INHBB Promotes Colorectal Cancer Progression by Inducing CD8 ⁺ T Cell Exhaustion via the ACVR2B‐SMAD Signaling Axis

ABSTRACT

To investigate the expression pattern, biological functions and regulatory mechanisms of inhibin beta B (INHBB) in colorectal cancer (CRC), and to clarify its role in mediating CD8⁺ T cell exhaustion via the INHBB‐ACVR2B‐SMAD signaling axis for identifying a novel therapeutic target in CRC targeted immunotherapy, we analyzed the expression profile and prognostic value of INHBB in CRC tissues using The Cancer Genome Atlas database. Stable INHBB knockdown and overexpression CRC cell lines were constructed, and the malignant phenotypes were evaluated by Transwell assays, flow cytometry and other functional experiments. The interaction between INHBB and ACVR2B was verified by co‐immunoprecipitation and immunofluorescence, and the in vivo regulatory effects of this pathway were determined using mouse xenograft tumor models combined with SMAD inhibitors. INHBB was upregulated in CRC tissues and associated with poor prognosis. Functional assays demonstrated that INHBB promoted the proliferation and invasion and suppressed the apoptosis of CRC cells. Mechanistically, INHBB bound to ACVR2B on CD8⁺ T cells, activated SMAD signaling, and triggered CD8⁺ T cell exhaustion, whereas blockade of the SMAD pathway reversed INHBB‐mediated immunosuppression and tumor progression. Collectively, INHBB dually regulates the malignant phenotypes of CRC cells and CD8⁺ T cell function through the INHBB‐ACVR2B‐SMAD axis, and targeting this axis may represent a promising therapeutic strategy for CRC immunotherapy.

INHBB secreted by colorectal cancer cells activates ACVR2B‐SMAD signaling to induce CD8⁺ T‐cell exhaustion and drive tumor progression. SB431542 blocks this oncogenic immune‐suppressive axis.

Abbreviations

ACVR2B

activin receptor type‐2B

CRC

colorectal cancer

EMT

epithelial‐mesenchymal transition

INHBB

inhibin beta B

INHBB‐KD

INHBB knockdown

INHBB‐OE

INHBB overexpression

TCGA

The Cancer Genome Atlas

TGF‐β

transforming growth factor‐β

TME

tumor microenvironment

1. Introduction

Colorectal cancer (CRC) ranks among the most prevalent and lethal malignancies of the digestive system worldwide, posing substantial clinical challenges. According to GLOBOCAN 2022 statistics, approximately 1.9 million new CRC cases and 900,000 deaths occur annually, with nearly 22% of patients presenting with regional lymph node or distant organ metastasis at diagnosis, resulting in a 5‐year survival rate below 30% [1, 2]. Although surgical resection combined with adjuvant chemoradiotherapy, targeted therapy, and immune checkpoint inhibitors has improved outcomes for certain CRC patients, therapeutic resistance and high recurrence rates persist due to tumor heterogeneity, chemoresistance, and an immunosuppressive tumor microenvironment (TME) [3, 4]. Therefore, deciphering the molecular mechanisms underlying CRC pathogenesis and identifying critical regulators of tumor progression and immune evasion are imperative for developing innovative precision therapeutic strategies.

The transforming growth factor‐β (TGF‐β) superfamily exerts dichotomous roles in tumorigenesis; its aberrant activity drives tumor‐cell proliferation, apoptosis, epithelial‐mesenchymal transition (EMT), and remodeling of the tumor immune microenvironment [5]. As an important member of this superfamily, inhibin beta B (INHBB) triggers downstream signaling cascades by binding to specific receptors and governs physiological processes including reproductive development and cellular differentiation [6]. Recent studies have demonstrated that INHBB exhibits differential expression patterns across various malignancies, including nasopharyngeal carcinoma, lung cancer, and gastric cancer, and its expression level correlates with tumor invasion depth, lymph node metastasis, and unfavorable prognosis. For instance, INHBB suppresses tumor cell invasion and metastasis in nasopharyngeal carcinoma by activating the SMAD2/3 signaling pathway [7]. In non‐small cell lung cancer, INHBA—a paralog of INHBB—mediates immunosuppressive effects that attenuate patient response to PD‐1 inhibitors and promote tumor growth [8]. However, the expression characteristics, biological functions, and regulatory mechanisms of INHBB in CRC remain largely unexplored, particularly its role and molecular mechanism in shaping the CRC immune microenvironment.

Imbalance of the tumor immune microenvironment constitutes a cornerstone of tumor immune evasion. CD8⁺ T cells, as pivotal effectors of anti‐tumor immunity, dictate the efficacy of immunotherapy. Under physiological conditions, CD8⁺ T cells recognize tumor antigens, undergo activation and proliferation, and differentiate into cytotoxic T lymphocytes to eliminate tumor cells. Conversely, in the TME of CRC and other malignancies, persistent exposure to tumor‐derived signals drives CD8⁺ T cells into a state of functional exhaustion, characterized by impaired proliferative capacity, attenuated cytotoxicity, and upregulated expression of exhaustion markers such as PD‐1 and TIM‐3, ultimately culminating in tumor immune escape [9, 10]. While immunosuppressive cytokines (e.g., TGF‐β, IL‐10), dysregulated immune‐checkpoint molecules, and perturbed signaling axes contribute to CD8⁺ T‐cell exhaustion, the complete regulatory landscape remains incompletely defined. Cumulative evidence indicates that members of this superfamily reshape the tumor immune microenvironment by modulating immune‐cell effector functions [11]. Whether INHBB contributes to CRC progression by regulating CD8⁺ T cell exhaustion remains unreported.

Activin receptor type‐2B (ACVR2B) serves as a high‐affinity receptor for inhibin β (including the INHBB subunit), and their binding activates downstream SMAD2/3 signaling to regulate cell proliferation, differentiation, and immune responses [12]. As the cognate receptor for INHBB, ACVR2B is co‐upregulated with INHBB in lung adenocarcinoma, and its expression correlates significantly with patient prognosis [13], though the underlying mechanisms remain elusive. In CRC, whether ACVR2B mediates INHBB‐driven biological effects and modulates CD8⁺ T cell function is undefined. Moreover, the SMAD signaling pathway, as a canonical downstream effector of the TGF‐β superfamily, is aberrantly activated during CRC progression and mediates immunosuppression. Phosphorylation of SMAD2/3 has been shown to promote EMT and chemoresistance in CRC cells [14], yet direct experimental evidence linking this pathway to INHBB‐driven CD8⁺ T cell exhaustion is lacking.

Collectively, this study systematically analyzed the expression profile and clinical significance of INHBB in CRC through TCGA database mining, delineated its impact on CRC cell behavior and CD8⁺ T cell function at the cellular level, and further validated the physical interaction between INHBB and ACVR2B via Co‐IP and confocal immunofluorescence. Finally, in vivo murine models were employed to substantiate the mechanism by which the Inhbb‐Acvr2b‐SMAD axis governs CD8⁺ T cell exhaustion and CRC progression. Our findings aim to elucidate the regulatory role and molecular mechanism of INHBB in CRC, providing novel theoretical insights and a potential therapeutic target for diagnostic biomarker development and targeted immunotherapy in CRC.

2. Material and Methods

2.1. Bioinformatics Analysis

Clinical and transcriptomic data for CRC and adjacent normal tissues were retrieved from The Cancer Genome Atlas (TCGA) database. Data processing and differential expression analysis of INHBB were performed using R software (version 4.2.0) with DESeq2 and survminer packages. Expression differences were visualized using box plots. CRC patients were stratified into high‐ and low‐expression groups based on the median INHBB expression level. Kaplan–Meier survival curves were constructed and overall survival differences were assessed using the log‐rank test to determine the prognostic relevance of INHBB expression.

2.2. Cell Culture

The human CRC cell line HCT116 and murine CRC cell line CT26 were purchased from the Cell Bank of the Chinese Academy of Sciences. HCT116 cells were maintained in DMEM (11966025, Gibco) supplemented with 10% fetal bovine serum (FBS; A5256701, Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin. CT26 cells were cultured in RPMI‐1640 medium (11875093, Gibco) with identical supplements. All cells were incubated at 37°C in a humidified atmosphere containing 5% CO₂ and subcultured every 2–3 days.

CD8⁺ T cells were isolated from the spleens of 6–8‐week‐old SPF immunocompetent mice. Briefly, spleens were aseptically removed after cervical dislocation, mechanically dissociated, and filtered to generate single‐cell suspensions. CD8⁺ T cells were purified using a CD8⁺ T cell isolation kit (B90011, Selleck) and cultured in RPMI‐1640 medium containing 10% FBS and 50 U/mL IL‐2 for subsequent experiments.

2.3. Cell Transfection and Stable Cell Line Construction

siRNAs targeting INHBB and ACVR2B (human)/Inhbb and Acvr2b (murine), along with respective overexpression plasmids, were designed and synthesized by Shanghai GenePharma Co. Ltd. Cells in logarithmic growth phase (HCT116, CT26, or CD8⁺ T cells) were transfected using Lipofectamine 3000 (L3000150, Invitrogen) following the manufacturer's protocol. Experimental groups included: control (NC, empty vector or non‐targeting siRNA), knockdown (KD, gene‐specific siRNA), and overexpression (OE, gene overexpression plasmid). At 48 h post‐transfection, puromycin (2 μg/mL final concentration) was added for 2–3 weeks of continuous selection to establish stable cell lines. Successful knockdown or overexpression was validated by Western blotting.

2.4. Western Blotting (WB)

Total protein was extracted from CRC cells, CD8⁺ T cells, or tumor tissue homogenates using RIPA lysis buffer (P0013B, Beyotime). Protein concentration was determined using a BCA assay kit (P0010, Beyotime). Equal amounts of protein (30 μg) were mixed with 5× SDS‐PAGE loading buffer, boiled for denaturation, separated by 10% SDS‐PAGE, and transferred onto PVDF membranes (Millipore). A prestained protein marker (G2058, Servicebio) was used to indicate molecular weights during electrophoresis. Membranes were blocked with 5% skim milk for 2 h at room temperature, then incubated overnight at 4°C with the following primary antibodies (1:500 dilution): INHBB (PA5‐119792, Invitrogen), ACVR2B (ab272869, Abcam), SMAD2 (12570‐1‐AP, Proteintech), SMAD3 (30130‐1‐AP, Proteintech), p‐SMAD2/SMAD3 (ab202445, Abcam), and β‐actin (20536‐1‐AP, Proteintech). After three TBST washes, membranes were incubated with HRP‐conjugated secondary antibodies (1:2000 dilution; SA00001‐2, Proteintech) for 1 h at room temperature. Protein bands were visualized using an ECL chemiluminescence kit (Millipore) and quantified using ImageJ software, with β‐actin serving as the loading control.

2.5. Transwell Migration and Invasion Assays

Migration Assay: Stable INHBB‐KD/OE (HCT116)/Inhbb‐KD/OE (CT26) CRC cells and NC controls were suspended at 1 × 10⁵ cells/mL in serum‐free medium. A 200 μL aliquot was added to the upper chamber of a Transwell insert (Corning), while the lower chamber was filled with 600 μL DMEM containing 10% FBS. After 24 h incubation, non‐migrated cells were removed, and migrated cells on the underside were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and counted in five random fields (200× magnification).

Invasion Assay: Transwell inserts were pre‐coated with 50 μL of Matrigel (356234, Corning Life Sciences; diluted 1:8 in serum‐free medium) and incubated for 30 min. Subsequent steps were identical to the migration assay.

2.6. Flow Cytometry

Cell apoptosis was assessed using the CoraLite Plus 488‐Annexin V/PI Apoptosis Detection Kit (PF00005, Proteintech). Cell proliferation was evaluated using the TransDetect EdU Imaging Kit‐647 Fluorophore (FU131‐01, TransGen). For immunophenotyping, cells were stained with fluorophore‐conjugated antibodies targeting mouse or human CD44 (65117‐1‐Ig, Proteintech, 1:200 dilution), CD62L (Mouse: 63‐0621‐82, Human: MA1‐19715, Invitrogen, 1:200 dilution), PD‐1 (14‐9969‐82, Invitrogen, 1:200 dilution), and TIM‐3 (Mouse: 25‐5870‐82, Human: 78‐3109‐42, Invitrogen, 1:200 dilution). Following incubation, cells were washed with PBS and analyzed using a flow cytometer. Data were collected and analyzed to determine apoptotic rate, EdU‐positive proliferation index, and percentages of activated versus exhausted CD8⁺ T cells.

2.7. Co‐Immunoprecipitation (Co‐IP)

CD8⁺ T cells co‐cultured with CRC cells were harvested and lysed in IP lysis buffer (P0013, Beyotime) containing protease inhibitors. A small aliquot of lysate was saved as input control. The remaining lysate was incubated overnight at 4°C with INHBB antibody, ACVR2B antibody, or control IgG, followed by incubation with Protein A/G agarose beads (P2179S, Beyotime) for 4 h. Beads were collected by centrifugation at 3000 rpm at 4°C, washed extensively with IP wash buffer, and boiled in 5× SDS‐PAGE loading buffer. Immunoprecipitated proteins were detected by Western blotting.

2.8. Immunofluorescence and Confocal Microscopy

CD8⁺ T cells co‐cultured with CRC cells were seeded on coverslips. After PBS washes, cells were sequentially fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X‐100, and blocked with 5% BSA. Cells were incubated overnight at 4°C with primary antibodies against INHBB/Inhbb and ACVR2B/Acvr2b, followed by incubation with Alexa Fluor 488‐ or 594‐conjugated secondary antibodies for 1 h at room temperature in the dark. Nuclei were counterstained with DAPI (C1006, Beyotime), and coverslips were mounted with anti‐fade mounting medium (P0126, Beyotime). Images were acquired using a laser scanning confocal microscope to visualize colocalization of INHBB and ACVR2B.

2.9. Quantitative Real‐Time PCR (qPCR)

Total RNA was extracted from human or mouse CD8⁺ T cells using TRIzol reagent (Invitrogen). RNA quality and concentration were quantified by NanoDrop spectrophotometer. Equal amounts of total RNA (1 μg) were reverse‐transcribed into cDNA using the PrimeScript RT reagent Kit (Takara). qPCR amplification was carried out on a CFX96 real‐time PCR detection system (Bio‐Rad) with SYBR Green qPCR Master Mix (Takara). The specificity of amplification was verified by melting curve analysis. Relative mRNA expression of target genes was normalized to human ACTB or mouse Actb, respectively, and calculated using the 2⁻^ΔΔCt method. All qPCR assays were performed with three independent biological replicates. The primer sequences were as follows: mouse Lag‐3 F: 5′‐CAAGCTGAAGACTGGTGATG‐3′, R: 5′‐GGTGAGGCTGGTGAAGATAA‐3′; mouse Tigit F: 5′‐CCTGAAGACATGGCTGATGA‐3′, R: 5′‐GAGGTGATGGTGAAGGTGAA‐3′; mouse Actb F: 5′‐GGCTGTATTCCCCTCCATCG‐3′, R: 5′‐CCAGTTGGTAACAATGCCATGT‐3′; human LAG3 F: 5′‐CTGGGACTGCTTTGGGAAG‐3′, R: 5′‐GGTTGATGTTGCCAGATAACCC‐3′; human TIGIT F: 5′‐CCACAGCAGGCACGATAGATA‐3′, R: 5′‐CATGCCACCCCAGGTCAAC‐3′; human ACTB F: 5′‐GGACTTCGAGCAAGAGATGG‐3′, R: 5′‐AGCACTGTGTTGGCGTACAG‐3′. All primers were used at an annealing temperature of 60°C.

2.10. ELISA

Supernatants were collected from co‐cultures of CRC cells and CD8⁺ T cells. Concentrations of TGF‐β (Mouse: ab119557, Human: ab100647, Abcam), IL‐10 (Mouse: ab255729, Human: ab185986, Abcam), IFN‐γ (PI507, Beyotime), LAG3 (BMS2211, Thermo Fisher Scientific), and TIGIT (EH454RB, Thermo Fisher Scientific) were measured using mouse‐specific ELISA kits according to the manufacturer's instructions. Cytokine levels were calculated and compared among treatment groups.

2.11. Animal Experiments

Female nude mice (6–8 weeks old, SPF grade) were purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd. Murine xenograft models were established by subcutaneously injecting 5 × 10⁶ CT26 cells (0.2 mL PBS) into the right dorsal flank. Mice were randomized into three groups (n = 5 per group): NC (parental CT26 cells), Inhbb‐KD (Inhbb knockdown CT26 cells), and Inhbb‐OE (Inhbb overexpressing CT26 cells). Tumor length (L) and width (W) were measured weekly, and volume was calculated using the formula V = 0.5 × L × W ².

For SMAD inhibition studies, an independent cohort was randomized into: NC, NC + SMAD inhibitor (SB431542; 10 mg/kg intraperitoneal injection every 2 days; Sigma), Inhbb‐OE, and Inhbb‐OE + SMAD inhibitor. After 4 weeks, mice were anesthetized with pentobarbital sodium before euthanasia. Pentobarbital sodium was prepared as an appropriate solution and administered via intraperitoneal injection at a dose of 50 mg/kg body weight. After deep anesthesia was confirmed, mice were euthanized, tumor tissues were excised, and processed for Western blotting, ELISA, and flow cytometric analyses.

All animal procedures were performed in accordance with the guidelines of the American Veterinary Medical Association (AVMA) for anesthesia and euthanasia, and all efforts were made to minimize animal suffering. All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) and conducted in accordance with institutional guidelines.

2.12. Statistical Analysis

All experiments were performed in triplicate or more. Data are presented as mean ± standard deviation (SD). Statistical analysis was conducted using GraphPad Prism 9.5 software. Comparisons between two groups were performed using unpaired Student's t‐test. Multiple group comparisons were analyzed using one‐way ANOVA followed by LSD t‐test for post hoc pairwise comparisons. p < 0.05 was considered statistically significant.

2.13. ARRIVE Guidelines Statement

This study was carried out in strict accordance with the ARRIVE 2.0 guidelines for the reporting of animal research. All animal procedures and experimental designs comply with the requirements of the ARRIVE guidelines.

3. Results

3.1. INHBB Overexpression in CRC Promotes Tumor Progression

INHBB overexpression is characteristic of multiple malignancies and is closely associated with tumor progression, distant metastasis, and chemoresistance [15, 16]. To characterize its expression pattern and functional role in CRC, we first mined TCGA data and found that INHBB was significantly upregulated in CRC tissues (Figure 1A) and its expression level was inversely correlated with patient survival prognosis (Figure 1B). To elucidate the biological functions of INHBB, we established INHBB knockdown (INHBB‐KD) and overexpression (INHBB‐OE) models in HCT116 cells, and Inhbb knockdown (Inhbb‐KD) and overexpression (Inhbb‐OE) models in CT26 CRC cell lines, and validated the efficiency of INHBB/Inhbb‐KD/OE by Western blot (Figure 1C–F). We then examined changes in cell proliferation and apoptosis after INHBB/Inhbb‐KD/OE treatment by flow cytometry. The results showed that INHBB/Inhbb‐KD significantly suppressed CRC cell proliferation, whereas INHBB/Inhbb‐OE markedly enhanced proliferative capacity (Figure 1G,H). Subsequently, we assessed cell invasion and migration following INHBB/Inhbb‐KD/OE using Transwell assays, which confirmed that INHBB‐KD profoundly attenuated metastatic and invasive potential, while INHBB/Inhbb‐OE substantially augmented migration and invasion (Figure 1I,J). Apoptosis analysis revealed that INHBB/Inhbb‐KD significantly elevated apoptosis rates, whereas INHBB/Inhbb‐OE inhibited cell death (Figure 1K,L).

FIGURE 1.

INHBB overexpression drives tumor progression in CRC. (A) The expression level of INHBB in CRC tissues was determined using data from The Cancer Genome Atlas (TCGA). (B) The correlation between INHBB expression and the survival prognosis of CRC patients was analyzed via TCGA datasets. (C–F) The efficiency of INHBB/Inhbb knockdown (INHBB/Inhbb‐KD) and overexpression (INHBB/Inhbb‐OE) in HCT116 and CT26 cells was verified by WB. (G–H) Cell proliferation of HCT116 and CT26 cells following INHBB/Inhbb‐KD/OE was assessed using flow cytometry. (I–J) Cell migration and invasion capacities of HCT116 and CT26 cells after INHBB/Inhbb‐KD/OE were evaluated via Transwell assays. (K–L) Apoptosis of HCT116 and CT26 cells upon INHBB/Inhbb‐KD/OE was detected by flow cytometry. (M–N) The effect of Inhbb‐KD/OE on in vivo tumor growth was examined using a subcutaneous xenograft model established by injecting CT26 cells into nude mice. Statistical analyses were performed with one‐way ANOVA followed by Dunnett's multiple‐comparisons test or Student's t‐test. *p < 0.05, **p < 0.01.

To validate these findings in vivo, we subcutaneously injected CT26 cells with Inhbb‐KD or Inhbb‐OE into nude mice to establish xenograft models. Inhbb‐KD markedly suppressed tumor growth, while Inhbb‐OE significantly increased tumor volume and weight (Figure 1M,N). Collectively, these data demonstrate that INHBB/Inhbb is highly expressed in CRC and drives progression by promoting tumor‐cell proliferation, enhancing metastatic capacity, and inhibiting apoptosis.

3.2. INHBB /Inhbb‐OE in CRC Induces CD8 ⁺ T Cell Exhaustion

Our preliminary bioinformatics analysis revealed a significant negative correlation between INHBB expression and CD8⁺ T cell infiltration in the CRC tumor microenvironment (Figure 2A). To functionally validate this regulatory relationship, we co‐cultured INHBB‐KD/OE (HCT116)/Inhbb‐KD/OE (CT26) CRC cells with CD8⁺ T cells for 24 h and analyzed CD8⁺ T cell proliferation and apoptosis by flow cytometry. Compared with the NC group, INHBB/Inhbb‐KD significantly enhanced CD8⁺ T cell proliferation (Figure 2B,D) and reduced apoptosis (Figure 2C,E), whereas INHBB/Inhbb‐OE produced opposite effects—suppressing proliferation and increasing apoptosis rates (Figure 2B–E). Concurrently, we measured immunomodulatory cytokine levels in co‐culture supernatants by ELISA. INHBB/Inhbb‐KD markedly decreased secretion of immunosuppressive cytokines TGF‐β and IL‐10, while INHBB/Inhbb‐OE upregulated their expression (Figure 2F–I). Flow cytometric analysis of CD8⁺ T cell activation and exhaustion markers revealed that INHBB/Inhbb‐OE significantly suppressed CD8⁺ T cell activation relative to INHBB/Inhbb‐KD (Figure 2J,L,N,P). Moreover, exhaustion marker analysis showed that INHBB/Inhbb‐KD inhibited CD8⁺ T cell exhaustion, whereas INHBB/Inhbb‐OE exacerbated exhaustion levels (Figure 2K,M,O,Q). In addition to PD‐1 and TIM‐3, we further detected other exhaustion markers LAG‐3 and TIGIT. qPCR results showed that INHBB/Inhbb‐OE significantly increased Lag‐3 and Tigit mRNA expression in CD8⁺ T cells, while INHBB/Inhbb‐KD decreased their transcription (Figure 2R,S).

FIGURE 2.

INHBB/Inhbb‐OE in CRC induces CD8⁺ T cell exhaustion. (A) The correlation between INHBB expression and CD8⁺ T cell infiltration in the CRC tumor microenvironment was analyzed using TCGA data. (B, D) Proliferation of CD8⁺ T cells co‐cultured with INHBB/Inhbb‐KD/OE CRC cells was measured by flow cytometry. (C, E) Apoptosis of CD8⁺ T cells in the above co‐culture system was detected via flow cytometry. (F–I) The secretion levels of immunomodulatory cytokines (TGF‐β and IL‐10) in the supernatant of the co‐culture system were quantified using ELISA. (J, L, N, P) Activation status of CD8⁺ T cells in the co‐culture system was assessed by flow cytometry. (K, M, O, Q) Exhaustion status of CD8⁺ T cells in the co‐culture system was determined via flow cytometry. (R, S) qPCR analysis of Lag‐3 and Tigit mRNA levels in the co‐culture system. Statistical analyses were performed with one‐way ANOVA followed by Dunnett's multiple‐comparisons test or Student's t‐test. *p < 0.05, **p < 0.01.

3.3. INHBB /Inhbb Mediates CD8 ⁺ T Cell Exhaustion Through Binding to Its Functional Receptor ACVR2B /Acvr2b

Prior studies have identified ACVR2B as a functional receptor for INHBB. To investigate the mechanism by which INHBB/Inhbb influences CD8⁺ T cell exhaustion, we first verified ACVR2B (human)/Acvr2b (murine) expression on CD8⁺ T cells. Western blot analysis showed low basal ACVR2B/Acvr2b expression in CD8⁺ T cells, which was dramatically upregulated upon co‐culture with CRC cell lines (Figure 3A,B). Immunofluorescence staining with FITC and DAPI, combined with confocal microscopy, confirmed ACVR2B/Acvr2b localization to the plasma membrane, further validating its expression on CD8⁺ T cells (Figure 3C).

FIGURE 3.

INHBB/Inhbb mediates CD8⁺ T cell exhaustion through binding to its functional receptor ACVR2B/Acvr2b. (A, B) The expression level of ACVR2B/Acvr2b in CD8⁺ T cells (before and after co‐culture with CRC cells) was detected by WB. (C) The subcellular localization of Acvr2b in CD8⁺ T cells was visualized using laser confocal microscopy. (D, E) The interaction between INHBB and ACVR2B was validated via co‐immunoprecipitation (Co‐IP) assays. (F) The colocalization of Inhbb and Acvr2b on the cell membrane was observed using laser confocal microscopy. (G) The efficiency of Acvr2b‐KD was verified by WB. (H, I) The effect of Acvr2b‐KD on Inhbb‐induced CD8⁺ T cell exhaustion was evaluated via flow cytometry, qPCR and ELISA detection. Statistical analyses were performed with one‐way ANOVA followed by Dunnett's multiple‐comparisons test or Student's t‐test. *p < 0.05, **p < 0.01.

We next examined INHBB‐ACVR2B/Inhbb‐Acvr2b binding by Co‐IP. After treating CD8⁺ T cells with INHBB/Inhbb‐His, immunoprecipitation with INHBB antibody retrieved ACVR2B/Acvr2b protein (Figure 3D); reciprocal Co‐IP with ACVR2B/Acvr2b antibody likewise captured INHBB/Inhbb protein (Figure 3E). Confocal microscopy demonstrated colocalization of ACVR2B/Acvr2b and INHBB/Inhbb at the cell membrane (Figure 3F). Based on these results, we inferred that INHBB/Inhbb engages CD8⁺ T cells in an ACVR2B/Acvr2b‐dependent manner. Functionally, flow cytometry analysis of ACVR2B/Acvr2b‐KD revealed that ACVR2B‐KD significantly reduced CD8⁺ T cell exhaustion compared with INHBB/Inhbb‐His alone (Figure 3G,H). Taken together, these findings establish that INHBB influences CD8⁺ T cell exhaustion through ACVR2B/Acvr2b. Compared with INHBB‐His treatment alone, ACVR2B‐KD not only decreased PD‐1⁺TIM‐3⁺ double‐positive CD8⁺ T cells, but also obviously lowered mRNA and soluble protein levels of LAG‐3 and TIGIT (Figure 3I).

3.4. ACVR2B /Acvr2b Influences CD8 ⁺ T Cell Exhaustion via the SMAD Signaling Pathway

Previous studies have implicated SMAD signaling in ACVR2B‐mediated CD8⁺ T cell regulation [17]. To dissect the mechanistic link between ACVR2B/Acvr2b and CD8⁺ T cell exhaustion in CRC, we co‐cultured CRC cells with CD8⁺ T cells and manipulated ACVR2B/Acvr2b expression. ACVR2B/Acvr2b‐KD suppressed SMAD pathway activation, whereas ACVR2B/Acvr2b‐OE activated the pathway (Figure 4A–E). We then performed ACVR2B/Acvr2b‐OE in CD8⁺ T cells with concurrent SMAD inhibition and assessed T cell activation and exhaustion. ACVR2B/Acvr2b‐OE increased TGF‐β and IL‐10 levels in supernatants (Figure 4F,G), reduced activated CD8⁺ T cell numbers (Figure 4H), and increased exhausted T cell populations (Figure 4I). Conversely, SMAD inhibition in ACVR2B/Acvr2b‐OE CD8⁺ T cells decreased TGF‐β and IL‐10 (Figure 4F,G), increased activated CD8⁺ T cell counts (Figure 4H), and reduced exhausted T cell numbers (Figure 4I). ACVR2B‐OE elevated LAG‐3 and TIGIT expression, whereas SMAD pathway inhibition largely abrogated this phenotype at both mRNA and secreted‐protein levels (Figure 4J). In summary, ACVR2B/Acvr2b influences CD8⁺ T cell exhaustion through SMAD‐dependent mechanisms.

FIGURE 4.

ACVR2B/Acvr2b regulates CD8⁺ T cell exhaustion through the SMAD signaling pathway. (A, B) The efficiency of Inhbb‐KD/OE in CD8⁺ T cells was verified by WB. (C) The expression levels of SMAD signaling pathway‐related proteins in CD8⁺ T cells after Acvr2b‐KD were detected by WB. (D, E) The subcellular localization and expression of SMAD‐related proteins were visualized using laser confocal microscopy. (F, G) The secretion levels of TGF‐β and IL‐10 in the supernatant of co‐cultures (containing CD8⁺ T cells with Acvr2b‐OE and treated with a SMAD pathway inhibitor) were quantified via ELISA. (H) The activation status of CD8⁺ T cells (treated with SMAD pathway inhibitor and Acvr2b‐OE) was assessed by flow cytometry. (I, J) The exhaustion status of CD8⁺ T cells (treated with SMAD pathway inhibitor and Acvr2b‐OE) was determined via flow cytometry, qPCR and ELISA detection. Statistical analyses were performed with one‐way ANOVA followed by Dunnett's multiple‐comparisons test or Student's t‐test. *p < 0.05, **p < 0.01.

3.5. In Vivo Validation

To explore the in vivo function of Inhbb, we established CT26 xenograft tumor models. Four groups of mice were used: NC, NC + Inbibitor, Inhbb‐OE and Inhbb‐OE + Inhibitor. Notably, tumor volume exhibited no significant difference between NC and NC + Inhibitor groups, indicating minimal intrinsic anti‐tumor activity of SB431542 monotherapy under our experimental dosage. As shown in Figure 5A,B, Inhbb‐OE mice developed significantly larger tumors compared with NC mice, whereas SB431542 treatment substantially reduced tumor burden in Inhbb‐OE mice. WB analysis showed that p‐Smad2/3 levels were significantly increased in Inhbb‐OE tumors, with no obvious changes in total Smad2/3 expression among groups. Only subtle changes in p‐Smad2/3 were observed between NC and NC + SB431542 groups without statistical significance. SB431542 administration efficiently blunted Smad2/3 hyper‐activation in Inhbb‐OE tumors (Figure 5C). The protein levels of Inhbb and Acvr2b remained high in both Inhbb‐OE groups and were not altered by SB431542 treatment. Consistently, ELISA results revealed increased levels of TGF‐β and IL‐10, as well as decreased IFN‐γ in Inhbb‐OE tumor tissues. Cytokine profiles were comparable between NC and NC + SB431542 groups. SB431542 restored the dysregulated cytokine milieu in Inhbb‐OE tumors (Figure 5D–F). We next analyzed tumor‐infiltrating CD8⁺ T‐cell status by flow cytometry. The frequency of PD‐1⁺TIM‐3⁺ double‐positive exhausted cells within CD45⁺CD3⁺CD8⁺ T cells was strongly increased in Inhbb‐OE tumors. SB431542 largely reversed CD8⁺ T‐cell exhaustion in Inhbb‐OE tumors (Figure 5G). Consistent with in vitro observations, the increased frequency of PD‐1⁺TIM‐3⁺ exhausted CD8⁺ T cells in Inhbb‐OE tumors, which was largely rescued by SMAD‐inhibitor administration (Figure 5G,H). Collectively, these in vivo data confirm that INHBB binds the ACVR2B complex on CD8⁺ T cells, activates the SMAD signaling axis, drives CD8⁺ T cell exhaustion, and thereby accelerates CRC progression.

FIGURE 5.

In vivo validation of Inhbb/Acvr2b/SMAD axis in CRC progression. (A, B) The effect of Inhbb‐OE and SMAD pathway inhibitor treatment on tumor growth was evaluated using a BALB/c mice xenograft model (established with Inhbb‐OE CT26 cells). (C) The expression levels of Inhbb, Acvr2b, and SMAD signaling pathway‐related proteins in mouse tumor tissues were detected by WB. (D–F) The secretion levels of TGF‐β, IL‐10, and IFN‐γ in mouse tumor tissues were quantified via ELISA. (G, H) The exhaustion status of CD8⁺ T cells in mouse tumor tissues was assessed by flow cytometry. Statistical analyses were performed with one‐way ANOVA followed by Dunnett's multiple‐comparisons test or Student's t‐test. *p < 0.05, **p < 0.01.

4. Discussion

As a globally prevalent digestive system malignancy with persistently high mortality, CRC continues to pose formidable clinical challenges, largely due to tumor heterogeneity, chemoresistance, and immune evasion [18]. Consequently, identifying pivotal molecular targets and core pathways that govern CRC progression and immune escape remains an urgent priority. INHBB, a crucial member of the TGF‐β superfamily implicated in the pathogenesis of various malignancies [19], has not been systematically characterized in CRC. Addressing this knowledge gap, our study employed integrated clinical data mining, functional cellular assays, and animal model validation to provide the first conclusive evidence that INHBB is aberrantly overexpressed in CRC and correlates with adverse clinical outcomes. Mechanistically, we demonstrated that Inhbb drives tumor progression by binding to Acvr2b on CD8⁺ T cells, activating SMAD signaling, and orchestrating CD8⁺ T cell exhaustion. These findings elucidate a previously unrecognized immunomodulatory axis and establish INHBB as a dual‐effector target linking tumor‐intrinsic malignancy with immune evasion in CRC.

Aberrant expression of TGF‐β superfamily members represents a hallmark molecular feature of malignant tumors. As a key constituent, the role of INHBB in cancer has gradually garnered attention, with previous studies confirming its overexpression in breast cancer, colon adenocarcinoma, and oral squamous cell carcinoma, where it correlates with advanced tumor stage and lymph node metastasis [20, 21, 22]. Our analysis of TCGA data revealed that INHBB is significantly upregulated in CRC tissues, and high expression is associated with markedly reduced overall survival—findings that align with its clinical characteristics in other malignancies and suggest that INHBB may serve as a universal driver of CRC progression.

Notably, prior investigations of INHBB in CRC have largely been confined to preliminary transcriptomic association analyses, lacking systematic validation of its clinical significance [23, 24]. Through integrated validation using large‐scale clinical datasets coupled with in vitro and in vivo functional experiments, our study definitively establishes the regulatory roles of INHBB/Inhbb in CRC cell proliferation, apoptosis, and metastasis—INHBB/Inhbb knockdown profoundly suppresses malignant phenotypes, whereas its overexpression accelerates tumor growth. These observations echo findings in gastric cancer where INHBB promotes epithelial‐mesenchymal transition [19]. More importantly, our study is the first to directly link INHBB expression levels with CRC patient prognosis, providing a robust foundation for its potential application as a diagnostic biomarker and prognostic indicator, thereby filling a critical gap in the existing literature. Of note, INHBB exerts context‐dependent, even opposing biological functions across distinct tumor types: INHBB suppresses invasion and metastasis in nasopharyngeal carcinoma, whereas it acts as an oncogenic driver in colorectal and gastric cancer. Such discrepancy may be partially explained by tissue‐specific expression patterns of activin/inhibin receptor complexes on tumor cells and immune cells. Different tumor tissues display variable abundance of ACVR2B, TGFBR3 and other co‐receptors, which may redirect downstream SMAD signaling outputs toward either tumor‐suppressive or tumor‐promoting programs. Moreover, differences in tumor‐intrinsic molecular background and heterogeneous tumor immune microenvironment among cancer types further shape the final biological outcome triggered by INHBB.

Remodeling of the tumor immune microenvironment constitutes a key mechanism of immune evasion in CRC, wherein the functional status of CD8⁺ T cells directly determines the efficacy of anti‐tumor immune responses [25]. Emerging evidence indicates that tumor cells induce CD8⁺ T cell exhaustion through secretion of immunosuppressive cytokines and expression of immune checkpoint ligands, with TGF‐β superfamily members playing pivotal regulatory roles in this process [26]. Our bioinformatics analysis uncovered a significant negative correlation between INHBB expression and CD8⁺ T cell infiltration in the CRC microenvironment. Subsequent functional experiments confirmed that INHBB/Inhbb, via paracrine signaling from CRC cells, suppresses CD8⁺ T cell proliferation, promotes their apoptosis, reduces activation markers such as CD69, and upregulates exhaustion markers including PD‐1 and TIM‐3, thereby elucidating the direct regulatory effect of INHBB/Inhbb on CD8⁺ T cell function. Unlike conventional immunosuppressive factors such as TGF‐β, the uniqueness of INHBB/Inhbb lies in its dual capacity to modulate both tumor cell‐intrinsic malignant phenotypes and immune cell function—it directly promotes CRC proliferation and invasion while simultaneously undermining anti‐tumor immunity by suppressing CD8⁺ T cells. This “dual‐driver” mode may explain the rapid progression and therapeutic resistance observed in CRC, offering novel insights into the suboptimal response to immunotherapy in certain CRC patients.

Elucidating the molecular mechanisms underlying signaling pathways is a prerequisite for identifying therapeutic targets. CD8⁺ T cells express Activin receptors including ACVR2B/Acvr2b, and Activin‐A—a family member—has been shown to inhibit CD8⁺ T cell infiltration and function via ACVR2/Acvr2 [27]. However, the role of the INHBB‐ACVR2B/Inhbb‐Acvr2b axis in CRC immune regulation remains undefined. Through Western blotting, confocal immunofluorescence, and Co‐IP assays, our study provides the first evidence that Acvr2b expression is significantly upregulated in CD8⁺ T cells following co‐culture with CRC cells, and that INHBB/Inhbb directly binds to ACVR2B/Acvr2b on the CD8⁺ T cell surface—discoveries that establish the critical molecular basis for INHBB/Inhbb‐mediated regulation of CD8⁺ T cell function.

The SMAD signaling pathway, as the canonical downstream effector of the TGF‐β superfamily, is aberrantly activated in CRC. Previous studies have demonstrated that SMAD2/3 phosphorylation promotes epithelial‐mesenchymal transition and metastasis [14], yet its role in CRC immune modulation remains poorly understood. Our ACVR2B/Acvr2b‐KD/OE experiments revealed that ACVR2B/Acvr2b regulates SMAD2/3/Smad2/3 phosphorylation to activate downstream signaling, while SMAD inhibition reverses INHBB/Inhbb‐induced CD8⁺ T cell exhaustion. Animal studies further demonstrated that the SMAD inhibitor SB431542 significantly attenuated Inhbb‐OE‐mediated tumor growth acceleration and CD8⁺ T cell exhaustion without affecting Inhbb or Acvr2b expression, thereby establishing the central mediating role of SMAD signaling in the Inhbb‐Acvr2b pathway.

Despite multi‐level experimental validation of INHBB/Inhbb's regulatory functions and mechanisms, several limitations warrant acknowledgment. First, all clinical expression and prognostic analyses in the present study were exclusively based on the public TCGA dataset. Although these in silico results support the clinical relevance of INHBB, external validation using an in‐house independent human CRC tissue cohort with fresh tumor and paracancerous specimens is still warranted. We are launching a prospective clinical study with multi‐center sample collection and long‐term follow‐up (pending further ethical approval) to externally verify the expression profile and prognostic performance of INHBB in CRC patients, which will be presented in our future report. Second, CD8⁺ T cells used for most in vitro functional assays were isolated from mouse spleens. These splenic T cells are phenotypically distinct from human tumor‐infiltrating lymphocytes (TILs) that undergo persistent antigen stimulation within human CRC tumor lesions. Future studies should collect multi‐center CRC tissue and serum samples to further determine the clinical diagnostic efficacy of INHBB and utilize patient‐derived tumor‐infiltrating lymphocytes to improve the translational and clinical relevance of our findings.

In summary, our study is the first to demonstrate the immunomodulatory role of the INHBB‐ACVR2B/Inhbb‐Acvr2b‐SMAD pathway in CRC, challenging the traditional view that this axis solely regulates tumor cell‐intrinsic phenotypes. We identify CD8⁺ T cells as key target cells of this signaling pathway, thereby completing the molecular network of immune evasion in CRC. This mechanistic insight positions INHBB, ACVR2B, and SMAD signaling as potential therapeutic targets for CRC immunotherapy, opening avenues for developing multi‐target combination strategies (Figure 6).

FIGURE 6.

Graphical abstract. Schematic diagram illustrating that INHBB promotes colorectal cancer progression by inducing CD8⁺ T cell exhaustion via the ACVR2B‐SMAD signaling axis.

Author Contributions

Guanghui Liu: conceptualization, investigation, methodology, writing – original draft, supervision, funding acquisition, project administration. Yuanhua Liu: investigation, data curation, formal analysis, writing – review and editing. Hongchao Zhao: investigation, software, validation, data curation. Junfeng Sun: investigation, resources, visualization. Hongwei Yang: methodology, software, writing – review and editing. Qingqing Ding: data curation, formal analysis, visualization.

Funding

This work was supported by Key scientific Research Project Plan of Colleges and universities of Henan Province (Grant numbers: 23A320014).

Ethics Statement

This study was performed in accordance with the ethical standards of the institutional and national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. Registry and the Registration No. of the study/trial: N/A. Since this study was based on publicly available databases, no additional ethical approval or informed consent was required for the data analysis part, which was exempted from ethical review in accordance with the relevant regulations of the Research and Clinical Trial Ethics Committee of the First Affiliated Hospital of Zhengzhou University. All animal experiments were conducted in accordance with internationally accepted principles for the care and use of laboratory animals, and were approved by the Research and Clinical Trial Ethics Committee of the First Affiliated Hospital of Zhengzhou University (Approval No: HLK‐20230621‐001). All animal procedures were performed in accordance with the guidelines of the AVMA for anesthesia and euthanasia. Animals were anesthetized with pentobarbital sodium and euthanized via cervical dislocation or overdose of anesthesia, and all efforts were made to minimize suffering.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.