Inhibitory effect of Acetylshikonin on drug-resistant Candida albicans

Abstract

Background

Candida albicans (C. albicans) is among the most common opportunistic fungal pathogens and causes superficial infections and life-threatening invasive candidiasis in immunocompromised individuals. In recent years, C. albicans has become resistant to a wide range of clinical drugs, and the identification of effective antifungal drugs is an extremely urgent medical need. Acetylshikonin (ASK) is a naphthoquinone compound extracted from Lithospermum erythrorhizon that exhibits potent antibacterial activity. However, its efficacy against C. albicans and antimicrobial mechanisms, especially against drug-resistant C. albicans, are unclear.

Materials and methods

The antifungal activity of ASK was evaluated based on minimal inhibitory concentration (MIC) and minimal fungicidal concentration (MFC) measured in vitro and in mouse models of vulvovaginal candidiasis and oropharyngeal candidiasis to assess its efficacy in vivo. Mechanistic investigations included assessments of cell membrane and cell wall damage, adhesion ability, oxidative stress evaluation, protein expression, and target identification (including RT‒qPCR, molecular docking, and related methods).

Results

The main active ingredient from Lithospermum erythrorhizon that targets C. albicans was identified as ASK. It exhibits significant activity against drug-resistant fungi both in vitro and in vivo. Moreover, ASK can reduce the adhesion of C. albicans and damage to cell membrane and cell wall and induce apoptosis-like cell death-like cell death. In addition, ASK may directly bind to Malate Synthase 1 (Mls1) and effectively downregulate its expression and inhibit the glyoxylate cycle, leading to the generation and accumulation of large amounts of ROS, and damage to DNA to achieve its antifungal effects.

Conclusion

ASK can treatment drug-resistant C. albicans infections, its mechanism of action is related to the inhibition of Mls1.

Graphical abstract

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s13099-026-00851-3.

Introduction

Fungal infections are the leading cause of deaths related to infectious diseases worldwide, with Candida albicans (C. albicans) infections being the primary aetiological agent of invasive candidiasis [1]. Invasive fungal infections present a serious threat to human health [2], accounting for at least 1.5 million global deaths annually with mortality rates ranging from 30 to 40% [3]. Over the past few decades, immunocompromised populations in particular have faced an increased risk of systemic fungal infections [4]. Currently, the main antifungal drugs used in the clinic are azoles, polyenes, and echinocandins [5]. Nevertheless, these agents have notable limitations: they cause adverse effects such as nephrotoxicity and hepatotoxicity, and their prolonged and widespread use has further exacerbated drug resistance in C. albicans, as well as a consequent reduction in therapeutic efficacy [6]. Consequently, the development of more efficacious drugs for the treatment of C. albicans infections is imperative.

Natural products are a common source for screening antifungal drugs. Acetylshikonin (ASK) is a naphthoquinone compound isolated from Lithospermum erythrorhizon [7], which has various bioactivities, including antitumour [8], anti-inflammatory, antimicrobial, and hypolipidaemic effects [9]. It inhibits Gram-positive bacteria (e.g., Staphylococcus aureus and Bacillus megaterium) and Gram-negative bacteria (e.g., Escherichia coli, Pseudomonas aeruginosa, and Yersinia intermedia). In addition, ASK exerts antibacterial effects by inhibiting the trypsin-like protease and glycosidase activities of Porphyromonas gingivalis [10]. Although ASK has a wide range of antibacterial and antifungal effects, its inhibitory effect on of ASK and underlying mechanism against C. albicans remain unclear.

Recently, the glyoxylate cycle (GC) has attracted attention as an antifungal target. The GC enables pathogenic fungi to utilize ethanol and acetate as the sole carbon source and is essential for fungal growth, development and virulence. Isocitrate lyase (Icl1) and malate synthase (Mls1) are key enzymes in the GC [11]. Deletion of Icl1 and Mls1 in C. albicans results in markedly diminished virulence and persistence relative to wild-type controls during systemic candidiasis in mice [12], thus demonstrating that Icl1 and Mls1 are indispensable for C. albicans infection. Since this metabolic pathway is absent in mammalian cells [13, 14], it could be a promising and specific target for antifungal drugs.

Currently, novel antifungal drug discovery is focused on drug targets, and if new targets related to the GC are identified, they will provide a new area for the development of novel antifungal drugs. This study aims to elucidate the effects and mechanism by which ASK inhibits the growth of drug-resistant C. albicans, thereby providing theoretical and experimental foundations for the treatment of drug-resistant C. albicans.

Materials and methods

Recovery and culture of strains

A total of seven C. albicans strains were used, with six strains (BHKS393, BHKS473, BHKS474, BHKS475, BHKS476, and BHKS477) generously provided by Professor Bi Hongkai of Nanjing Medical University. Additionally, a standard C. albicans strain was purchased from the Guangdong Microbial Culture Collection Center. After the C. albicans strains were stored at −80 °C, they were inoculated on ssss (SDA) at 37 °C for 48 h. Sabouraud dextrose broth (SDB) medium was used to culture and maintain the C. albicans. The medium consisted of 1.0% peptone and 4.0% glucose. Candida tropicalis, Escherichia coli, Staphylococcus haemolyticus, Acinetobacter baumannii, Helicobacter plori and Proteus mirabilis were provided by the Microbial Drug Resistance Prevention and Control Center of Youjiang Medical College for Nationalities.

Drugs

ASK (Refins, Chengdu, China) and itraconazole (ITZ; Mackin, Shanghai, China) were dissolved in dimethyl sulfoxide to 4 mg/mL, fluconazole (FLC; Mackin, Shanghai, China) and 5-fluorocytosine (5-FC; Mackin, Shanghai, China) were dissolved in anhydrous ethanol to 4 mg/mL (Table 1 and Fig. S1 in the Supplementary Material).

Table 1.

Information on the compounds

Drug	Brand	CAS	Purity
Shikonin	Chengdu Herpurify Co.,Ltd	517-89−5	> 97%
Lithospermoside	Chengdu Herpurify Co.,Ltd	63492-69−3	> 97%
β, β-Dimethylacrylshikonin	Chengdu Herpurify Co.,Ltd	24502-79−2	> 97%
β, β-Dimethylacrylalkannin	Chengdu Herpurify Co.,Ltd	34539-65−6	> 97%
Lithospermic acid	Chengdu Herpurify Co.,Ltd	28831-65−4	> 97%
β-Acetoxyisovalerylshikonin	Chengdu Herpurify Co.,Ltd	69091-17−4	> 97%
Isobutyrylshikonin	Chengdu Herpurify Co.,Ltd	52438-12−7	> 97%
ASK	Chengdu Herpurify Co.,Ltd	24502-78−1	> 97%
Deoxyshikonin	Chengdu Herpurify Co.,Ltd	43043-74−9	> 97%
FLC	Macklin	86386-73−4	98%
ITZ	Macklin	84625-61−6	98%
5-FC	Macklin	2022-85−7	99%

Evaluation of the efficacy of ASK

Determination of the MIC, EC₅₀ and EC₉₀

A 96-well polystyrene plate was sterilized, and 100 µL of medium supplemented with drugs was added to each well. The concentrations of the drug solutions were set to range from 1 to 128 µg/mL through serial twofold dilutions, and 10 µL of the bacterial or fungal suspension was added to each well. The fungal suspension was adjusted to an OD₆₀₀ of 0.5, which is equivalent to 5 × 10⁶ CFU/mL, and diluted to a final working concentration of 1 × 10² CFU/mL. The bacterial suspension was adjusted to an OD₆₀₀ of 0.3, which is equivalent to 1 × 10⁸ CFU/mL, and then diluted to a final working concentration of 1 × 10⁵ CFU/mL. The negative wells (with medium and drugs) and positive wells (with medium and fungi or bacteria) were used as controls, and the wells were incubated at 37° C for 48 h. The minimal inhibitory concentration (MIC) was determined by visual inspection and defined as the lowest drug concentration that inhibited visible microbial growth. The median effective concentration (EC₅₀) and 90% effective concentration (EC₉₀) of the inhibitory effect of ASK on C. albicans were determined using GraphPad Prism 9.0. The experiment was repeated three times.

Determination of the MFC

The minimum fungicidal concentration (MFC) was measured using the liquid dilution coating method. A C. albicans suspension was formulated at 5 × 10⁶ CFU/mL, and different concentrations of ASK were added, AmB was used as a positive control. The fungal suspension was incubated at 37 ℃ and 200 rpm. At 2, 4, 8, 12, 16, 24 and 48 h, the fungal solution was diluted 10-fold, 100-fold and 1000-fold, and 100 µL of the diluted suspension was spread onto SDA plates, which were then incubated at 37 ℃ for 48 h. The MFC was defined as the lowest drug concentration that achieved a 99.9% reduction in fungal colony counts. It was determined by enumerating fungal colonies on SDA after drug exposure.

Assessment of drug resistance

A C. albicans suspension was formulated at 1 × 10² CFU/mL and the drug was cocultured with C. albicans at 1/4 MIC. The MIC was measured every 3 days for 30 days, and FLC was used as a positive control.

Analysis of the antifungal effects of ASK in combination with other compounds

The drug-containing medium was serially diluted horizontally and vertically, and 10 µL of fungal solution (1 × 10² CFU/mL) was added to each well and incubated for 48 h. The partial inhibitory concentration (FIC) was calculated using the following formula:

FIC = (Compound A combined MIC)/(Compound A alone MIC) + (Compound B combined MIC)/(Compound B alone MIC).

where an FIC index ≤ 0.5 indicates a synergistic effect; 0.5 < FIC index ≤ 1 indicates an additive effect; 1 < FIC index < 2 indicates an irrelevant effect; and FIC index ≥ 2 indicates an antagonistic effect.

Establishment of a C. albicans-infected mouse model

Female C57BL/6 mice (6–8-week-old specific pathogen free) were acquired from Changsha Tianqin Biological Co. Ltd. All animal experiments were approved by the Institutional Review Board of the Right River College of Ethnic Medicine (Baise, Guangxi, China), and conducted in accordance with the Animal Welfare Standards and Institutional Guidelines (Ethics in Animal Experimentation No. 2023071101).

Mouse model of oral candidiasis induced by C. albicans

The C. albicans suspension was formulated at 1 × 10⁷ CFU/mL [15]. Since immunocompetent mice are not typically colonized by C. albicans under normal conditions, mice were administered subcutaneous injections of 0.2 mL of hydrocortisone sodium succinate (225 mg/kg) to increase their susceptibility to C. albicans infection. One day prior to infection with C. albicans, the mice were provided drinking water supplemented with 0.83 mg/mL tetracycline hydrochloride. This supplementation was continued for three consecutive days and persisted until the end of the experiment. On the day of the C. albicans infection, the mice were anaesthetized with 0.2 mL of tribromoethanol (1.25%) via intraperitoneal injection, and a cotton ball soaked with a C. albicans suspension was placed in the oral cavity of the mice and remained in place for 30 min, this procedure was performed on two consecutive days. After successful infection with C. albicans, 24 mice were randomly divided into four groups for treatment (n = 6): the FLC group (10 mg/kg), the low-dose ASK group (2.5 mg/kg), the high-dose ASK group (10 mg/kg), and the untreated group. We infiltrated 200 µL of the drug into cotton balls, which were inserted into the oral cavity of the mice and left in place for at least 30 min, this procedure was repeated for four days. On the second day after drug treatment, the mice were euthanized by decapitation. Half of the tongue tissue was removed, weighed, homogenized, diluted, and incubated on SDA plates supplemented with 0.05% chloramphenicol at 37 °C for 48 h, after which the amount of fungi colonizing the tissue was calculated [16]. The other half of the tongue tissue was processed for haematoxylin and eosin (H&E) staining, periodic acid–Schiff (PAS) staining, TUNEL staining, and immunofluorescence staining of pathological sections and were quantified using ImageJ software.

Mouse model of vulvovaginal candidiasis induced by C. albicans

A suspension of C. albicans was formulated at 1 × 107 CFU/mL, and the mice were administered 0.2 mL of hydrocortisone sodium succinate (225 mg/kg) and 0.2 mL of oestradiol benzoate (2 mg/mL). Using the method described above, the mice were anaesthetized and infected with C. albicans in the vagina for three consecutive days. After the mouse model was established, vaginal irrigation was performed every other day using 500 µL of PBS. The irrigation fluid was then inoculated onto SDA plates supplemented with 0.05% chloramphenicol, after which the fungal colonization load was quantified. After infection, 24 mice were randomly divided into four groups for treatment (n = 6): the FLC group (10 mg/kg), the low-dose ASK group (2.5 mg/kg), the high-dose ASK group (10 mg/kg), and the untreated group. A cotton ball saturated with 200 µL of the drug was placed in the vaginal area of each mouse for 30 min, and this procedure was repeated daily for five consecutive days. The mice were euthanized on the second day following drug discontinuation. Half of the vaginal tissue was used to calculate the fungal colonization load, and the other half of the vaginal tissue was subjected to H&E staining, PAS staining, TUNEL staining, and immunofluorescence staining of pathological sections and quantified using ImageJ software.

Safety evaluation

Analysis of ASK cytotoxicity

RAW 264.7 cells obtained from the Kunming Cell Bank, Chinese Academy of Sciences (Kunming, Yunnan, China) were prepared at a concentration of 1 × 10⁵ and the cell density was determined using a Cell Counting Kit-8 (CCK-8; Beyotime, China).

Assessment of ASK toxicity in animals

Six- to eight-week-old C57BL/6 mice were randomly divided into groups of 6 mice each. The mice in the drug group were administered 10-fold the therapeutic dose of ASK (25 mg/kg) continuously for 5 days, while those in the control group were administered PBS solution, and the average body weight of the mice was calculated. After the mice were euthanized, the stomach, kidney, liver, and spleen tissues were collected, pathological sections were prepared, and the sections were stained with H&E.

Determination of the chitin content

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL. We added Calcofluor White Stain (CFW) to the fungal suspensions after drug treatment, incubated the mixtures for 3 min, rinsed the samples thoroughly with slow-running water, dried the samples, and observed them using a fluorescence microscope. The fluorescence images were quantified using ImageJ.

Scanning electron microscopy (SEM) to detect the morphological structure

A C. albicans suspension was formulated at 5 × 10⁶ CFU/mL and incubated with ASK and FLC for 4 h. The fungal precipitate was resuspended in electron microscope fixative overnight at 4 °C, dehydrated with a gradient of 30, 50, 70, 90, and 100% ethanol for 10 min, incubated with 100% anhydrous ethanol twice, and then centrifuged and lyophilized. The lyophilized C. albicans powder was coated on a conductive gel, and the samples were plated, observed under SEM and photographed.

Detection of extracellular alkaline phosphatase (AKP) activity

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL, and 2, 4 and 8 µg/mL ASK was added for treatment. FLC was used as the positive control group, and a blank group was established. After an incubation at 37 °C for 4 h, the samples were centrifuged at 5000×g for 10 min, after which the fungal pellet was washed twice with PBS and resuspended. The supernatant was aspirated, and the change in the content of AKP was detected according to the instructions of the AKP kit using the following formula:

AKP (Gin units / 100 mL) = [(Absorbance of assay wells - absorbance of blank wells)/(Absorbance of standard vacuole - absorbance of blank wells)] × concentration of phenol standard (0.02 mg/mL) × 100 mL × dilution of the sample before the assay.

The experiment was repeated three times.

Analysis of the ergosterol content

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL, and 2 and 8 µg/mL ASK were added and incubated with the suspension, AmB was used as the positive control group. After the incubation with the drug, 0.5 g of wet fungi was weighed, and then 10% KOH dissolved in methanol was added to the fungi. The mixture was heated in a water bath at 80 °C for 60 min. Next, 5 mL of petroleum ether was added to the sample and extracted three times. Afterwards, the mixture was washed with distilled water, and the unsaponified esters obtained after blowing with nitrogen were dissolved in methanol. Finally, the samples were subjected to HPLC analysis to determine the ergosterol content in each group. The experiment was repeated three times.

Analysis of the inhibition of mycelium and shoot tube formation

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL, and 2, 4 and 8 µg/mL ASK were added and incubated with the suspension, FLC was used as the positive control group. The fungal suspension was treated with drugs and then stained with a 5% crystal violet solution for 2 min. After staining, the smears were observed under a microscope. The mycelium formation rate and the length of the bud tube were calculated using ImageJ. The experiment was repeated three times.

Detection of cell surface hydrophobicity (CSH)

A two-phase water–hydrocarbon emulsion was used to determine the CSH of C. albicans. A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL, dispensed into sterile 6-well plates, and supplemented with ASK (concentrations ranging from 1 µg/mL to 4 µg/mL). The mixture was incubated at 37 °C for 24 h. The supernatant was carefully removed from the biological peritoneal membrane, which was subsequently washed with PBS. Peritoneal cells were harvested by scraping, while the C. albicans suspension was diluted in SDB until the absorbance at 600 nm reached 1. The OD₆₀₀ nm value of SDB was measured as a negative control. For each group, 1.2 mL of C. albicans suspension was soaked in a sterile glass tube, 0.3 mL of n-octane solution was added, and the mixture was vortexed and mixed for 3 min and then left to stand at room temperature for 5–10 min for water‒hydrocarbon two-phase separation, and the absorbance value of the aqueous phase at OD₆₀₀ nm was determined immediately after separation. The experiment was repeated three times.

The formula for calculating the CSH was as follows:

Relative hydrophobicity of the cell surface = (OD600 experimental group - OD600 negative control group)/OD600 control group

Determination of the extracellular polysaccharide (EPS) content

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL. A total of 12.5 mL of extracellular extract was added to 37.5 mL of anhydrous ethanol, and the mixture was allowed to settle overnight. Subsequently, 2 mL of sterile distilled water was added to the mixture, which was then thoroughly mixed to obtain the polysaccharide solution. The EPS solution was combined with 5% phenol at a 1:1 ratio, and the mixture was vortexed thoroughly. Afterwards, 5 mL of concentrated sulfuric acid was slowly added dropwise. The absorbance was measured at 600 nm using a microplate reader (BioTek Synergy H1). The experiment was repeated three times.

Detection of ROS levels

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL. DCFH-DA was added to the suspension to measure the level of ROS. Following drug treatment, 10 µL of fungal suspension was dropped on a slide and observed under a fluorescence microscope, the fluorescence images were quantified using ImageJ.

Detection of ATP levels

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL. After drug treatment, it was ground and crushed with sterile glass beads with a diameter of 0.55 mm, and ATP levels were detected using an enzyme counter. The experiment was repeated three times.

Assessment of oxidative damage

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL, FLC was used as the positive control group, and a blank control group was established. Rhodamine 123 and 4ʹ,6-diamidino-2-phenylindole (DAPI) were added to detect the mitochondrial membrane potential and DNA damage. Following drug treatment, 10 µL of the fungal suspension was dropped on a slide and observed under a fluorescence microscope, the fluorescence images were quantified using ImageJ.

Protein affinity target protein assay

A C. albicans suspension was formulated at 5 × 10⁶ CFU/mL, different concentrations of ASK were added, and the absorbance was measured at 600 nm to determine the semi-inhibitory concentration. Total protein was extracted from C. albicans in the logarithmic growth stage, diluted to a concentration of 5 mg/mL, mixed with the minimum semi-inhibitory concentration of ASK for C. albicans, and incubated at 37 °C for 45 min. A pronase solution was added to ethanol and ASK, and the mixture was digested at 37 °C for 3, 4 and 5 min, after which the samples were placed in 5 × SDS upwelling buffer and boiled to terminate digestion [17, 18]. After the different bands were obtained, mass spectrometry identification was performed, and the results were analysed by Wuhan Jinkairui Biotechnology Co. The filtered differentially expressed proteins were uploaded to the Search Tool for the Retrieval of Interacting Genes (STRING) database for analytical purposes, after which a protein‒protein interaction (PPI) network was constructed. The CentiScaPe 2.2 plug-in in Cytoscape was used to screen the key proteins.

Measurement of the total protein content

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL, after which the samples were ground with sterile glass beads (0.55 mm in diameter), and the protein content in the supernatant was determined using SDS‒PAGE. The experiment was repeated three times.

RT-qPCR

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL, and the semi-inhibitory concentration of ASK was added. RNA was extracted using Fast Pure Cell/Tissue Total RNA Extraction Reagent KIT2 (Vazyme, China), reverse transcribed to cDNA using Mon script RTIIII All-in-One Mix with dsDNase (Monad, China), and then analysed using Mon Amp SYBR Green qPCR Mix (Monad, China) on a LightCycler96 (Roche, USA). Solubilization curves were analysed to verify product homogeneity, and GAPDH were used as an internal reference for data normalization. Relative quantification (2^−ΔΔct method) was performed to determine changes in relative mRNA expression levels (Table 2). The experiment was repeated three times.

Table 2.

Primer sequences

Primer	Forward primers 5’→3’	Reverse primers 5’→3’
GAPDH	TGAGAAGGACCCTGCCAACA	ACTCCGGCTTGTAGGCATCAA
CDC19	TTGGATGGTGCTGACTGTGT	GGCCTTTTCAGCGGTAAGAC
SHM2	TGGTGGTGACAATATCAGCGT	TGCCGATAAAGTTGGTGCTT
LAT1	GGAGAAGCACCAAAACCAGC	TCTGTCGGTTGGGGCTTTTT
MLS1	GGCTGCTCCATTCATGTCCT	GAGCAGCCATACCACCAAGT
MAE1	CCTCAGAATGGGACGGTGTC	CCTGGCTGGGTAGAACATCC

Molecular docking

The 3D structure of ASK was retrieved from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/), and the crystal structure of the target protein was derived from the UniProt database (https://www.uniprot.org/). Docking was performed using AutoDockTools 1.5.6 (Trott and Olson, 2009) software, and the data were subsequently visualized and analysed using PyMOL 2.3.0 and Discovery Studio 2019.

Assay of Mls activity

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL and incubated with FLC and ASK for 4 h, and a blank group was established. A Mls kit (Shanghai Enzyme Link Bio) was used for detection. The experiment was repeated three times.

Detection of catalase activity

A C. albicans suspension was formulated at 1 × 10⁶ CFU/mL, 40 µg/mL H₂O₂ was used as a positive control for the catalase activity assay, and a blank group was established. A catalase kit (Beyotime) was used for detection. The experiment was repeated three times.

Spot assay

C. albicans suspensions were formulated at 1 × 10⁶ CFU/mL, and the final concentrations were sequentially diluted to 1 × 10⁵ CFU/mL, 1 × 10⁴ CFU/mL, 1 × 10³ CFU/mL and 1 × 10² CFU/mL. For each dilution, 5 µL of the solution was spotted onto minimal medium plates supplemented with glucose, ethanol, glycerol, potassium acetate and mannitol for 48 h. The experiment was repeated three times.

Statistical analysis

All results are presented as the means ± standard deviations (SDs) of at least three independent experiments. Statistical analyses were performed using GraphPad Prism 9.0 and SPSS 20.0 software. The Shapiro–Wilk test was used to evaluate the normality of data distribution, and Levene’s test was used to assess the homogeneity of variances. For data with normal distribution and equal variances, one-way analysis of variance (ANOVA) was applied for intergroup comparisons, followed by Tukey’s honest significant difference (HSD) post-hoc test. A P value < 0.05 was considered statistically significant.

Results

Antimicrobial activity of ASK

The antimicrobial activities of the nine components present in Lithospermum erythrorhizon were detected, and the results indicated that ASK exerted the antifungal and antibacterial effects on C. albicans (Table 3).

Table 3.

MICs of related components of Lithospermum erythrorhizon (µg/mL)

Component	Klebsiella	Pseudomonas	Acinetobacter	Staphylococcus	Candida	Cryptococcus
	pneumoniae	aeruginosa	baumannii	aureus	albicans	neoformans
Shikonin	> 128	> 128	> 128	> 128	> 128	> 128
Lithospermoside	> 128	> 128	> 128	> 128	8	4
β, β-Dimethylacrylshikonin	> 128	> 128	> 128	> 128	> 128	> 128
β, β-Dimethylacrylalkannin	> 128	> 128	> 128	> 128	32	8
Lithospermic acid	> 128	> 128	> 128	> 128	> 128	> 128
β-Acetoxyisovalerylshikonin	> 128	> 128	> 128	> 128	> 128	> 128
Isobutyrylshikonin	> 128	> 128	> 128	> 128	> 128	> 128
ASK	> 128	> 128	16	> 128	2	8
Deoxyshikonin	> 128	> 128	> 128	> 128	> 128	8

Activity of ASK against drug-resistant C. albicans in vitro

ASK had a good antifungal effect on strains resistant to FLC, ITZ, 5-FC and ketoconazole (KCZ), with MICs of 1–4 µg/mL (Table 4, Supplementary Table 1), with EC₅₀ and EC₉₀ were 0.9723 µg/mL and 1.6545 µg/mL, respectively (Fig. 1A). Notably, all C. albicans strains displayed high levels of resistance to FLC, ITZ, and 5-FC (Table S1 Supplementary Material). These results indicate that ASK significantly inhibits the growth of drug-resistant C. albicans. Moreover, a 4-fold increase in the MIC killed 99.9% of C. albicans within 4 h. The fungicidal activity of ASK exhibited concentration- and time-dependent variations (Fig. 1B). The analysis of resistance induction revealed that no resistance to ASK was developed after 21 days, whereas a 2-fold change in the MIC of FLC was detected after 12 days, indicating that ASK can reduce the risk of resistance (Fig. 1C). Moreover, ASK exerted bacteriostatic effects on a wide range of strains, such as Candida tropicalis, Escherichia coli, Acinetobacter baumannii, which can aid in the treatment of multiple infections (Table S2). ASK exerted an additive inhibitory effect on C. albicans in combination with other compounds, such as amphotericin B, pseudolaric acid B, polyphyllin VII, dihydrotanshinone, eupatilin, luteolin and punicalagins). These findings demonstrate that ASK has the advantages of being an effective, fast fungicide that does not easily induce resistance in C. albicans.

Table 4.

MICs of ASK against C. albicans (µg/mL)

No	Strains	Drug resistance	MIC (µg/mL)
1	BHKS393	Resistant to FLC, ITZ, and 5-FC	2
2	BHKS473	Resistant to FLC, ITZ, and 5-FC	1
3	BHKS474	Resistant to FLC, ITZ, and 5-FC	2
4	BHKS475	Resistant to FLC, ITZ, and 5-FC	4
5	BHKS476	Resistant to FLC, ITZ, and 5-FC	2
6	BHKS477	Resistant to FLC, ITZ, and 5-FC	1
7	C. albicans (GB4789.28)	Resistant to FLC, ITZ, and 5-FC	2

Fig. 1.

Antifungal activity of ASK against C. albicans in vitro. (A) EC₅₀ and EC₉₀ of ASK against C. albicans. (B) MFC of ASK against C. albicans. (C) Assessment of ASK resistance in C. albicans

Assessment of the effect of ASK on drug-resistant C. albicans in vivo

Therapeutic effect of ASK on oral candidiasis

C. albicans strain S393 was adaptively colonized in C57BL/6 mice to establish an oral candidiasis model (Fig. 2A). Following treatment with high or low doses of ASK, the symptoms of the mice significantly alleviated. The white patchy lesions on the oral mucosa was markedly reduced (Fig. 2B), the pseudomembrane area and thickness on the dorsal surface of the mouse tongue were scored [19], and an obvious therapeutic effect was observed (Table 5; Fig. 2C). In addition, a significant decrease in body weight was not observed (Fig. 2D). H&E and PAS staining revealed extensive hyphal colonization and obvious inflammatory cell infiltration in the PBS group, whereas these pathological changes were largely absent in the treatment group (Fig. 2E). Moreover, C. albicans colonization in tongue tissue was diminished significantly (Fig. 2F), the area of inflammatory cell infiltration was reduced (Fig. 2G), and the expression levels of IL-6, TNF-α and IL-1β was significantly reduced after ASK treatment (Fig. 2H). These effects were significantly superior to those observed in the FLC-treated group.

Fig. 2.

Therapeutic effect of ASK on oral candidiasis. (A) Mouse model of oral candidiasis. (B) Repair of the tongue after treatment. (C) Scoring of tongue tissue damage. (D) Changes in the body weight of the mice. (E) Repair of the tongue mucosal tissues after treatment (10×, 40×). (F) Amount of C. albicans colonization after treatment. (G) Quantitative graph of PAS staining after treatment. (H) Quantitative graph of the levels of inflammatory factors after treatment. The data are presented as the means ± SEMs (n = 6). ^*P < 0.05, ^** P < 0.01, ^*** P < 0.001, and ^**** P < 0.0001 compared with the control group

Table 5.

Scoring of oral dorsal tongue lesions

Score	Symptom
0	Normal (no pseudomembrane)
1	A small amount of thin pseudomembrane, covering < 20% of the tongue surface
2	Thin pseudomembrane, covering > 21% and ≤ 90% of the tongue surface
3	Thin pseudomembrane, covering > 91% of the tongue surface
4	Thick pseudomembrane, covering > 91% of the tongue surface

Therapeutic effect of ASK on vulvovaginitis candidiasis

C. albicans strain S393 was used to establish a vulvovaginitis candidiasis model in C57BL/6 mice (Fig. 3A). Following treatment with high and low doses of ASK, fungal burden vaginal tissues was markedly decreased, and the effect was significantly superior in the high-dose group than in the FLC group. H&E and PAS staining revealed that extensive hyphal colonization and obvious inflammatory cell infiltration were observed in the PBS group (Fig. 3B), whereas the amount of C. albicans colonization and vaginal lavage were significantly alleviated after ASK treatment (Fig. 3C and D). No significant fluctuations in body weight were observed (Fig. 3E). Additionally, the fungal colonization level decreased, and the expression levels of inflammatory factors, including IL-6, TNF-α, and IL-1β were downregulated (Fig. 3F and G).

Fig. 3.

Therapeutic effect of ASK on vulvovaginitis candidiasis. (A) Mouse model of vulvovaginitis candidiasis. (B) Repair of vaginal mucosal tissues after treatment (10×, 40×). (C) Amount of C. albicans colonization after treatment. (D) Fungal load of vaginal lavage. (E) Changes in the body weight of the mice. (F) Quantitative graph of inflammatory factors after treatment. (G) Quantitative graphs of PAS staining after treatment. The data are presented as the means ± SEMs (n = 6). ^*P < 0.05, ^** P < 0.01, ^*** P < 0.001, and ^**** P < 0.0001 compared with the control group

As shown in Sect. 3.3.1 and 3.3.2, ASK decreased the colonization of the drug-resistant C. albicans in the tongue and vaginal mucosa of mice, reduced the inflammatory response, and alleviated tissue injury to the tongue and vaginal mucosa. Collectively, these data indicate that ASK exerts potent and favorable therapeutic efficacy against drug-resistant C. albicans infections in vivo.

Evaluation of ASK safety in vitro and in vivo

The cytotoxicity of ASK towards RAW264.7 cells was evaluated in vitro using a CCK-8 assay (Fig. 4A). The results demonstrated that ASK did not directly impair innate immune function. In the in vivo toxicity evaluation, the mice maintained stable body weight with no obvious fluctuations (Fig. 4B). Furthermore, the mice were administered 25 mg/kg ASK via gavage (10-fold higher than the therapeutic dose). The histopathological examination revealed no significant pathological damage to the stomach, liver, spleen, or kidney, thus avoiding the serious risk of potential acute multiorgan toxicity (Fig. 4C). Collectively, these findings demonstrate that ASK displays low toxicity and favorable biocompatibility in mice at the tested doses.

Fig. 4.

In vitro and in vivo assessments of ASK safety. (A) Evaluation of the cytotoxicity of ASK to RAW264.7 cells. (B) Curves showing the changes in mouse body weight. (C) H&E staining of tissues. The data are presented as the means ± SEMs (n = 3 in A; n = 6 in B and C). ^*P < 0.05, ^** P < 0.01, ^*** P < 0.001, and ^**** P < 0.0001 compared with the control group

Mechanism underlying the inhibitory effect of ASK on C. albicans

ASK-induced damage to the C. albicans cell membrane and cell wall

AKP activity can indirectly reflect the permeability of the cell wall. Therefore, we determined the AKP content and observed a significant increase in extracellular AKP levels following treatment with ASK, which indicated that the fungal cell wall was damaged (Fig. 5A). In addition, the ergosterol content was determined using HPLC, and the results showed that ASK effectively decreased the ergosterol content in a dose-dependent manner (Fig. 5B). SEM observations revealed that the cell wall was damaged after drug treatment and that the surface was rough and wrinkled, with leakage of the cellular contents (Fig. 5C). Using fluorescence microscopy, chitin leakage from the cell wall was observed to increase after treatment with increasing drug concentrations. Given that CFW specifically binds to chitin in the cell wall, this chitin leakage resulted in a progressive reduction in fluorescence intensity (Fig. 5D). These findings indicated that ASK damaged the cell wall and cell membrane of C. albicans.

Fig. 5.

ASK damages the cell membrane and cell wall of C. albicans. (A) Determination of the AKP content. (B) Determination of the ergosterol content. (C) SEM image showing the C. albicans morphology and structure. (D) CFW fluorescence staining for the detection of the chitin content (10×). The data are presented as the means ± SEMs (n = 3). ^*P < 0.05, ^** P < 0.01, ^*** P < 0.001, and ^**** P < 0.0001 compared with the control group

ASK inhibits the adhesion of C. albicans

The inhibitory effect of ASK on hyphal and germ tube formation was evaluated using crystal violet staining. Microscopy images were captured to document the morphological transition of cells from yeast to filamentous stages (Fig. 6A and C). Over a 4-hour incubation period, morphological changes in C. albicans were monitored via microscopy, which showed that the untreated control group exhibited abundant number of hyphae characterized by normal growth and a plump morphology. After treatment with gradually increasing concentrations of ASK, the hyphal formation rate of C. albicans decreased progressively, accompanied by a shortened hyphal length, and most cells remained in the yeast form. These results indicate that ASK exerts its inhibitory effect by suppressing the yeast-to-hyphal transition of C. albicans. The CSH is a key indicator of adhesion ability. We assayed the surface hydrophobicity of C. albicans following treatment with ASK, and the results revealed that ASK significantly reduced the CSH of the fungus, thereby impairing the adhesion ability of C. albicans (Fig. 6D). Moreover, EPS are closely associated with fungal adhesion. The phenol‒sulfuric acid method was employed to assess the effect of ASK on the EPS content of C. albicans (Fig. 6E). These findings suggest that ASK can hinder the growth of C. albicans by reducing its adhesion ability.

Fig. 6.

Inhibition of the adhesion and invasion of C. albicans by ASK. (A) Crystal violet-stained hyphae (20×). (B) Rate of hyphal formation. (C) Hyphal length (µm). (D) Determination of the CSH. (E) Determination of the EPS content. The data are presented as the means ± SEMs (n = 3). ^*P < 0.05, ^** P < 0.01, ^*** P < 0.001, and ^**** P < 0.0001 compared with the control group

ASK damages C. albicans cells via ROS-mediated reactions

ROS accumulation is vital for inducing apoptosis-like cell death-like cell death. Compared with the control treatment, ASK treatment significantly increased the intensity and proportion of fluorescence in a dose-dependent manner (Fig. 7A and B). Elevated ROS levels can damage cell membranes, proteins and DNA, thereby affecting ATP production. The results demonstrated that ASK markedly reduced the ATP level in cells (Fig. 7C). Mitochondria also play an important role in yeast apoptosis-like cell death-like cell death because they are the main site of ROS production. Increased mitochondrial permeability is a key marker of the early stages of apoptosis-like cell death-like cell death. Therefore, we performed rhodamine 123 staining to determine the effect of ASK on mitochondrial apoptosis-like cell death-like cell death. Following treatment with ASK, the fluorescence intensity decreased in a concentration-dependent manner as the drug concentration increased, indicating that ASK induced the depolarization of the mitochondrial membrane potential in C. albicans (Fig. 7D).

Fig. 7.

Apoptotic damage to C. albicans caused by ASK. (A) Fluorescence microscopy was used to detect the oxidizing effect. (B) Graph of the fluorescence intensity. (C) Measurement of the ATP content. (D) Rhodamine 123 staining was used to measure the mitochondrial membrane potential. (E) 4ʹ,6-Diamidino-2-phenylindole (DAPI) staining was performed to label damaged DNA in cells. The data are presented as the means ± SEMs (n = 3). ^*P < 0.05, ^** P < 0.01, ^*** P < 0.001, and ^**** P < 0.0001 compared with the control group

We performed DAPI staining to detect morphological changes in the cell nucleus. Fluorescence microscopy showed that the cells treated with ASK exhibited irregular nuclear fragmentation and teardrop-shaped tubules compared with the control cells (Fig. 7E). These characteristics are typical features of nuclear abnormalities associated with DNA damage during the process of apoptosis-like cell death-like cell death. In summary, the above results suggest that the treatment of C. albicans with ASK leads to ROS accumulation. The accumulated ROS subsequently reduce the mitochondrial membrane potential and ATP levels, which in turn induce morphological changes (e.g., DNA fragmentation and nuclear condensation), these morphological alterations ultimately trigger apoptosis-like cell death-like cell death in C. albicans. However, the specific mechanism of ROS production remains unclear.

Analysis of ASK binding to target proteins

Drug affinity-responsive target stability (DARTS) assays are a widely used method for detecting drug–target binding. First, growth curves of the effects with ASK on C. albicans at different time points were examined, and the OD₆₀₀ value was essentially unchanged at 2 times the MIC, which was used as the semi-inhibitory concentration in the DARTS experiment. The results showed that the proteins in different bands had a molecular weight range of 50–70 kD (Fig. 8A and B). Differentially expressed proteins were identified and 263 potential targets were ultimately screened, with 9 and 49 proteins specific to the ASK and ethanol groups, respectively (Fig. 8C). The COG annotations of the proteins were related mainly to translation, ribosomal structure and biochemical synthetics, amino acid transport and metabolism, and energy production and conversion (Fig. 8D). The KEGG pathway enrichment analysis revealed enrichment mainly in metabolic pathways (Fig. 8E), secondary metabolite biosynthesis, amino acid biosynthesis and carbon metabolism. In the GO enrichment map, the proteins were enriched mainly in cellular processes, metabolic processes and biosynthetic processes (Fig. 8F). Subcellular localization predictions revealed that cellular components were localized mainly in the cytoplasm, nucleus and cell membrane (Fig. S2). Based on the aforementioned protein features, the results of the quantitative analysis and the results of the phenotyping experiments (Table S4), five target proteins, Mae1, Lat1, Cdc19, Shm2 and Mls1, were screened.

Fig. 8.

Drug affinity response target stability (DARTS) target protein assay. (A) Curve of the semi-inhibitory concentration of ASK for C. albicans. (B) SDS‒PAGE electropherogram of the DARTS protein screen. (C) Venn diagram showing overlapping proteins. (D) COG functional annotations of the proteins. (E) Enriched KEGG pathways. (F) GO annotations of the proteins

Validation of key proteins targets for ASK activity

Based on the results of qualitative and quantitative assessments of the total protein expression level, the bands disappeared or became lighter after ASK treatment, and the protein content tended to decrease (Fig. 9A and B), moreover, the protein–protein interaction networks of the relevant proteins were evaluated using the STRING website (Fig. 9C), and all proteins were downregulated to different degrees, except for Cdc19. The compounds were subsequently docked to the target proteins using molecular docking and visualized, among which Mls1 displayed the highest binding affinity (Table S5 and Fig. S3), with a recorded binding energy of −5.95 kcal/mol (Fig. 9D). mRNA expression was also detected by performing RT‒qPCR (Fig. 9E). Mls1 formed conventional hydrogen-bonding interactions with LYS407 and GLU404; pi–cation interactions with LYS321; and pi–alkyl interactions with VAL324, PRO402, and HIS328. We combined molecular docking and mRNA expression data to determine whether Mls1 is an important target protein. Mls1 plays an important role in the carbon metabolism pathway, which is consistent with the results of the abovementioned biosignature analyses. The content of Mls1, a key enzyme in the GC, was determined via spectrophotometry following ASK treatment. The Mls1 content decreased in a concentration-dependent manner after treatment with increasing ASK concentrations (Fig. 9F). The GC cycle is a vital metabolic pathway in peroxisomes, and catalase is an enzyme localized to peroxisomes. Accordingly, catalase levels in C. albicans were determined. We found that the catalase enzyme content gradually decreased after drug treatment (Fig. 9G).

Fig. 9.

Effect of ASK on C. albicans proteins. (A) SDS‒PAGE and mass spectrometry analysis of protein bands for the detection of total protein contents. (B) Determination of the total protein content. (C) Protein–protein interactions identified using STRING. (D) Molecular docking of the target protein Mls1 with ASK. (E) RT‒qPCR validation of the mRNA expression of the target protein Mls1. (F) Determination of the Mls1 content. (G) Determination of the catalase content. (H) Growth of C. albicans on fermentable and nonfermentable carbon sources. The data are presented as the means ± SEMs (n = 3). ^*P < 0.05, ^** P < 0.01, ^*** P < 0.001, and ^**** P < 0.0001 compared with the control group

Previously, we identified Mls1 as an important target protein for ASK-mediated inhibition of C. albicans growth. Mls1 and Icl1 play important roles in carbon and nitrogen metabolism, and their levels are involved in the utilization of nonfermentable carbon sources; when Mls1 and Icl1 are absent, C. albicans cannot use nonfermentable carbon sources (such as ethanol, potassium acetate, glycerol, or mannitol) for growth and is restricted to fermentable carbon sources such as glucose. A variety of different carbon sources were used to observe the growth of C. albicans, and C. albicans grew well in media containing both fermentable and nonfermentable carbon sources in the absence of drugs (Fig. 9H). However, after the addition of ASK, the growth of C. albicans in medium containing a fermentable carbon source was better than that in medium containing a nonfermentable carbon source. The expression of Mls1 was reduced during ASK-mediated inhibition of C. albicans and thus it could not utilize a nonfermentable carbon source and could only grow by utilizing the fermentable carbon source.

Discussion

C. albicans is a common opportunistic pathogenic fungus in humans and is the main cause of invasive candidiasis. Recently, the widespread use of antifungal drugs has led to extensive clinical drug resistance in C. albicans. Thus, novel antifungal drugs are urgently needed.

In the preliminary stage, ASK from Lithospermum erythrorhizon was screened as the active component with inhibitory activity against C. albicans. ASK exhibited significant inhibitory activity against drug-resistant C. albicans both in vitro and in vivo, with MICs ranging from 1 to 4 µg/mL. In addition, ASK showed low toxicity and good safety both in vitro and in vivo. Thus, the properties of ASK indicate its potential as a good candidate for drug-resistant C. albicans.

CSH is an important indicator of adhesion ability, and EPS is involved in biofilm formation [20–22]. Our results demonstrated that ASK effectively reduced the CSH and EPS content and inhibited hyphal formation, thereby impairing its adhesion and pathogenicity. In addition, ASK also causes remarkable structural damage to C. albicans. The cell wall and cell membrane play important roles in regulating osmotic pressure, material exchange, and signal transduction [23]. Notably, the fungal cell wall is unique and absent in human cells, and the composition of the fungal cell membrane also differs significantly from that of mammalian cells. Our study demonstrated that ASK decreased the ergosterol content in the cell membrane and the chitin content in the cell wall of C. albicans, accompanied by the leakage of AKP and the appearance of a rough and wrinkled cell wall surface. These structural injuries represent direct manifestations of the antifungal activity of ASK and also serve as a crucial foundation for subsequent apoptotic cell death.

Dysregulation of ROS homeostasis triggers severe oxidative stress, thereby initiating the apoptotic program. In this study, ASK treatment significantly increased ROS levels in C. albicans, which further induced mitochondrial membrane potential depolarization and triggered mitochondrial permeability transition pore opening, resulting in impaired ATP synthesis. DAPI staining further confirmed that ASK induced typical apoptotic nuclear morphology, such as nuclear condensation and fragmentation in C. albicans. These results confirm that ASK triggers apoptosis-like cell death in C. albicans through the induction of oxidative stress. Furthermore, ROS levels were significantly reduced in the ASK plus NAC co-treatment group (Fig. S5), nearly returning to those of the control group. These findings suggest that ASK exerts its antifungal effect at least partially by triggering oxidative stress via excessive ROS accumulation in C. albicans, and this effect can be reversed by the ROS scavenger NAC, indicating that oxidative stress may serve as an important molecular mechanism underlying the antifungal activity of ASK.

How did ASK induce ROS production in C. albicans? Based on the differential bands obtained from DARTS experiments, followed by mass spectrometry identification and removal of proteins outside the target range, a total of 263 potential targets were ultimately identified, including 49 and 9 unique proteins in the ASK and solvent groups, respectively. COG annotation indicated that these proteins are primarily associated with biosynthetic pathways, while KEGG enrichment analysis highlighted predominant involvement in metabolic pathways and carbon metabolism. Subsequently, the 263 potential targets were submitted to the STRING database to construct a PPI network after were removed. The network was then imported into Cytoscape 3.8.2 for visualization, leading to the identification of five key target proteins: Mae1, Lat1, Cdc19, Shm2, and Mls1. Furthermore, RT-qPCR was performed to assess the mRNA expression levels of the five key targets following ASK treatment, and molecular docking was conducted to evaluate their potential binding affinities. Mls1 exhibited notable downregulation and strong binding affinity, suggesting that it may serve as a potential key target protein.

Mls1, a key enzyme of the GC, acts as a critical bypass of the tricarboxylic acid (TCA) cycle under glucose deprivation, enabling C. albicans to utilize non-fermentable carbon sources for biosynthesis. As this pathway is highly conserved in fungi and lacks human orthologs [24], it represents an ideal specific antifungal target. Our findings suggest that the antifungal effect of ASK may be primarily achieved by targeting Mls1 and inhibiting the GC, thereby triggering a cascade of metabolic disorders and oxidative stress responses. Regarding carbon metabolism, ASK significantly inhibited the growth of C. albicans under non-fermentable carbon source conditions. We speculate that this observation may be associated with the downregulation of Mls1 (Fig. 10). Reduced Mls1 expression may impair GC function, limiting the ability of fungal cells to efficiently utilize non-fermentable carbon sources for survival and proliferation, ultimately leading to growth inhibition [25].

Fig. 10.

Molecular mechanism underlying the effect of ASK on C. albicans

Meanwhile, Mls1 is localized in peroxisomes, and its normal function is highly dependent on peroxisomal redox homeostasis, in which catalase serves as a key antioxidant enzyme [26]. The decreased catalase level following ASK treatment indicates disrupted peroxisomal redox balance and weakened intracellular antioxidant capacity, which may contribute to excessive accumulation of ROS [27]. Notably, excessive ROS accumulation may further interfere with the normal operation of core intracellular metabolic pathways. In this study, we observed markedly reduced levels of acetyl-CoA, succinate dehydrogenase (SDH), and citrate synthase in C. albicans after ASK treatment (Fig. S6). As acetyl-CoA represents a central intermediate in carbon and energy metabolism, and SDH and citrate synthase are key rate-limiting enzymes in the TCA cycle, these changes imply that TCA cycle function may be significantly compromised.

Collectively, we propose that the underlying mechanism by which ASK exerts its antifungal activity against C. albicans may involve targeting Mls1 as a key gene. Through inhibiting the GC, disturbing peroxisomal homeostasis, and inducing ROS accumulation, ASK may further disrupt central carbon metabolism and energy production, ultimately leading to the suppression of fungal growth. However, to further validate this targeted effect, additional assays such as SPR, ITC, and MST are needed to clarify their potential interaction and underlying molecular mechanism.

Conclusions

The present study identifies ASK as the major antifungal constituent isolated from Lithospermum erythrorhizon, with potent inhibitory activity against C. albicans both in vitro and in vivo. Mechanistic evidence suggests that the antifungal action of ASK may involve targeting Mls1 as a potential key target gene. Through inhibiting the GC, disturbing peroxisomal homeostasis, and inducing ROS accumulation, ultimately resulting in the suppression of fungal growth.

Abbreviations

ATP

Adenosine triphosphate

ASK

Acetylshikonin

5-FC

5-flucytosine

ATP

Adenosine triphosphate

C. albicans

Candida albicans

CFU

Colony-forming unit

CSH

Cell surface hydrophobicity

DARTS

Drug affinity responsive target stability

FIC

Fractional inhibitory concentration

FLC

Fluconazole

H&E

Hematoxylin and eosin

ITZ

Itraconazole

MFC

Minimal fungicidal concentration

MIC

Minimal inhibitory concentration

Mls1

Malate synthase

PAS

Periodic acid–schiff

PBS

Phosphate-buffered saline

qRT-PCR

Real-time quantitative reverse transcription PCR

SDA

Sabouraud dextrose agar

SDB

Sabouraud dextrose broth

SEM

Standard error of the mean

GC

Glyoxylate cycle

TCA

Tricarboxylic acid

SDH

Succinate dehydrogenase

Author contributions

Zhenyi Xu: Writing—review and editing, Methodology, Investigation, Conceptualization.Wenting Zhou: Writing—review and editing, Methodology, Investigation. Jiazi Luo: Funding acquisition, Conceptualization. Yuanyuan Dai: Funding acquisition, Conceptualization. Shixian Yang: Validation, Software. Yanqiang Huang: Writing—review and editing, Methodology, Project administration, Funding acquisition. Shufang Li: Writing—review and editing, Supervision.

Funding

This work was supported by the Guangxi Science and Technology Major projects (grant number AA23073012) and the National Natural Science Foundation of China (grant numbers 32360035 and 32060018).

Data availability

The raw data supporting the conclusions of this article will be made available by the authors without undue reservation.

Declarations

Ethics approval and consent to participate

All animal experiments were approved by the Institutional Review Board of the Right River College of Ethnic Medicine (Baise, Guangxi, China) and conducted in accordance with the Animal Welfare Standards and Institutional Guidelines (Ethics in Animal Experimentation No. 2023071101).

Competing interests

The authors declare no competing interests.

Generative AI statement

The author(s) declare that generative AI was not used in the creation of this manuscript.