Generation of two induced pluripotent stem cell lines from Fabry disease patients carrying GLA mutations

Abstract

Fabry disease is a rare genetic disease caused by loss-of-function in the GLA gene. This gene encodes the lysosomal enzyme α-galactosidase A (α-Gal A). A deficiency of α-Gal A results in the globotriaosylceramide buildup throughout the major organs, which is associated with increased mortality from cardiac disease in patients with Fabry disease. Both females and males are affected by this X-linked disease. We generated and characterized induced pluripotent stem cell (iPSC) lines from peripheral blood mononuclear cells (PBMCs) of two female patients carrying a heterozygous GLA mutation. The two Fabry disease patient-derived iPSC lines are thoroughly characterized and genetically accurate, valuable human cell resources for preclinical research.

1.

Resource table

Unique stem cell lines identifier	1. SCVIi164-A 2. SCVIi165-A
Institution	Stanford Cardiovascular Institute, Stanford, CA, USA
Contact information of distributor	Joseph C. Wu, joewu@stanford.edu
Type of cell lines	iPSC
Origin	Human
Additional origin info required	SCVIi164-A Age: 13; Sex: Female; Ethnicity: Hispanic or Latino SCVIi165-A Age: 51; Sex: Female; Ethnicity: White/Caucasian
Cell Source	PBMCs (both lines)
Clonality	Clonal
Method of reprogramming	Non-integrating Sendai virus expressing human OCT4, SOX2, KLF4, and c-MYC
Genetic Modification	Yes
Type of Genetic Modification	Hereditary
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	RT-qPCR
Associated disease	Fabry disease
Gene/locus	GLA; Xq22.1, single nucleotide variant
Mutation details	SCVIi164-A: heterozygous GLA c.898C > T (p.Leu300Phe); SCVIi165-A: heterozygous GLA c.868A > C (p.Met290Leu)
Date archived/stock date	SCVIi164-A: 12/26/2025; SCVIi165-A: 12/26/2025
Cell line repository/bank	https://hpscreg.eu/cell-line/SCVIi164-A https://hpscreg.eu/cell-line/SCVIi165-A
Ethical approval	The generation of the lines was approved by the Administrative Panel of Human Subjects Research (IRB) under IRB #29904 “Derivation of Human Induced Pluripotent Stem Cells.”

2. Resource utility

Patient-derived iPSCs are a powerful tool to thoroughly investigate genetic diseases by modeling diseases in a dish and unveiling their potential roles in organ-specific pathophysiology. This current study has generated and characterized two Fabry disease iPSC lines, carrying heterozygous mutations in the GLA gene, that contribute to cardiomyopathy and nephropathy in patients. These patient-specific iPSC lines will serve as a critical tool for differentiation into cardiovascular cell types in order to study molecular mechanisms of diseases and perform preclinical drug screening assays for enzyme replacement therapies and gene-editing strategies. Although Fabry disease was previously considered predominantly a male disorder, heterozygous females develop a broad spectrum of cardiac, renal, and neurological manifestations whose underlying mechanisms remain incompletely understood, in large part due to the modifying effects of X-chromosome inactivation (Izhar et al., 2023). Female-derived iPSC lines therefore provide a necessary resource to model sex-specific disease pathophysiology and to investigate phenotypic variability in this X-linked disorder (see Table 1).

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography bright field	Visual record of the line: normal	Fig. 1A
Genotype	Karyotype / copy-number (LP-WGS)	Low-pass whole-genome sequencing (LP-WGS): normal genome-wide copy-number profile; 46,XX (SCVIi164-A and SCVIi165-A)	Fig. 1H
Phenotype	Qualitative analysis: IF staining	Positive expression of undifferentiated hPSC state markers NANOG, SOX2 and OCT3/4 in both lines	Fig. 1E
	Quantitative analysis: RT-qPCR	Positive expression of undifferentiated hPSC state markers NANOG and SOX2 in both lines; absent in differentiated CMs	Fig. 1B
Identity	STR analysis	Matching of 16 loci tested	Available with authors
Mutation analysis	Sequencing	Heterozygous mutations: SCVIi164-A; GLA (c.898C > T) p.Leu300Phe SCVIi165-A; GLA (c.868A > C) p.Met290Leu	Fig. 1G
Microbiology and Virology	Mycoplasma	Mycoplasma testing by luminescence: Negative	Fig. 1D
Donor screening	HIV 1 + 2, Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info	Blood group genotyping, HLA tissue typing	N/A	N/A

3. Resource details

Fabry disease is a rare genetic disease associated with lysosomal storage dysfunction (Pieroni et al., 2021). Genetically, a loss-of-function mutation in the GLA gene, which encodes the lysosomal enzyme α-galactosidase A (α-Gal A), causes this disease (Zhou et al., 2018). Lower α-Gal A activity progressively allows the deposition of globotriaosylceramide throughout the body, contributing to the development of cardiac diseases in adult patients (Germain, 2010), and a leading cause of mortality in these patients. Therefore, generating patient-derived iPSCs allows disease modeling in a dish and utilizes the resource for drug development (Yildirim et al., 2025).

We have generated induced pluripotent stem cell (iPSC) lines SCVIi164-A and SCVIi165-A from PBMCs of a 13-year-old Hispanic female and a 51-year-old White/Caucasian female, both of whom carry a heterozygous mutation in the GLA gene. The mutations were c.898C > T (p.Leu300Phe) and c.868A > C (p.Met290Leu), for lines SCVIi164-A and SCVIi165-A, respectively. These two Fabry disease iPSC lines were reprogrammed by introducing Sendai virus vectors encoding SOX2, KLF4, OCT4, and c-MYC, followed by clonal selection.

We observed that both lines exhibit typical pluripotent stem cell morphology (Fig. 1A) and show elevated mRNA expression of SOX2 and NANOG compared to differentiated iPSC-cardiomyocytes (iPSC-CMs; negative control) (Fig. 1B). Notably, after passage 23, both iPSC lines showed a marked reduction in Sendai viral genome content compared to early-passage controls (passage 8; Fig. 1C), confirming the loss of exogenous reprogramming factors. We detected that iPSC lines were negative for mycoplasma contamination at passage 23 (Fig. 1D). In addition, immunofluorescence analysis confirmed robust expression of pluripotency markers SOX2, OCT3/4, and NANOG in both iPSC lines (Fig. 1E, scale bar: 130 μm). Furthermore, the potential for trilineage differentiation was validated by immunostaining for endoderm (SOX17, and FOXA2), mesoderm (Brachyury, and TBX6), and ectoderm (OTX2, and PAX6) germ layer–specific markers, following directed differentiation protocols (Fig. 1F, scale bar: 130 μm).

Fig. 1. Characterization of iPSC lines derived from Fabry disease patients carrying GLA mutations.

(A) Representative brightfield images showing normal pluripotent colony morphology of the two generated iPSC lines (SCVIi164-A and SCVIi165-A). (B) RT-qPCR analysis of pluripotency markers SOX2 and NANOG in iPSCs compared to differentiated iPSC-derived cardiomyocytes (iPSC-CMs; negative control). (C) RT-qPCR analysis demonstrating loss of Sendai virus (SeV) reprogramming vectors at passage 23 compared to passage 8. (D) Luminescence-based testing confirming negative mycoplasma status in both iPSC lines at passage 23. (E) Representative immunofluorescence images confirming expression of pluripotency markers NANOG (red), SOX2 (green), and OCT3/4 (magenta) in both iPSC lines. Nuclei are stained with DAPI (blue). Scale bar: 130 μm. (F) Immunofluorescence staining verifying in vitro differentiation into endoderm (SOX17, FOXA2), mesoderm (Brachyury, TBX6), and ectoderm (OTX2, PAX6) lineages. Scale bar: 130 μm. (G) Sanger sequencing chromatograms confirming heterozygous GLA mutations in patient PBMCs and derived iPSC lines (mutant variants indicated by arrows and dashed boxes). (H) Low-pass whole-genome sequencing (LP-WGS) copy-number profile at passage 15 showing normal genome-wide integrity without gross chromosomal abnormalities for both iPSC lines.

Sanger sequencing analysis further confirmed the existence of the respective GLA mutations (c.898C > T in SCVIi164-A and c.868A > C in SCVIi165-A) in both iPSC lines and their respective PBMCs (Fig. 1G). We also performed karyotyping, which verified normal chromosomal stability in each line (Fig. 1H). In addition, STR profiling confirmed the donor-specific identity of each iPSC line with its parental PBMCs (data archived).

4. Materials and methods

4.1. Reprogramming

PBMCs were isolated from whole blood samples of Fabry disease patients by Percoll^® density gradient centrifugation (GE Healthcare, #17089109). Cells were washed thoroughly with Dulbecco’s phosphate-buffered saline (DPBS; Thermo Fisher Scientific, #14190144) and cultured in StemPro^®-34 SFM medium (Thermo Fisher Scientific, #10639011) supplemented with 100 ng/mL stem cell factor (SCF; Peprotech, #300-07), 100 ng/mL FLT3 ligand (Thermo Fisher Scientific, #PHC9414), and 20 ng/mL each of interleukin-3 (IL-3; Peprotech, #200-3), interleukin-6 (IL-6; Thermo Fisher Scientific, #PHC0063), and erythropoietin (EPO; Thermo Fisher Scientific, #PHC9631). Medium was replaced every two days. A total of 3 × 10⁵ PBMCs per donor were reprogrammed using the CytoTune^™-iPSC 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, #A16517) per the manufacturer’s instructions, which delivers the four Yamanaka factors (OCT4, SOX2, KLF4, and c-MYC). Transduced PBMCs were plated onto Matrigel-coated plates (Corning, #356231) in StemPro^®-34 medium. Seven days post-transduction, the medium was changed to StemMACS^™ iPS-Brew XF (Miltenyi Biotec, #130–104–368). Emerging iPSC colonies appeared between days 10–15, after which they were manually picked, expanded, and cryopreserved.

4.2. Cell culture

Established iPSC lines were maintained in StemMACS^™ iPS-Brew XF medium (Miltenyi Biotec, #130–107-086) with its corresponding supplement (Miltenyi Biotec, #130–107-087). Upon reaching confluency, cells were passaged using 0.5 mM EDTA (Invitrogen, #15575–038) and replated on Matrigel-coated culture dishes. After passaging, 10 μM ROCK inhibitor (Y-27632; Selleck Chemicals, #S1049) was added to the culture medium for 24 h to promote survival (Jimenez-Tellez et al., 2023). Media were refreshed daily, and cells were maintained in a humidified incubator at 37 °C with 5 % CO₂.

4.3. RT-qPCR

To assess the expression of undifferentiated hPSC state markers and the clearance of reprogramming vectors, iPSCs at passage 23 were analyzed for the expression of NANOG and SOX2 transcripts, as well as Sendai virus genome content. A previously characterized iPSC line from a healthy donor was used as a positive control, and iPSC-derived cardiomyocytes (iPSC-CMs) were used as a negative control. Total RNA was isolated from Fabry iPSC lines, the positive control iPSC line, and iPSC-CMs using the RNeasy Mini Kit (QIAGEN, #74104), according to the manufacturer’s protocols. First-strand cDNA synthesis was performed using the iScript^™ cDNA Synthesis Kit (Bio-Rad, #1708891). RT-qPCR was carried out using predesigned TaqMan^® Gene Expression Assays (see Table 2 for probe details).

Table 2.

Reagent details.

Category	Antibody	Dilution	Company & Catalog #	RRID
hiPSC state marker	Rabbit Anti-Nanog	1:200	Proteintech Cat #14295–1-AP	AB_1607719
hiPSC state marker	Mouse IgG2bκ Anti-Oct-3/4	1:200	Santa Cruz Biotechnology Cat #sc-5279	AB_628051
hiPSC state marker	Mouse IgG1κ Anti-Sox2	1:200	Santa Cruz Biotechnology Cat #sc-365823	AB_10842165
Ectoderm marker	Goat Anti-Otx2	1:200	R&D Systems Cat # AF1979	AB_2157172
Ectoderm marker	Rabbit Anti-Pax6	1:100	Thermo Fisher Scientific Cat #42–6600	AB_2533534
Endoderm marker	Goat Anti-Sox17	1:200	R&D Systems Cat # AF1924	AB_355060
Endoderm marker	Rabbit Anti-Foxa2	1:250	Thermo Fisher Scientific Cat #701698	AB_2576439
Mesoderm marker	Goat Anti-Brachyury	1:200	R&D Systems Cat # AF2085	AB_2200235
Mesoderm marker	Rabbit Anti-Tbx6	1:200	Thermo Fisher Scientific Cat #PA5-35102	AB_2552412
Secondary antibody	Alexa Fluor 488 Goat Anti-Mouse IgG1	1:1000	Thermo Fisher Scientific Cat #A-21121	AB_2535764
Secondary antibody	Alexa Fluor 488 Donkey Anti-Goat IgG (H + L)	1:1000	Thermo Fisher Scientific Cat #A-11055	AB_2534102
Secondary antibody	Alexa Fluor 555 Goat Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific Cat #A-21428	AB_141784
Secondary antibody	Alexa Fluor 647 Goat Anti-Mouse IgG2b	1:250	Thermo Fisher Scientific Cat #A-21242	AB_2535811
Category	Target	Size of Band	Primer Sequence (5′–3′) / TaqMan Assay ID
Sendai virus Plasmids (qPCR)	Sendai virus genome	181 bp	Mr04269880_mr
Genotyping	SCVIi164-A; GLA (c.898C > T); heterozygous SCVIi165-A; GLA (c.868A > C); heterozygous	435 bp	F: TGTTGCTGGACCAGGGGGTTGG R: CTTGCTTGCCCAAGGGGTCCTG
House-keeping gene (qPCR)	GAPDH	471 bp	Hs02786624_g1
Undifferentiated hPSC state marker (qPCR)	SOX2	258 bp	Hs04234836_s1
Undifferentiated hPSC state marker (qPCR)	NANOG	327 bp	Hs02387400_g1

4.4. Trilineage differentiation

Trilineage differentiation was performed using passage 20 iPSC lines to confirm all three primary germ layers. Ectoderm differentiation was induced using the Human Pluripotent Stem Cell Functional Identification Kit (R&D Systems, #SC027B), according to the manufacturer’s instructions. Endoderm differentiation was achieved using the STEMdiff^™ Definitive Endoderm Differentiation Kit (STEMCELL Technologies, #05110). For mesoderm induction, iPSCs were cultured in RPMI medium (Gibco, #11875085) supplemented with B27 Minus Insulin (Gibco, #A18956-01) and 6 μM CHIR99021 (Selleck Chemicals, #S2924) for 48 h.

4.5. Immunofluorescence staining

Immunofluorescence was conducted on Fabry iPSCs at passage 20 to assess the expression of key undifferentiated hPSC state markers. Cells were fixed in 4 % paraformaldehyde (Thermo Fisher Scientific, #50980487) for 15 min at room temperature (RT), then permeabilized using 0.1 % PBST (Sigma-Aldrich, #9036–19–5) for 10 min. Blocking was performed for 1 h at RT in 0.1 % PBST containing 5 % Donkey Serum (Sigma-Aldrich, #D9663) or Goat Serum (Sigma-Aldrich, #G9023), depending on the host species of the secondary antibody. Fixed and blocked cells were incubated overnight at 4 °C with primary antibodies (see Table 2), followed by three PBS washes and 60-min incubation at RT with corresponding fluorescent secondary antibodies and DAPI solution (62248, Invitrogen) (Zushin et al., 2023). Fluorescent images were acquired using an ECHO Revolve fluorescence microscope.

4.6. Karyotyping

At passage 15, low-pass whole-genome sequencing (LP-WGS) was performed for each iPSC line to assess the karyotype. For each iPSC line, LP-WGS was performed to 1 × coverage with 150-bp paired-end reads on a NovaSeq platform (Tan et al., 2025). Reads were aligned to the human reference genome (GRCh38) using Bowtie2 (RRID: SCR_016368). SAMtools (RRID: SCR_002105) was used to convert, sort, and index BAM files. GATK MarkDuplicates (RRID: SCR_001876) was used to flag duplicate reads. The per-site sequencing depth was generated using SAMtools, and karyotype plots were produced using the R package karyoploteR (RRID: SCR_021824). A Log R Ratio plot was made to assess genome-wide copy number and ploidy stability.

4.7. Sanger sequencing

Genomic DNA was extracted from iPSCs as described in Section 4.9, and regions surrounding the GLA mutations were amplified using GoTaq Green Master Mix (Promega, Cat #M7122) with region-specific primers (see Table 2). PCR conditions included initial denaturation at 98 °C for 2 min; 30 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min; then 72 °C for 5 min. PCR products were submitted to Elim Biopharm (Hayward, CA) for PCR cleanup and sequencing. The forward PCR primer was also used as the sequencing primer.

4.8. Mycoplasma detection

Mycoplasma contamination testing was performed on both Fabry iPSC lines at passage 23 using the MycoAlert^™ Mycoplasma Detection Kit (Lonza, #LT07-318) in accordance with the manufacturer’s protocol.

4.9. Short Tandem Repeat (STR) analysis

STR profiling was used to confirm the identity and genetic origin of the Fabry iPSC lines. Genomic DNA was extracted from both PBMCs and corresponding iPSC lines at passage 20 using the DNeasy^® Blood & Tissue Kit (Qiagen, #69504). STR amplification was performed using the AmpFLSTR^™ Identifiler^™ Plus PCR Amplification Kit (Applied Biosystems #4427368). Capillary electrophoresis was carried out on an ABI 3130xl Genetic Analyzer at GENEWIZ.

Data availability

Data will be made available on request.