into dopaminergic neurons and highlight their promise for future applications in regenerative medicine.

Introduction

Dopaminergic neurons, located in the midbrain of the mammalian central nervous system, are responsible for synthesizing the neurotransmitter dopamine (DA), playing a vital role in controlling movement, influencing reward mechanisms, modulating mood, and guiding decision-making processes. A deficiency in DA production is a hallmark of Parkinson’s disease (PD), one of the most prevalent neurodegenerative disorders [1, 2] affecting approximately 1% of individuals over 60 years old. It is characterized by progressive loss of dopaminergic neurons and Lewy body formation, leading to reduced DA in the substantia nigra and striatum and resulting in clinical symptoms such as tremor, rigidity, bradykinesia, and postural instability [2].

Current treatment strategies primarily involve DA replacement, most commonly through levodopa administration [3]. Although levodopa provides symptomatic relief by increasing DA levels in the striatum, long-term use is associated with significant side effects, including hallucinations and motor complications [4]. Deep brain stimulation offers another therapeutic option, but its effectiveness is variable, and the invasive nature of the procedure presents additional risks and eligibility concerns [5]. Considering these limitations, stem cell-based therapies have gained attention as promising alternatives for restoring dopaminergic function in PD patients [6]. Stem cells are valued in regenerative medicine for their self-renewal capabilities and ability to differentiate into various cell types under suitable conditions [6]. Embryonic stem cells, with their inherent pluripotency, were initially considered ideal for therapeutic use [7, 8]; however, ethical concerns and risks of tumorigenicity have hindered their clinical application [9]. Consequently, adult stem cells (ASCs) have been explored as alternatives. Although ASCs possess a more limited differentiation potential, they present fewer ethical issues. Among these, mesenchymal stem cells (MSCs) are especially promising due to their ability to differentiate into cell types from all three germ layers [10, 11].

MSCs can be isolated from diverse tissues, bone marrow, dental pulp, umbilical cord, and adipose tissue [12-15]. Although bone marrow has been primary source of MSCs, its use is limited by donor age-related decline in differentiation capacity and the invasive nature of the collection procedure [16, 17]. Currently, placental tissues—including the umbilical cord, chorionic villi, amniotic fluid, and membranes—are the most commonly used sources of MSCs. These gestational tissue-derived MSCs possess greater immunosuppressive potential compared to those from adult sources. In addition, MSCs from perinatal tissues offer several advantages over other sources: their collection is non-invasive, ethical, and results in high yields [18-20].

Human amniotic fluid (hAF) has recently emerged as a compelling alternative source of MSCs. It contains a heterogeneous population of cells originating from both fetal and placental tissues [21], with representatives of all three embryonic germ layers having been identified in the fluid [22]. Amniotic fluid-derived mesenchymal stem cells (AF-MSCs), typically obtained via amniocentesis during the second trimester for prenatal diagnosis, represent a developmental stage intermediate between embryonic and ASCs [21, 23]. They were found to express embryonic markers, such as Oct-4, as well as pluripotency-associated markers like SSEA4 and c-Kit [20, 24, 25]. Moreover, they can be collected with minimal ethical concerns and low risk of tumorigenicity [26].

Therefore, the objective of this study was to investigate the in vitro differentiation potential of hAF-MSCs, a multipotent stem cell population with immunological compatibility potential for generating dopaminergic neurons as a step toward developing effective cell-based therapies for PD.

Materials and Methods

Cell samples

The back-up flasks of hAF cell samples were received from the 16–22 weeks of gestation by amniocentesis after prenatal diagnosis with normal karyotype (46, XX/46, XY) from the Human Genetics Laboratory, Department of Anatomy, Faculty of Medicine, Chiang Mai University. This study protocol complied with the exemption criteria and was exempted by the Research Ethics Committee of the Faculty of Medicine, Chiang Mai University (Study Code: ANA-2562-06584). Due to the nature of the study, the requirement for informed consent was waived by the committee. All samples were expanded before the experimental analysis as follows.

Cell isolation

The direct adherent method was used to isolate hAF-MSCs as previously described [27]. Firstly, the hAF cell samples were cultured with BIOAMF-3^TM Complete Medium (Biological Industries) in 25 cm² flasks (Corning Incorporated) at 37°C, 5% CO₂ and 95% humidity until the colonies of the adherent cells appeared. After that, the basal growth medium, Dulbecco’s Modified Eagle Medium (DMEM)–high glucose (Gibco) was replaced with a supplement of 10% fetal bovine serum (FBS) (Gibco), gentamycin, Pen Strep (penicillin and streptomycin) (Gibco). After 24 h, the culture medium was changed to remove non-adherent cells. At 80% confluence, they were sub-cultured using 0.25% trypsin-EDTA (Gibco) and re-expanded under similar conditions. The medium was changed every 3 days, and the 2nd passage was utilized for all experiments.

Cell culture

The hAF cell samples (2nd passage) were observed under DMi1 inverted phase contrast microscope (Leica Microsystems). The cells were then washed twice with sterile phosphate-buffered saline (PBS) (Amresco) and trypsinized with 0.25% trypsin-EDTA. Subsequently, hAF cells were suspended in the basal growth medium (DMEM-high glucose with 10% FBS) and centrifuged (C2 series, Centurion Scientific Ltd) at 2,035 g for 6 min at room temperature. Finally, the hAF cells were used in the next experiments.

Flow cytometry analysis

To determine MSCs surface markers, the hAF cell samples (n=3) were trypsinized and centrifuged at 2,035 g, 6 min at room temperature for 2 times. After that, the cells were incubated with monoclonal antibodies; fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD34, CD90 (Biolegend), mouse anti-human HLA-ABC (Immuno Tools GmbH), and mouse anti-human fibroblast (EDM), as well as phycoerythrin (PE)-conjugated mouse anti-human CD31, CD117, HLA-DR (Immuno Tools GmbH), mouse anti-human CD44 (Pierce Biotechnology), and mouse anti-human CD73 (Life Technologies) at 4°C for 1 h. FITC mouse isotype control and PE mouse isotype control (Biolegend) were used as negative controls. Cell fluorescence was evaluated using FACscan and analyzed by the CellQuest Pro 9.0 software (Becton Dickinson).

Alamar blue cell proliferation assay

The colorimetric indicator was used to measure living cell proliferation from the oxidation–reduction of the living cell metabolism through the conversion of resazurin (oxidised form, blue color) to resorufin (reduced form, pink color) and monitor the absorbance of Alamar blue at 540–630 nm. In brief, the hAF-MSCs (n=3) were plated on a 24-well culture plate (Corning Incorporated) at a density of 2×10³ cells/well for 24 h. Thereafter, the medium was removed and 100 μl of 10% Alamar blue in DMEM was added. The samples were then incubated at 37°C, 5% CO₂ with 95% humidity for 4 h. After that, the supernatant was evaluated using the colorimetric change from each well, while hAF-MSCs were continuously cultivated with basal growth medium. Absorbance measurement was done every other day until day 21 of the culturing period using an Original Multiskan EK spectrophotometer plate reader (Thermo Scientific).

Dopaminergic induction

The hAF-MSCs (n=5) were seeded in 24-well culture plates at the density of 1×10⁴ in each well. Cells were divided into 2 groups under different conditions. The control group was cultured with basal growth medium and dopaminergic induced group was cultured with induced medium (basal growth medium+N2-supplement [Gibco]+10 ng/ml FGF2 [Peprotech]+10 ng/ml EGF [Peprotech]+100 ng/ml FGF8 [Gibco]+250 ng/ml SHH [Peprotech]+300 ng ATRA [Peprotech]). The culture medium was changed every 3 days until 21 days of induction.

Histological analysis

After 21 days of dopaminergic induction, the cells in both control and dopaminergic induced groups were fixed with 4% paraformaldehyde at 4°C for 15 min, washed with dH₂O 2 min twice and stained with Harris’s hematoxylin for 3 min. After that, the cells were washed twice with dH₂O for 1 min, counterstained with eosin and washed twice with dH₂O for 1 min. The cells were then dehydrated with alcohol series twice for 1 min. Finally, the cells were cleared and mounted. All stained slides were visualized using a microscope Olympus AX70. Photographs were taken with DP manager and DP controller (Olympus Life Science).

Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR)

After 1, 7, 14, and 21 days of dopaminergic induction, total ribonucleic acid (RNA) was extracted from both control and dopaminergic induced groups by using utilizing an Illutra RNAspin Mini RNA Isolation Kit (GE Healthcare), and then the complementary DNA (cDNA) was synthesized from 0.5 μg RNA using the iScript^TM cDNA Synthesis kit (Bioline) according to the manufacturer’s instructions. The RT-qPCR was carried out using a SensiFAST^TM SYBR^® No-ROX Kit (Bioline) on a Chromo4^TM Real-Time PCR Detector (Bio-Rad). PCR primers (Table 1) were used to target nestin (NES), β-III-tubulin (TUBB3), glial fibrillary acidic protein (GFAP), and tyrosine hydroxylase (TH). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control gene for normalizing the relative gene expression level using the 2^−ΔΔct method.

Table 1.

The primer for RT-qPCR

Gene	Primer sequence
NES	Forward 5'-3' CAGCTGGCGCACCTCAAGATG Reverse 5'-3' AGGGAAGTTGGGCTCAGGACTGG
TUBB3	Forward 5'-3' GCACACTGCTCATCAACAAG Reverse 5'-3' TCTTGCTCTCCTTCATGGAC
GFAP	Forward 5'-3' ACCTGGCCAGTTATCGACAG Reverse 5'-3' TCTTAGGGCTGCTGTGAGGT
TH	Forward 5'-3' AACCAGATCGGGGCCAAGTT Reverse 5'-3' GGCACGTACTTGTGAGAAGAGG
GAPDH	Forward 5'-3' ATGGGAAGGTGAAGGTCG Reverse 5'-3' TAAAAGCAGCCCTGGTGACC

Immunofluorescence

After 21 days of dopaminergic induction, the cells in both groups were fixed with 4% paraformaldehyde at 4°C for 30 min and the cell membranes were permeabilized with 0.1% triton X-100 (Amresco) in PBS for 5 min. After blocking (10% AB-serum in 1% bovine serum albumin in PBS [BSA-PBS]) for 30 min at 4°C, the cells were then incubated with rabbit anti-NES antibody (Merck), mouse anti-TUBB3 antibody (Merck) and rabbit anti-TH antibody (Merck) for 1 h. Next the cells were incubated with PE-conjugated goat anti-rabbit IgG antibody (Thermo Scientific) or FITC-conjugated goat anti-mouse IgG antibody (Thermo Scientific). Subsequently, the nuclei and coverslips were mounted onto the microscopic slides using anti-fade reagent with 4'-6-diamidino-2-phenylindole (Invitrogen). The cells were visualized by using a fluorescent microscope Olympus AX70. Photographs were taken with DP manager and DP controller (Olympus Life Science). To quantify protein expression levels, the fluorescence intensity was analyzed using ImageJ software and presented as the corrected total cell fluorescence (CTCF).

Statistical analysis

Data distribution was assessed using the Shapiro–Wilk test. Since the data were not normally distributed, non-parametric tests were used. Differences between control and induced groups were analyzed using the Mann–Whitney U-test, and r-values were calculated as effect sizes. Comparisons across multiple time points within the induced group were performed using the Kruskal–Wallis test and post hoc analysis. All results are presented as a P-value. All statistics were performed by using SPSS 26.0 version software (IBM Co.).

Results

Cell isolation and cultivation

During the cultivation period, the hAF cells (1st passage) exhibited the heterogeneous population (polygonal and fibroblast-like morphology) and adhered to culture flasks (Fig. 1A). In the 2nd passage the polygonal shaped-cell seemed to diminish while the fibroblast-like cells were adhered and expanded in monolayer (Fig. 1B).

Fig. 1.

Morphology of hAF cells. Phase-contrast micrographs of unstained cells in the culture flask at 10× magnification. (A) The 1st passage exhibited a heterogeneous population consisting of polygonal-shaped cells and fibroblast-like cells. (B) The 2nd passage displayed a more homogeneous population of fibroblast-like cells.

Flow cytometry analysis

The results showed that the hAF cells exhibited positive expression of MSCs markers CD44 (96.18%), CD73 (90.27%), CD90 (98.52%), and HLA-ABC (96.29%). As expected, they were negatively stained with platelet endothelial cell adhesion molecule CD31 (0.2%), hematopoietic cell surface marker CD34 (0.36%) and CD45 (0.09%), amniotic fluid stem cells CD117 (0.15%), HLA-DR (0.24%), and fibroblast surface protein (0.21%) (Fig. 2).

Fig. 2.

Immunophenotypic characterization of human amniotic fluid mesenchymal stem cells (hAF-MSCs) by flow cytometry. The hAF-MSCs cells at the 2nd passage are analyzed. (A) Histograms showing positive results for CD44, CD73, CD90, and HLA-ABC markers. (B) Histograms showing negative results for CD31, CD34, CD45, CD117, fibroblast, and HLA-DR markers. In each histogram, the blue area represents the fluorescence intensity of cells stained with the specific antibody against each marker (indicating positive expression), while the red area represents the isotype control (indicating background fluorescence).

Alamar blue cell proliferation assay

The result revealed the potential proliferation in the logarithmic phase through continuously increased from the early stage of cultivation (day 1–7). After that, the cells began to increase steadily (day 7–11). Interestingly, the highest level of cell proliferation had been observed on day 11 with 2.52-fold compared with the first day of cultivation. After day 13 the cell numbers began to decrease (Fig. 3). The growth characteristic of hAF-MSCs indicated that the percentage of reduction of cells continuously increased in log phase from the early stage of cultivation. After day 9, Cells then entered the stationary phase and began to decrease after day 11 through day 21.

Fig. 3.

Growth characteristics of human amniotic fluid cells cultured in basal growth medium for 21 days by Alamar blue cell proliferation assay.

Histological analysis

Morphological changes were observed at day 21 of dopaminergic induction after H&E staining. The cells in the control group showed the general MSCs morphology, flattenand spindle cell shape (Fig. 4A). In dopaminergic induced group, the cell body area seemed to reduce by representing the retraction of the cytoplasm to nucleus and the extended processes of cells were found more than the cells in control group (Fig. 4B).

Fig. 4.

Morphology of hAF-MSCs after 21 days of dopaminergic induction, visualized by H&E staining at 10× magnification. (A) Control group culture in basal growth medium that maintained fibroblastic morphology and (B) dopaminergic induced group showed the retraction of the cytoplasm to nucleus and the extended processes.

Detection of gene expression

RT-qPCR was used to determine the dopaminergic differentiation potential of hAF-MSCs. After 1, 7, 14, and 21 days of dopaminergic induction, the cells in both control and dopaminergic induced groups were evaluated for neuronal and dopaminergic specific genes (NES, TUBB3, and TH). The results indicated that the gene expression of dopaminergic induced group was equal with control group on day 1. Then, the gene expression became significantly greater on day 7. After that, the expression continuously increased on day 14 and still exhibited significantly higher expression compared between day 1 and day 21 (Fig. 5). Additionally, the NES, TUBB3, and TH gene expression of dopaminergic induced group significantly higher than control group on day 14 (NES 4.16-fold, TUBB3 3.66-fold, and TH 7.05-fold) and day 21 (NES 5.59-fold, TUBB3 3.95-fold, and TH 7.08-fold). Moreover, the expression of TUBB3 gene of dopaminergic induced group significantly higher than control group on day 7 of induction up to 2.27-fold. However, the expression of GFAP gene of dopaminergic induced group was decreased on day 7, 14 and revealed the lowest on day 21 (Table 2).

Fig. 5.

The expression of neuronal and dopaminergic specific genes after 21 days of cultivation in the control group and the induced group. The relative expression levels of NES (A), GFAP (B), TUBB3 (C), and TH (D) were determined by RT-qPCR. Gene expression data were normalized to GAPDH and are presented relative to the control group at the corresponding time point. Data are shown as mean±SEM. The Kruskal–Wallis test showed significant differences across time points within the induced group (NES, P=0.015; GFAP, P=0.022; TUBB3, P=0.018; TH, P=0.009). Dunn’s post hoc test was used for pairwise comparisons. *Indicates a statistically significant difference between the control and induced group by using Mann–Whitney U-test (P=0.008) (r=0.83). ^#Indicates a significant difference among different days of induction within the dopaminergic induced group (adjusted P<0.05).

Table 2.

Gene expression in day 1, 7, 14, and 21 of dopaminergic induction

Gene	Gene expression compared to control group
	Day 1	Day 7	Day 14	Day 21
NES	0.78±0.06	2.32±1.23	4.16±3.17	5.59±6.10
TUBB3	0.63±0.47	2.27±1.78	3.66±3.03	3.95±5.45
TH	0.54±0.31	2.72±1.40	7.05±9.23	7.08±7.16
GFAP	1.94±1.30	1.68±0.76	1.31±0.68	0.34±0.35

Values are presented as mean±SD.

Detection of protein expression

The dopaminergic differentiation capacity was confirmed with protein expression. On day 21 of dopaminergic induction, the cells in both control and dopaminergic induced groups were investigated for neuronal and dopaminergic specific proteins (NES, TUBB3, and TH). The results of immunofluorescence showed that the dopaminergic induced group was strongly positive for NES and TUBB3 (Fig. 6D–F, J–L) while the control group was not positive (Fig. 6A–C, G–I). In addition, the dopaminergic induced group had few positives for TH (Fig. 6P–R) while the control group had no signal (Fig. 6M–O). The quantitative data were analyzed using ImageJ software. The data are presented in term of the CTCF. The result showed that there were significant differences in CTCF levels for NES, TUBB3, and TH (Fig. 7).

Fig. 6.

Detection of specific markers by immunofluorescence staining. (A–C) Control group and (D–F) dopaminergic induced group represented nestin (NES)-positive cells (red fluorescence). (G–I) Control group and (J–L) dopaminergic induced group represented β-III-tubulin-positive cells (green fluorescence). (M–O) Control group and (P–R) dopaminergic induced group represented tyrosine hydroxylase (TH)-positive cells (red fluorescence). PE, phycoerythrin; FITC, fluorescein isothiocyanate.

Fig. 7.

Quantitative analysis of neural and dopaminergic markers via fluorescence intensity. The expression levels of nestin, β-III-tubulin, and tyrosine hydroxylase (TH) were quantified using corrected total cell fluorescence. Data are presented as mean±SEM. Statistical significance was determined using the Mann–Whitney U-test. *P=0.008, r=0.82 compared to the control group.

Discussion

hAF has emerged as a promising source of MSCs for therapeutic applications, owing to its ease of isolation, robust self-renewal capacity, multipotent differentiation potential, and immuno-privileged properties [26, 28]. While previous studies have demonstrated the differentiation potential of hAF-MSCs into mesodermal [25, 26] and endodermal lineages [29, 30], the present study aimed to explore their capacity to differentiate into ectodermal derivatives, specifically dopaminergic neurons.

MSCs in this study were successfully isolated from hAF using the direct adherence method, consistent with the technique described by Fei et al. [27]. The primary cell cultures initially exhibited heterogeneous morphology, which transitioned into a fibroblast-like appearance, one of the defining features of MSCs [28]. Flow cytometric analysis confirmed the MSC phenotype by the high expression of surface markers CD44, CD73, and CD90. Furthermore, the cells expressed HLA-ABC, supporting their immune privilege. In contrast, they were negative for hematopoietic (CD34, CD45), endothelial (CD31), and pluripotency (CD117) markers, as well as HLA-DR. Notably, low levels of fibroblast surface protein expression helped differentiate these cells from fibroblast populations, reinforcing their MSC identity.

According to the criteria for MSCs, it can be defined by the International Society for Cellular Therapy based on fibroblast-like morphology, the positive expression of MSCs surface markers, proliferation ability, and multipotent differentiation [31]. Previous studies reported that the hAF-MSCs strongly expressed MSCs surface markers, namely CD29, CD44, CD73, CD90, CD144, CD166, and HLA-ABC [32-34], while there were negative for CD31, CD34, and CD45, CD117 (c-Kit), HLA-DR, and fibroblast markers [35, 36]. The positive expression of HLA-ABC and negative expression of HLA-DR showed that hAF-MSCs have a significantly lower risk of allograft rejection and utilized in cell transplantation in immunologically matched recipients [32]. Moreover, the determination of cell proliferation using Alamar blue assay showed a similar growth curve to the previous findings which have a short lag phase, achieving highest peak around day 11–13, and plateaued thereupon [37-39]. This finding suggested that the hAF-MSCs were able to duplicate and maintain their self-renewal capacity.

In terms of dopaminergic induction capacity, the hAF-MSCs were cultured with dopaminergic induced medium. Following 21 days of induction, the histological staining showed the distinct morphology between control and dopaminergic induced groups. The induced group revealed the longer cytoplasmic processes than the control group. In agreement with previous studies, they have shown the induced cells illustrated neuron-like morphology with large nucleus and prolonged process [40-42]. The expression of neuronal and dopaminergic specific genes and proteins which play a significant role in neurogenesis/neuronal differentiation were used to evaluate the functionality of differentiated cells. The gene expression analysis by RT-PCR demonstrated that hAF-MSCs had significantly higher amounts of NES, TUBB3 genes in dopaminergic induced group than control group. These results were investigated further using immunofluorescence analysis, indicating that there were specific proteins expressed in induced cells. The results of NES and TUBB3 related gene expression referred to the ability of differentiation into neuronal lineage of hAF-MSCs [43-45]. Both genes have been widely used in various cerebral nervous system (CNS) cells differentiation [46-48].

NES and TUBB3, both cytoskeletal proteins, play a role in the process of neurogenesis [47]. NES is considered as a marker protein of neuronal progenitor cells and highly expressed in multipotent stem cells of CNS development [45, 49, 50]. TUBB3, a protein exclusively found in neurons, plays a crucial role in the early phases of neuronal differentiation. This characteristic makes it a dependable marker for identifying mature neurons [51, 52]. The expression of TUBB3 in mature neurons is associated with the presence of stable microtubules, essential for the maintenance of neurites. It is also believed to provide neurite extension by promoting microtubule polymerization during early neuritic development in neuroblastoma cells [51].

Moreover, the result showed an increase in the expression of TH gene, a dopaminergic specific marker. This gene leads to translation to TH enzyme which plays a role in the first step of the DA synthesis and is expressed in various regions of CNS [42, 53]. On the other hand, the expression of GFAP gene gradually decreased in the dopaminergic induction group and became the lowest on day 21 of the induction. GFAP, found in neural progenitor cells, is an intermediate filament protein that supports and stabilizes the astrocyte processes [54]. It is uniquely found in astrocytes in the CNS as a neuronal marker [55]. The gradual decline in GFAP expression levels indicates a preferential differentiation of hAF-MSCs into neurons rather than glial cells.

Our results indicating that MSCs derived from hAF exhibit the expression of dopaminergic specific marker that is comparable to MSCs from other sources such as bone marrow, adipose tissue and Wharton’ s jelly [53, 56]. MSCs from perinatal source perform a higher potential to differentiate into dopaminergic-like cell [56].

Taken together, our findings and those from previous researches suggest that hAF-MSCs exhibit a significant potential as an autologous cell source for future therapeutic applications in neurodegenerative diseases such as PD.

For further studies, it will be important to evaluate the functional maturity of these induced cells, specifically their ability to secrete DA in response to physiological stimuli, to confirm their identity as dopaminergic neurons. In addition, future studies should include quantitative protein analyses to provide more robust evidence of differentiation at the protein level. These approaches will be essential to fully validate the neuronal phenotype and therapeutic potential of hAF-MSC–derived dopaminergic-like cells.