Skip to main content
NCBI home page
RSC Advances logoLink to RSC Advances
. 2026 Sep 28;16(45):57759–57771. doi: 10.1039/d6ra05164b

DNA detection using metal-enhanced fluorescence

Awrad Khattab a, Mohamed Allam a, Aya A Mouhamed b, Ashrakat Yousry c, Amr M Mahmoud d, Radwa Ewaisha e,✉
PMCID: PMC13617611  PMID: 42807838

Abstract

The development of rapid and sensitive DNA detection methods is critical for advancing diagnostic technologies. This study explores the application of metal-enhanced fluorescence (MEF) to achieve a highly efficient DNA detection system. Gold nanoparticles (AuNPs) were selected due to their ability to amplify fluorescence signals. Ethidium bromide (EB) was employed as the fluorescent dye, given its strong intercalation with DNA and significant fluorescence enhancement upon binding. This system was employed for the detection of double stranded DNA upon formation from binding of single stranded DNA with a complementary probe. To create the detection system, AuNPs were chemically modified with either lipoic acid or aryl diazonium salt to optimize their surface properties. A bench-top fluorimeter was used for detection. The optimized system demonstrated a detection limit as low as 0.4 µg mL−1 of test DNA, showcasing its potential for practical applications. This work highlights the harmony between AuNPs and EB in enhancing fluorescence signals, paving the way for the development of a rapid DNA detection kit. The proposed method offers a promising alternative to conventional techniques, combining simplicity, sensitivity, and cost-effectiveness.

Gold nanoparticles amplify the ethidium bromide signal resulting from hybridization of test DNA and its specific probe, a rapid and amplification-free assay that identifies target DNA in the sample.graphic file with name d6ra05164b-ga.webp

1. Introduction

Fluorescence analysis is a widely utilized technique for both qualitative and quantitative assessment of substances through fluorescence spectroscopy.1 This method involves the absorption of photons by electrons in molecular orbitals, leading to excitation to higher energy levels.2 By measuring the absorbed energy, fluorescence spectroscopy enables the identification of unknown substances.2 Over the past two decades, it has emerged as a key analytical tool in biochemistry and biophysics, particularly for quantifying biological molecules.3 The preference for fluorimetry stems from its high sensitivity, specificity, simplicity, and cost-effectiveness compared to other available analytical approaches.3

One major advancement in fluorescence-based detection is metal-enhanced fluorescence (MEF), first introduced in 2002.4 MEF occurs when fluorophores are placed within 10 nm of a metallic surface, leading to a notable increase in fluorescence intensity while simultaneously shortening fluorescence lifetime.5 This enhancement significantly improves signal detection, allowing for lower detection limits in diagnostic tests.6

Among the metallic nanostructures utilized in biomedical applications, gold nanoparticles (AuNPs) are widely recognized for their low toxicity and biocompatibility.7 Recently, AuNPs have been increasingly applied in diagnostic technologies and radiation therapy, further expanding their biomedical relevance.8 These nanoparticles serve as biosensors and imaging agents, reinforcing their importance in molecular diagnostics.8

A particularly valuable application of gold nanoparticles is in DNA detection, where their colorimetric shift provides a visually observable indication of biomolecule binding. When gold nanoparticles bind to DNA, their interparticle spacing decreases, resulting in a color transition from red to purple (or blue).9 This property has proven useful in the detection of Staphylococcus aureus (S. aureus) DNA, demonstrating its potential in molecular diagnostics.10

Additionally, ethidium bromide (EtBr) has remained a widely used fluorescent dye in molecular biology for over 40 years, primarily for visualizing nucleic acids.11 Gold nanoparticles complement fluorescence-based detection methods by amplifying fluorescence signals, enabling greater sensitivity in biosensor applications.12

Medical diagnostics play a critical role in early disease detection, guiding treatment decisions and improving overall patient outcomes.13 However, challenges such as high costs, misinterpretation risks, and the requirement for specialized equipment still exist.14 Consequently, the development of rapid and sensitive DNA detection techniques remains essential for advancing diagnostic technology.15 Fluorescence spectroscopy, particularly when combined with AuNP-based enhancements, offers a highly effective approach to biomolecular detection, thanks to its superior sensitivity, specificity, and cost efficiency.16

This paper explores the role of metal-enhanced fluorescence in DNA detection, emphasizing its ability to improve diagnostic sensitivity, reduce detection limits, and drive innovation in biomedical sciences.17 By leveraging MEF principles and gold nanoparticle technology, researchers continue to refine biosensing methods for accurate and efficient molecular identification.

2. Experimental

2.1. Chemicals and reagents

Sodium citrate dihydrate, gold(iii) chloride solution (HAuCl4), 4-aminophenylacetic acid, tetrafluoroboric acid solution (HBF4), sodium nitrite (NaNO2), alfa-lipoic acid, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), and N-hydroxysuccinimide solution (NHS) were purchased from Sigma-Aldrich (USA) and used without further purification. Disodium hydrogen phosphate dihydrate buffer was purchased from MERCK (Germany). Ethidium bromide was purchased from Fisher Scientific (USA). A test DNA sequence derived from the Staphylococcus aureus nuc gene and its complementary DNA probe (nuc Seq. and nuc Probe 1) were purchased from Thermo Fisher Scientific (USA) (Table 1). Another pair of you can add also flouremeter complementary test DNA (CYP2C9 Seq.) and probe DNA (CYP2C9 probe) was also designed (Thermo Fisher Scientific -USA).

Table 1. Sequences of test DNA and probes used in this study.

Sequence name and description Sequence Modification Number of bases
nuc Seq. (Test DNA) GGTGTAGAGAAATATGGTCCTGAAGCAAGT None 30
nuc Probe 1 (probe DNA) CTAATCCGCACAG-ACTTGCTTCAGGACC NH2-C6 28
CYP2C9 Seq. (Test DNA) AGATACATTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAATTC None 71
CYP2C9 probe (Probe DNA) AGATAGTTTCTGAATTTAATGTCACAGGTCACTGCATGGGGCAGGCTGGTGGGGAGAAGG NH2-C6 71
Open in a new tab

2.2. Instrumentation

The surface morphology of the synthesized Au-NPs was analyzed using High-Resolution Transmission Electron Microscope (HRTEM), JEM 2100 HRT, Japan). Fluorescence was then measured using an Agilent Cary Eclipse Fluorescence Spectrometer (Agilent Technologies, USA).

3. Methods

3.1. Preparation of gold nanoparticles (AuNPs)

AuNPs were prepared by adding sodium citrate dihydrate (38.8 mM) to condensed HAuCl4 (10 mg mL−1) and leaving the mixture to condense with vigorous stirring for 20 minutes. AuNPs were then filtered with a 0.22 µm syringe filter in a bottle, covered from light, and stored in the refrigerator.18

3.2. Modification of gold nanoparticles using aryl diazonium salt

Modification of AuNPs with aryl diazonium salt enhances the binding of AuNPs to DNA. An aryl diazonium salt was prepared by dissolving 4-aminophenylacetic acid (the reagent) in a few drops of Tetrafluoroboric acid solution (HBF4). A sodium nitrite (NaNO2) solution was made, and all solutions were placed in an ice bath. The ratio between 4-aminophenylacetic to NaNO3 was 2 : 1. The NaNO2 solution was added to the reagent dropwise over 30 minutes, then it was left on the stirrer for another 30 minutes.

Aryl diazonium salt was used to modify AuNPs by adding 50 µL of aryl diazonium salt in a beaker with 4 mL of previously prepared AuNPs and then leaving it on the stirrer overnight. The next day, the solution was centrifuged at 8000 rpm for 10 minutes twice, then the pellets were dispersed in distilled water and stored in the refrigerator.19

3.3. Modification of gold nanoparticles using lipoic acid

Some of the AuNPs were modified using lipoic acid. 5 mL of Trisma buffer (pH 10.0) was added to 0.05 g of lipoic acid and 5 mL of AuNPs. The solution was left on a stirrer overnight at 220 rpm, then underwent three rounds of centrifugation at 4500 rpm for 10 minutes each. Finally, the pellets were redispersed in distilled water.20

3.4. DNA conjugation

Conjugation occurred by using EMC/NHS solution (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide/N-hydroxysuccinimide solution). This solution was made by dissolving 10 mM EDC and 10 mM NHS in 10 mL phosphate buffer (10 mM, pH 7.0). 300 µL of AuNPs (modified with lipoic acid) were added to this solution and left on a shaker for 2 hours. After that, 300 µL of the single-stranded DNA was added, vortexed, and then incubated in the fridge overnight.21

3.5. Fluorescence spectroscopy measurements

Samples were exciting at both 284 and 482 nm. Fluorescence intensities were monitored over the wavelength ranges 300–800 and 500–800 nm, respectively. The voltage was set to high voltage.

3.6. Fluorescence measurements using Arduino

A simple Arduino microcontroller was used to measure fluorescence for DNA detection without the need for expensive fluorescence spectroscopy and centralized laboratories. This device uses a one-wavelength Blue LED to excite the sample. The emission is measured by an RGB light sensor, and the results are transmitted through Arduino to a computer.

4. Results

4.1. Morphological and surface characterization of Au-NPs@g-C3N4

To evaluate the surface morphology the prepared Au-NPs, HRTEM was performed to investigate the internal structure and nanoscale features of Au NPs. As shown in Fig. 1A, Au NPs appear as uniformly distributed dark spots with particle size ∼4–7 nm. The TEM-selected area electron diffraction (SAED) pattern (Fig. 1B) exhibits distinct concentric diffraction rings confirming the polycrystalline nature of the Au NPs.

Fig. 1. TEM characterization of Au-NPs (A) selected area electron diffraction (SAED) patterns Au-NPs showing clear concentric rings confirming the polycrystalline nature of Au nanoparticles. (B) TEM image showing uniformly dispersed Au nanoparticles.

Fig. 1

Open in a new tab

4.2. Determination of the fluorescence spectrum intensity of ethidium bromide

Ethidium bromide (EtBr) is a fluorescent dye that binds to DNA by interacting between the nucleotide base pairs.22 We identified the specific characteristics of the fluorescence spectrum of EtBr. It showed emission when excited at 215, 284.06, and 482.98 nm. The emission intensity for EtBr was 639.65 and 147.06 a.u. when excited at 284 and 482 nm, respectively. The higher emission intensity recorded upon excitation at 284 nm (639.65 a.u.) compared to 482 nm (147.06 a.u.) is attributed to the substantially higher molar extinction coefficient of ethidium bromide in the ultraviolet region (ε285nm ≈ 5.0 − 10.0 × 104 M−1 cm−1) relative to its visible absorption band (ε480nm ≈ 5.6 − 6.0 × 103 M−1 cm−1) (Parodi et al., 1975). Although excitation at 284 nm populates higher electronic energy levels, rapid internal conversion (Sn → S1) according to Kasha's rule leads to relaxed fluorescence emission from the lowest excited singlet state, yielding greater overall fluorescence intensity driven by enhanced excitation light absorption (Fig. 2).23

Fig. 2. Ethidium bromide fluorescence emission peaks when excited at 284 nm (left) and 482 nm (right).

Fig. 2

Open in a new tab

4.3. Ethidium bromide fluorescence enhancement with gold nanoparticles

To determine whether AuNPs have the potential to enhance the fluorescence signal of EtBr, we measured the fluorescence intensity of ethidium bromide after adding AuNPs. Initially, AuNPs were excited at the same wavelengths at which EtBr gives emission (284 and 482 nm) to confirm that they do not emit at those wavelengths and will not interfere with further results investigated.

The enhancement potential was tested by comparing the emission of EtBr alone and in the presence of AuNPs in its three forms: unmodified AuNPs, lipoic acid-modified AuNPs, and aryl diazonium salt-modified AuNPs. The modified forms of AuNPs are expected to allow a greater distance between EtBr (the emitter) and AuNPs (the metal) than unmodified AuNP, which minimizes fluorescence intensity quenching, thereby increasing the signal.24

A signal enhancement was observed with AuNPs (Fig. 3), whereby the highest emission peak was increased by 4–5% when the ratio between EtBr and AUNPs was 2 : 1 and 9–10% when the ratio was 5 : 1. The emission of EtBr was found to be 693.65 and 147.06 a.u. when excited at 284 and 482 nm, respectively (Fig. 3). AuNPs were added to a final ratio between EtBr and AuNPs of 2 : 1. The fluorescence emission of EtBr and unmodified AuNPs was found to be 696.77 and 161.28 a.u. when excited at 284 and 482 nm, respectively. The fluorescence emission of EtBr and lipoic acid-modified AuNPs was found to be 713.20 and 161.05 a.u. when excited at 284 and 482, respectively. The fluorescence emission of EtBr and aryl diazonium salt-modified AuNPs was 722.18 and 165.93 a.u. when excited at 284 and 482 nm, respectively. The highest signal enhancement of EtBr fluorescence was observed with the addition of lipoic acid-modified AuNPs when used in both ratios 2 : 1 and 5 : 1.

Fig. 3. The impact of AuNPs on EtBr fluorescence intensity when measured at 284 nm (top) and 482 nm (bottom). Fluorescence signal intensity of EtBr alone (blue), and after the addition of unmodified AuNPs (red), lipoic acid-modified AuNPs (blue), and aryl diazonium salt-modified AuNPs (green). The ratio between EtBr and AuNPs in all samples was 2 : 1.

Fig. 3

Open in a new tab

To select the EtBr to AuNPs ratio that gives the best enhancement, we compared three different ratios of EtBr and lipoic acid-modified AuNPs– 1 : 1, 2 : 1, and 5 : 1 (Fig. 4). It was found that the best enhancement with lipoic acid-modified AuNPs was at 5 : 1, although enhancement was still observed with the 2 : 1 ratio as well. No enhancement was observed when the ratio between EtBr and AuNPs was 1 : 1.

Fig. 4. The effect of different ratios of EtBr to lipoic acid-modified AuNPs on the fluorescence intensity when measured at 284 nm (top) and 482 nm (bottom).

Fig. 4

Open in a new tab

Next, we compared different ratios of aryl diazonium salt-modified AuNPs (Fig. 4). The lowest fluorescence intensity was observed when the ratio between EtBr and AuNPs was 2 : 1, which was lower than EtBr alone. The 5 : 1 ratio showed a 4% enhancement in EtBr fluorescence intensity. The fluorescence intensity of EtBr alone was 693.65 and 161.28 a.u. when excited at 284 and 482 nm, respectively. The fluorescence intensity for the ratio 2 : 1 was 656.02 and 138.38 a.u. when excited at 284 and 482 nm, respectively. The intensity for the 5 : 1 ratio was 726.45 and 168.8 a.u. at 284 and 482 nm, respectively (Fig. 5).

Fig. 5. The effect of different ratios (2 : 1 and 5 : 1) of EtBr to aryl diazonium salt-modified AuNPs on fluorescence intensity when measured at 284 nm (top) and 482 nm (bottom).

Fig. 5

Open in a new tab

4.4. Detection of Staphylococcus aureus-specific DNA by EtBr/AuNPs

We sought to use the fluorescence intensity of EtBr/AuNPs to detect Staphylococcus aureus-specific DNA using a ssDNA probe complementary to a sequence in the nuc gene. The detection of DNA was performed relying on the fact that the fluorescence intensity of EtBr increases in the presence of dsDNA. EtBr binds to DNA by intermolecular interactions between nitrogen bases in DNA, and the intermolecular binding is known to be stronger with dsDNA than with ssDNA.25 DNA was detected by measuring the difference between the fluorescence intensity in the presence of the ssDNA sequence and the fluorescence intensity when the DNA probe was added.

To optimize the detection procedure, the fluorescence intensity of EtBr/AuNPs samples was measured three times at each excitation wavelength (Fig. 6). The fluorescence intensity increased by 7.4% and 4% at the excitation wavelengths 284 nm and 482 nm, respectively, in the presence of test DNA. The fluorescence intensity for the sample containing EtBr, AuNPs, and probe DNA was found to be 743.25 and 161.40 a.u. when excited at 284 and 482 nm, respectively. After the addition of nuc sequence xtest DNA, the fluorescence intensity became 802.60 and 168.14 a.u. when excited at 284 and 482 nm, respectively.

Fig. 6. Detection of DNA by comparing the differences in fluorescence intensities in the absence and presence of the test DNA when measured at 284 nm (top) and 482 nm (bottom). Fluorescence intensity was measured in the presence of EtBr and AuNPs alone (blue), when the DNA probe was added (red), and when the complementary (test) DNA was added (green).

Fig. 6

Open in a new tab

Next, we sought to ensure that the increase in the fluorescence intensity was due to binding of the test DNA strand forming double-stranded DNA and not due to the increase in DNA concentration. We compared fluorescence intensity after adding different concentrations of ssDNA and dsDNA (Fig. 7). It was found that increasing DNA concentration resulted in a proportional increase in fluorescence intensity, but the increase was more pronounced with dsDNA than ssDNA when comparing the same total DNA concentration.

Fig. 7. Increase in fluorescence intensity of EtBr in the presence of lipoic acid-modified AuNPs with the increase in DNA concentration in the case of ssDNA and dsDNA measured at 284 nm (left) and 482 nm (right).

Fig. 7

Open in a new tab

4.5. Determination of assay limit of detection (LOD)

The limit of detection (LOD) of this method was determined by measuring the fluorescence intensity of EtBr in the presence of lipoic acid-modified AuNPs and different amounts of DNA. Serial dilutions of test DNA were prepared (3.2 µg, 1.6 µg, 0.8 µg, 0.4 µg, 0.2 µg), and fluorescence intensity was measured in the presence of EtBr, lipoic acid-modified AuNPs, and probe DNA. The lowest detectable amount of test DNA was 0.4 µg (Fig. 8) when the sample was excited at 284 nm.

Fig. 8. Determination of the lowest detectable amount of test DNA (LOD) using the complementary DNA probe in the presence of EtBr and lipoic acid-modified AuNPs.

Fig. 8

Open in a new tab

4.6. Effect of DNA conjugation on fluorescence intensity and DNA detection

A single-stranded DNA (probe DNA, Table 1) was conjugated to gold nanoparticles using EMC/NHS in phosphate buffer. Conjugation was done to assess whether it would help enhance the fluorescence intensity of EtBr. EtBr was added to the probe DNA that was conjugated to lipoic acid-modified AuNPs. The fluorescence intensity was 237 and 166 a.u. when excited at 284 and 482 nm, respectively. When an equal amount of the test DNA was added, the fluorescence intensity was found to be 246 and 173 a.u. when excited at 284 and 482 nm, respectively (Fig. 9). The increase in fluorescence was only 3–5%. This could be due to quenching by the buffer used in conjugation, since when comparing the intensity of equivalent DNA amounts (3.2 µg) without conjugation, the fluorescence peak was higher (802.6 and 168.16 a.u. when excited at 284 and 482 nm, respectively) (Fig. 10).

Fig. 9. DNA Detection using ssDNA probe conjugated with AuNPs.

Fig. 9

Open in a new tab

Fig. 10. The effect of DNA conjugation to AuNPs on the fluorescence signal intensity of EtBr.

Fig. 10

Open in a new tab

4.7. Effect of dibasic sodium phosphate buffer on the fluorescence intensity of EtBr

The effect of each of distilled water and phosphate buffer (10 mM disodium hydrogen phosphate dihydrate buffer, pH 7.0), which is commonly used in DNA conjugation to AuNPs,21 on the fluorescence intensity of EtBr was tested. The fluorescence intensity of the sample containing EtBr, lipoic acid-modified AuNPs, and dsDNA dissolved in distilled water was 772 when excited at 284 nm. However, the fluorescence intensity was suppressed to 558 at 284 nm when the same components were dissolved in phosphate buffer (Fig. 11).

Fig. 11. The effect of phosphate buffer vs. distilled water on the fluorescence of a sample that contained the same quantities of EtBr, lipoic acid-modified AuNPs, and dsDNA.

Fig. 11

Open in a new tab

4.8. Fluorescence measurements using Arduino microcontroller

An Arduino microcontroller was used for fluorescence detection using a blue LED that excites the sample at 450 nm giving an emission that is measured by a RGB light sensor.

4.9. Statistical analysis of fluorescence enhancement and DNA detection

To evaluate the performance of the MEF system using EtBr and AuNPs, fluorescence measurements were conducted across various DNA concentrations (0.2–3.2 µg), nanoparticle surface modifications, and DNA forms (ssDNA vs. dsDNA). Excitation was performed at two key wavelengths: 284 nm and 482 nm.

4.9.1. Comparison of fluorescence between ssDNA and dsDNA

Across nearly all conditions, dsDNA induced a greater enhancement in EtBr fluorescence than ssDNA, confirming more efficient intercalation and signal amplification.

• At 0.8 µg DNA, lipoic acid-modified AuNPs showed the following differences (dsDNA–ssDNA):

✓ 284 nm: +15.03, +13.38, +14.76 → mean = +14.39 ± 0.83 a.u.

✓ 482 nm: +6.04, −0.26, +5.95 → mean = +3.91 ± 3.18 a.u.

• At the same 0.8 µg DNA concentration, diazonium-modified AuNPs showed:

✓ 284 nm: +17.60, +14.76, +13.08 → mean = +15.15 ± 2.31 a.u.

✓ 482 nm: −1.86, −8.89, +2.05 → mean = −2.90 ± 5.66 a.u.

The results indicate that lipoic acid modification was more consistent for fluorescence enhancement, especially at 482 nm, while diazonium salt modification showed erratic performance at this wavelength.

4.9.2. Effect of DNA concentration on fluorescence intensity

Using lipoic acid-modified AuNPs, fluorescence intensity increased with higher dsDNA concentration at 284 nm:

DNA amount (µg) Fluorescence difference (dsDNA–ssDNA, 284 nm)
0.2 µg +3.4 a.u.
0.4 µg −6.03 a.u.
0.8 µg +10.16 a.u.
1.6 µg +59.35 a.u.
3.2 µg +71.86 a.u.
Open in a new tab

At 482 nm, the signal also increased with DNA concentration, although to a lesser extent:

DNA amount (µg) Fluorescence difference (dsDNA–ssDNA, 482 nm)
0.2 µg −1.7 a.u.
0.4 µg +0.38 a.u.
0.8 µg 0.00 a.u.
1.6 µg +6.76 a.u.
Open in a new tab

These data support the hypothesis that EtBr fluorescence enhancement is more pronounced with dsDNA and increases proportionally with concentration above 0.8 µg for 482 nm wavelength and concentration above 0.4 µg for 284 nm wavelength.

4.9.3. Standard deviations across conditions

The reproducibility of fluorescence signals was assessed via standard deviation calculations from replicate experiments under various conditions:

Sample condition 284 nm SD 482 nm SD
EtBr only 0.83 2.20
EtBr + AuNP (unmodified) 1.29 2.34
EtBr + AuNP (unmodified) + ssDNA 3.36 3.80
EtBr + AuNP (unmodified) + dsDNA 1.05 4.96
EtBr + AuNP (lipoic acid) 3.45 2.37
EtBr + AuNP (lipoic acid) + ssDNA 2.01 3.25
EtBr + AuNP (lipoic acid) + dsDNA 1.38 21.52
EtBr + AuNP (diazonium) + ssDNA 0.26 1.81
EtBr + AuNP (diazonium) + dsDNA 2.04 2.04
Open in a new tab

The highest variability was found in lipoic acid-modified AuNPs with dsDNA at 482 nm.

5. Discussion

The integration of MEF into DNA detection platforms presents a significant advancement in molecular diagnostics due to its high sensitivity and simplicity of operation.26 This study evaluated the efficacy of gold nanoparticles (AuNPs), modified with either lipoic acid or aryl diazonium salt, to enhance the fluorescence signal of ethidium bromide (EtBr) during DNA hybridization. Gold nanoparticles are well recognized for their biocompatibility and strong optical properties, making them ideal candidates for fluorescence amplification in biosensing systems.27

EtBr was selected as the fluorophore because of its classical and well-documented ability to intercalate with double-stranded DNA (dsDNA), resulting in increased fluorescence intensity.28 When intercalated between base pairs, EtBr experiences restricted rotation and a more hydrophobic environment, which enhances its quantum yield.28 In our study, this enhancement was significantly increased by proximity to AuNPs, consistent with the MEF effect reported in previous literature.29

Fluorescence enhancement was particularly evident when using lipoic acid-modified AuNPs compared to aryl diazonium salt-modified or unmodified AuNPs. This can be attributed to the improved surface chemistry and spacing provided by lipoic acid, which prevents direct quenching of the fluorophore and promotes optimal fluorophore-metal distance for maximum signal.30 Previous studies have shown that this intermediate separation (typically 5–10 nm) enables constructive plasmonic interactions that amplify emission without energy transfer quenching.30

A dose-dependent increase in fluorescence intensity was observed with rising dsDNA concentrations at both 284 nm and 482 nm excitation wavelengths. However, the enhancement was more prominent at 284 nm, indicating this wavelength is more favorable for the excitation of EtBr in the presence of AuNPs. This aligns with earlier work demonstrating higher quantum yields of EtBr at shorter UV wavelengths, where energy absorption is greater and scattering effects are minimal.28

The comparison between single-stranded DNA (ssDNA) and dsDNA confirmed that dsDNA leads to higher fluorescence enhancement. This is consistent with the higher binding affinity of EtBr to dsDNA and the intercalative mechanism being ineffective with ssDNA due to the lack of stacked base pairs.28 Consequently, fluorescence intensity served as a reliable indicator of hybridization events between test DNA and probe DNA.

Despite the observed enhancement, some variability in signal output was noted, particularly in the lipoic acid-AuNP + dsDNA system at 482 nm. This could be due to structural interactions or dynamic conformational changes in the DNA-AuNP-EB complex that affect fluorescence stability.31 Such variability is not uncommon in MEF systems and has been attributed to fluctuations in local dielectric environments or nanoparticle aggregation.32

Conjugation of the probe DNA to AuNPs using EDC/NHS chemistry in phosphate buffer did not significantly enhance fluorescence intensity. On the contrary, the signal was lower compared to unconjugated systems. This may be explained by the fluorescence-quenching effect of phosphate buffer, which was clearly demonstrated by the ∼28% suppression in fluorescence intensity observed when EtBr/AuNP/DNA samples were dissolved in phosphate buffer instead of distilled water33 Phosphate ions are known to interfere with fluorophore activity by altering ionic strength and promoting energy dissipation pathways.33

Taken together, the results of this study demonstrate the practicality of combining MEF with classical fluorophores such as EtBr for nucleic acid detection. The optimal performance was achieved using lipoic acid-modified AuNPs with unbound DNA in distilled water, at excitation of 284 nm. The detection sensitivity reached as low as 0.4 µg of DNA, suggesting this system could serve as a low-cost and rapid alternative to conventional diagnostic tools.

6. Conclusion

This study demonstrates the potential of a MEF platform utilizing EtBr and surface-modified AuNPs for sensitive and rapid DNA detection. Among the tested systems, lipoic acid-modified AuNPs showed the most consistent and significant enhancement of EtBr fluorescence, particularly in the presence of double-stranded DNA. The method achieved a detection limit as low as 0.4 µg, with higher fluorescence intensities correlating with increased DNA concentrations, confirming its quantitative capabilities. Moreover, excitation at 284 nm proved superior to 482 nm for signal generation, and distilled water was shown to be a more favorable solvent than phosphate buffer due to fluorescence quenching effects. While conjugation of DNA probes to AuNPs introduced some signal suppression, the overall platform remains promising for the development of cost-effective, portable, and label-free diagnostic tools. Future improvements could focus on optimizing surface chemistry and minimizing background variability to enhance signal reliability for real-world applications.

Conflicts of interest

There are no conflicts to declare.

Data availability

The authors confirm that all primary data necessary to evaluate the conclusions of this work are presented entirely within the main text, figures, and tables of this article.

References

  1. Lee L. S. Poneros J. M. New frontiers in endoscopic imaging. Gastrointest. Endosc. Clin. N. Am. 2005;15(3):631–651. doi: 10.1016/j.giec.2005.04.006. [DOI] [PubMed] [Google Scholar]
  2. Silvius J. R., Fluorescence spectroscopy [Lecture notes, BIOC 404 Biophysical Chemistry], Department of Biochemistry, McGill University, 2009, https://www.mcgill.ca/biochemistry/files/biochemistry/404_silvius_09.pdf [Google Scholar]
  3. Nath P. Mahtaba K. R. Ray A. Fluorescence-Based Portable Assays for Detection of Biological and Chemical Analytes. Sensors. 2023;23(11):5053. doi: 10.3390/s23115053. https://dx.doi.org/10.3390/S23115053 [DOI] [Google Scholar]
  4. Aslan K. Gryczynski I. Malicka J. Matveeva E. Lakowicz J. R. Geddes C. D. Metal-enhanced fluorescence: an emerging tool in biotechnology. Curr. Opin. Biotechnol. 2005;16(1):55. doi: 10.1016/j.copbio.2005.01.001. https://dx.doi.org/10.1016/J.COPBIO.2005.01.001 [DOI] [Google Scholar]
  5. Ray K. Lakowicz J. R. Metal-Enhanced Fluorescence Lifetime Imaging and Spectroscopy on a Modified SERS Substrate. J. Phys. Chem. C. 2013;117(30):15790–15797. doi: 10.1021/jp404590j. [DOI] [Google Scholar]
  6. Gryczynski Z. Malicka J. Gryczynski I. Matveeva E. Geddes C. D. Aslan K. et al., Metal-Enhanced Fluorescence: A Novel Approach to Ultra-Sensitive Fluorescence Sensing Assay Platforms. Proc. SPIE – Int. Soc. Opt. Eng. 2004;5321(275):275. doi: 10.1117/12.530072. [DOI] [Google Scholar]
  7. Dorsey J. F. Sun L. Joh D. Y. Witztum A. Zaki A. A. Kao G. D. et al., Gold nanoparticles in radiation research: potential applications for imaging and radiosensitization. Transl. Cancer Res. 2013;2(4):280–291. doi: 10.3978/J.ISSN.2218-676X.2013.08.09. [DOI] [Google Scholar]
  8. Oliveira B. B. Ferreira D. Fernandes A. R. Baptista P. V. Engineering gold nanoparticles for molecular diagnostics and biosensing. Wiley Interdiscip. Rev.:Nanomed. Nanobiotechnol. 2023;15(1):e1836. doi: 10.1002/WNAN.1836. [DOI] [Google Scholar]
  9. Chang C. C. Chen C. P. Wu T. H. Yang C. H. Lin C. W. Chen C. Y. Gold Nanoparticle-Based Colorimetric Strategies for Chemical and Biological Sensing Applications. Nanomaterials. 2019;9(6):861. doi: 10.3390/nano9060861. https://dx.doi.org/10.3390/NANO9060861 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. madkour E. Abou Zeid A. Abdel G. S. Alshehrei F. M. EL- Ghareeb D. Abdel-Hakeem M. Sensitive and selective colorimetric detection of Staphylococcus aureus-SPA gene by engineered gold nanosensor. Saudi J. Biol. Sci. 2023;30(2):103559. doi: 10.1016/j.sjbs.2023.103559. https://dx.doi.org/10.1016/J.SJBS.2023.103559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ethidium Bromide|Thermo Fisher Scientific – EG, [Internet], [cited 2025 Aug 2], available from: https://www.thermofisher.com/eg/en/home/life-science/dna-rna-purification-analysis/nucleic-acid-gel-electrophoresis/dna-stains/etbr.html?utm_source=chatgpt.com
  12. Yuan Z. Hu C. C. Chang H. T. Lu C. Gold nanoparticles as sensitive optical probes. Analyst. 2016;141(5):1611–1626. doi: 10.1039/C5AN02651B. [DOI] [PubMed] [Google Scholar]
  13. Kao K., Kohli M., Gautam J., Kassa H., Acellam S. and Ndungu J., et al., Strengthening health systems through essential diagnostic lists and diagnostic network optimization. PLOS Global Public Health, Public Library of Science, 2023, 10.1371/journal.pgph.0001773 [DOI] [Google Scholar]
  14. Peeling R. W. Mabey D. Point-of-care tests for diagnosing infections in the developing world. Clin. Microbiol. Infect. 2010;16(8):1062–1069. doi: 10.1111/j.1469-0691.2010.03279.x. [DOI] [PubMed] [Google Scholar]
  15. Craw P. Balachandran W. Isothermal nucleic acid amplification technologies for point-of-care diagnostics: a critical review. Lab Chip. 2012;12(14):2469–2486. doi: 10.1039/C2LC40100B. [DOI] [PubMed] [Google Scholar]
  16. Chen F. Fu X. Meng Y. Jiang M. Wang J. Zhou Y. L. et al., A novel miniaturized homogeneous label-free electrochemical biosensing platform combining integrated microelectrode and functional nucleic acids. Anal. Chim. Acta. 2021;1158:338415. doi: 10.1016/j.aca.2021.338415. https://dx.doi.org/10.1016/J.ACA.2021.338415 [DOI] [Google Scholar]
  17. Aslan K. Gryczynski I. Malicka J. Matveeva E. Lakowicz J. R. Geddes C. D. Metal-enhanced fluorescence: an emerging tool in biotechnology. Curr. Opin. Biotechnol. 2005;16(1):55. doi: 10.1016/j.copbio.2005.01.001. https://dx.doi.org/10.1016/J.COPBIO.2005.01.001 [DOI] [Google Scholar]
  18. Taton T. A. Preparation of Gold Nanoparticle–DNA Conjugates. Curr. Protoc. Nucleic Acid Chem. 2002;9(1) doi: 10.1002/0471142700.nc1202s09. [DOI] [Google Scholar]
  19. Cohen T. Dietz A. G. Miser J. R. A Simple Preparation of Phenols from Diazonium ions via the Generation and Oxidation of Aryl Radicals by Copper Salts. J. Org. Chem. 1977;42(12):2053–2058. doi: 10.1021/jo00432a003. https://dx.doi.org/10.1021/JO00432A003/ASSET/JO00432A003.FP.PNG_V03 [DOI] [Google Scholar]
  20. Ghann W. Harris T. Kabir D. Kang H. Jiru M. Rahman M. M. et al., Lipoic Acid Decorated Gold Nanoparticles and Their Application in the Detection of Lead Ions. J. Nanomed. Nanotechnol. 2019;10(6):539. doi: 10.35248/2157-7439.19.10.539. [DOI] [Google Scholar]
  21. Al-Ghobashy M. A. Nadim A. H. El-Sayed G. M. Nebsen M. Label-free potentiometric ion flux immunosensor for determination of recombinant human myelin basic protein: Application to downstream purification from transgenic milk. ACS Sens. 2019;4(2):413–420. doi: 10.1021/acssensors.8b01315. [DOI] [PubMed] [Google Scholar]
  22. Hogan K., Principles and Techniques of Molecular Biology, Foundations of Anesthesia: Basic Sciences for Clinical Practice, 2005, pp. 51–69, 10.1016/B978-0-323-03707-5.50010-3 [DOI] [Google Scholar]
  23. Parodi S. Kendall F. Nicolini C. A clarification of the complex spectrum observed with the ultraviolet circular dichroism of ethidium bromide bound to DNA. Nucleic Acids Res. 1975:477–486. doi: 10.1093/nar/2.4.477. [DOI] [Google Scholar]
  24. Pawar S. Bhattacharya A. Nag A. Metal-Enhanced Fluorescence Study in Aqueous Medium by Coupling Gold Nanoparticles and Fluorophores Using a Bilayer Vesicle Platform. ACS Omega. 2019;4(3):5983–5990. doi: 10.1021/acsomega.9b00036. https://dx.doi.org/10.1021/ACSOMEGA.9B00036/ASSET/IMAGES/LARGE/AO-2019-000365_0007.JPEG [DOI] [Google Scholar]
  25. Vardevanyan P. O. Antonyan A. P. Parsadanyan M. A. Davtyan H. G. Karapetyan A. T. The binding of ethidium bromide with DNA: interaction with single- and double-stranded structures. Exp. Mol. Med. 2003;35:527–533. doi: 10.1038/emm.2003.68. [DOI] [Google Scholar]
  26. Xiao R. Lu L. Rong Z. Wang C. Peng Y. Wang F. et al., Portable and multiplexed lateral flow immunoassay reader based on SERS for highly sensitive point-of-care testing. Biosens. Bioelectron. 2020;168:112524. doi: 10.1016/j.bios.2020.112524. https://dx.doi.org/10.1016/J.BIOS.2020.112524 [DOI] [Google Scholar]
  27. Stegle O. Parts L. Piipari M. Winn J. Durbin R. Using probabilistic estimation of expression residuals (PEER) to obtain increased power and interpretability of gene expression analyses. Nat. Protoc. 2012;7(3):500. doi: 10.1038/nprot.2011.457. https://dx.doi.org/10.1038/NPROT.2011.457 [DOI] [Google Scholar]
  28. Lepecq J. B. Paoletti C. A fluorescent complex between ethidium bromide and nucleic acids: Physical—Chemical characterization. J. Mol. Biol. 1967;27(1):87–106. doi: 10.1016/0022-2836(67)90353-1. [DOI] [Google Scholar]
  29. Aslan K. Gryczynski I. Malicka J. Matveeva E. Lakowicz J. R. Geddes C. D. Metal-enhanced fluorescence: an emerging tool in biotechnology. Curr. Opin. Biotechnol. 2005;16(1):55. doi: 10.1016/j.copbio.2005.01.001. https://dx.doi.org/10.1016/J.COPBIO.2005.01.001 [DOI] [Google Scholar]
  30. Dulkeith E. Morteani A. C. Niedereichholz T. Klar T. A. Feldmann J. Levi S. A. et al., Fluorescence Quenching of Dye Molecules near Gold Nanoparticles: Radiative and Nonradiative Effects. Phys. Rev. Lett. 2002;89(20):203002. doi: 10.1103/PhysRevLett.89.203002. [DOI] [Google Scholar]
  31. Pawar S. Bhattacharya A. Nag A. Metal-Enhanced Fluorescence Study in Aqueous Medium by Coupling Gold Nanoparticles and Fluorophores Using a Bilayer Vesicle Platform. ACS Omega. 2019;4(3):5983–5990. doi: 10.1021/acsomega.9b00036. https://dx.doi.org/10.1021/ACSOMEGA.9B00036 [DOI] [Google Scholar]
  32. Gao X. Yang L. Petros J. A. Marshall F. F. Simons J. W. Nie S. In vivo molecular and cellular imaging with quantum dots. Curr. Opin. Biotechnol. 2005;16(1):63–72. doi: 10.1016/j.copbio.2004.11.003. https://dx.doi.org/10.1016/J.COPBIO.2004.11.003 [DOI] [PubMed] [Google Scholar]
  33. Kürkçüoǧlu G. S. Çetinkaya F. Arslan T. A theoretical study on the molecular structure and vibrational (FT-IR and Raman) spectra of cyano-bridged heteronuclear polymeric complex of triethylenetetramine. Spectrochim. Acta, Part A. 2012;94:110–118. doi: 10.1016/j.saa.2012.03.011. https://dx.doi.org/10.1016/J.SAA.2012.03.011 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The authors confirm that all primary data necessary to evaluate the conclusions of this work are presented entirely within the main text, figures, and tables of this article.

Articles from RSC Advances are provided here courtesy of Royal Society of Chemistry

RESOURCES