Omega-3 PUFAs Mitigate Polytrauma-Induced Gut-Liver-Lung Inflammation and Organ Dysfunction via GPR120/PPAR-γ

Abstract

Background

Severe polytrauma frequently triggers a systemic inflammatory response, culminating in fatal Multiple Organ Dysfunction Syndrome (MODS). Although Omega-3 polyunsaturated fatty acids (PUFAs) possess well-documented anti-inflammatory properties, their role in modulating the gut—liver—lung inflammatory axis following polytrauma remains to be fully elucidated. This study investigated whether targeted Omega-3 PUFA administration could mitigate post-traumatic MODS, alongside concurrent changes in intestinal homeostasis and the GPR120/PPAR-γ signaling axis linked to TLR4/NLRP3-associated hyper-inflammation.

Methods

Male Sprague-Dawley rats were randomly assigned (computer-generated randomization, n = 6 per group) to Sham, Polytrauma (blunt abdominal trauma + tibial-fibular fracture), and Omega-3 group (300 mg/kg/day via oral gavage). The therapeutic intervention commenced 24 h post-injury and continued daily for 7 consecutive days, with endpoint measurements performed at Day 7. Histological assessments were conducted by investigators blinded to group allocation. We assessed organ injury markers, histological integrity, pro-inflammatory cytokine profiles, colonic GPR120-associated signaling pathways, and the fecal microbiome via 16S rRNA sequencing (n = 6 fecal samples per group).

Results

Omega-3 PUFA administration attenuated polytrauma-induced organ dysfunction (n = 6 per group). Specifically, treatment reduced serum ALT by 51.4% (51.3 ± 8.2 vs 105.6 ± 12.4 U/L in Model group, P = 0.008), AST by 42.4% (141.2 ± 18.5 vs 245.1 ± 22.3 U/L in Model group, P = 0.009), and CK by 48.2% (854.5 ± 112.4 vs 1650.3 ± 156.8 U/L in Model group, P < 0.001). Histological analysis confirmed alleviation of lung injury (score: 2.1 ± 0.2 vs 3.5 ± 0.3; P = 0.012), liver injury (1.7 ± 0.3 vs 3.2 ± 0.2; P = 0.005), and intestinal damage (Chiu’s score: 1.6 ± 0.3 vs 3.2 ± 0.2; P = 0.008), alongside preserved goblet cell counts and ZO-1 expression. 16S rRNA sequencing (n = 6 per group) further revealed recovery in microbial alpha-diversity. Compared with the Model group, the Omega-3 group exhibited increased Shannon index (4.02 ± 0.18 vs 3.41 ± 0.32, P = 0.008) and Chao1 index (442.6 ± 41.5 vs 368.2 ± 39.1, P = 0.006). Taxonomic differences across groups were determined using Linear Discriminant Analysis Effect Size (LEfSe). Western blot and qRT-PCR analyses indicated that these protective phenotypic changes were associated with reduced expression of TLR4, NLRP3, and p-p65/total p65 ratio, as well as upregulation of GPR120 and PPAR-γ.

Conclusion

Targeted Omega-3 PUFA administration may mitigate polytrauma-induced systemic inflammation and multi-organ dysfunction. These protective effects appear to be associated with maintained intestinal barrier integrity, altered gut microbiota composition, and shifts in GPR120/PPAR-γ pathway activity. These findings suggest that Omega-3 PUFAs warrant further preclinical and translational evaluation as a potential immunonutritional strategy for traumatic MODS management.

Introduction

Severe polytrauma remains a leading cause of mortality and disability worldwide, ranking first among young adults.¹ Despite advances in damage control surgery, survivors are frequently vulnerable to a “second hit”: a substantial proportion of patients develop systemic inflammatory response syndrome (SIRS), which can rapidly escalate into multiple organ dysfunction syndrome (MODS).² Mortality from MODS peaked at approximately 70% in clinical series from the late 1970s to early 1980s, yet contemporary outcomes have become increasingly heterogeneous, with traumatic brain injury (TBI) emerging as the predominant predictor of fatality in modern cohorts.^3,4 Although resuscitation and supportive strategies remain the cornerstones of intensive care,⁵ they frequently fail to arrest the trauma-induced hyper-inflammatory storm. Consequently, there is an urgent clinical need for targeted immunomodulatory interventions that can recalibrate the host immune response and block the progression from SIRS to MODS.⁶

The intestinal tract has long been hypothesized to act as a pivotal driver—often referred to as the “motor”—in the cascade leading to systemic inflammation and subsequent MODS following trauma.^7,8 Under the extreme physiological stress of trauma, splanchnic vasoconstriction triggers microcirculatory dysfunction and ischemia-reperfusion injury, leading to the “leaky gut” phenomenon.⁹ Concurrently, traumatic stress rapidly induces severe gut dysbiosis, characterized by a depletion of beneficial commensals and an overgrowth of opportunistic pathobionts. This dual insult of physical barrier disruption and microbial ecological imbalance facilitates the uncontrolled translocation of gut bacteria and their pathogen-associated molecular patterns (PAMPs, eg, LPS) into the systemic circulation.^10,11 This gut-origin endotoxemia triggers secondary immune injuries in distant vital organs, such as the lungs and liver, establishing a pathological gut—liver—lung inflammatory axis.^12,13 Therefore, restoring gut homeostasis and mucosal barrier function represents a pivotal strategy to interrupt the vicious cycle of MODS.

At the molecular level, impaired intestinal barrier integrity facilitates the translocation of gut-derived endotoxins (eg, LPS), which initiates the TLR4/NF-κB signaling cascade—a major contributor to systemic hyper-inflammation.^14,15 Following LPS recognition, TLR4 triggers NF-κB activation and increases the secretion of pro-inflammatory cytokines (eg, TNF-α, IL-6), while simultaneously priming the NLRP3 inflammasome to amplify inflammatory responses through the maturation of IL-1β and IL-18.^16,17 To limit excessive inflammatory activation, the host relies on endogenous negative regulatory pathways, with the nuclear transcription factor PPAR-γ serving a central protective role. Multiple pathological stress states feature finely tuned molecular circuits restraining exaggerated inflammatory responses.¹⁸ PPAR-γ signaling mediates the trans-repression of NF-κB activity and restrains NLRP3 inflammasome assembly, which may help restore intestinal immune homeostasis.^19–21 However, how dietary lipid interventions can engage this endogenous inhibitory program to counterbalance TLR4/NF-κB/NLRP3-driven inflammation under traumatic stress remains unclear.

Notably, G-protein-coupled receptor 120 (GPR120) acts as a primary upstream membrane sensor for lipid mediators capable of inducing PPAR-γ activation. This interconnected regulatory network forms the basis of our working hypothesis: exogenous bioactive lipids, specifically Omega-3 polyunsaturated fatty acids (PUFAs) such as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), function as high-affinity ligands for GPR120.^22,23 Building on this evidence, we hypothesized that by activating the GPR120/PPAR-γ axis, Omega-3 PUFAs could attenuate trauma-driven inflammatory cascades.^24,25 Furthermore, emerging evidence suggests that targeted Omega-3 PUFA administration not only modulates these signaling pathways but also actively remodels the gut microbiota composition, fostering a pro-homeostatic microbial environment that reinforces mucosal integrity.^26,27 Nevertheless, whether this axis can be harnessed therapeutically in the complex milieu of severe polytrauma has not been tested.

Despite these advances, several critical knowledge gaps impede the clinical translation of Omega-3-based immunomodulation in trauma care. First, although extensive experimental studies have demonstrated the efficacy of Omega-3 PUFAs in distinct models of critical illness—such as sepsis and ischemia-reperfusion injury^28–31—and clinical evidence suggests favorable outcomes of lipid-modulated nutrition in acute critical care settings.³² However, clinical trials in sepsis and acute respiratory distress syndrome have yielded inconsistent results, leaving the translational value of Omega-3 supplementation highly context-dependent and debated. Crucially, their therapeutic efficacy within the specific, hyper-catabolic, high-stress milieu of severe polytrauma remains largely uncharacterized. The complex pathophysiological trajectory of polytrauma distinguishes it from these other inflammatory conditions, limiting the direct applicability of existing findings. Second, while the microbiome-remodeling effects of Omega-3 PUFAs have been documented in metabolic disorders,^33–36 whether targeted supplementation can reverse the profound dysbiosis triggered by acute traumatic stress—and whether such ecological restoration is causally linked to multi-organ protection—has not been systematically examined. Third, the molecular mechanisms by which Omega-3 PUFA engages membrane lipid sensors such as GPR120 to activate the PPAR-γ anti-inflammatory axis in the context of gut barrier injury remain incompletely understood, particularly regarding the potential crosstalk with the TLR4/NF-κB/NLRP3 pathways. Finally, no study to date has integrated gut microbial profiling, intestinal barrier assessment, and multi-organ pathological evaluation within a single standardized severe polytrauma model to elucidate the upstream mechanisms of Omega-3 PUFA intervention.

To fill these unresolved gaps, the present study incorporates several distinguishing design features: a standardized severe polytrauma rat model; Omega-3 supplementation initiated at 24 h post-insult mimicking clinical early enteral feeding; coordinated analysis spanning gut microbiota, intestinal barrier integrity, and distant liver and lung injury across the gut–liver–lung axis; and concurrent characterization of the reciprocal GPR120/PPAR-γ and TLR4/NF-κB/NLRP3 signaling networks. We systematically investigated whether early Omega-3 intervention concurrently restores gut microbial homeostasis, reinforces intestinal barrier integrity, and activates the GPR120/PPAR-γ axis to attenuate TLR4/NF-κB/NLRP3-mediated inflammation, thereby conferring protection against distant organ injury (liver and lung). We hypothesized that the therapeutic efficacy of Omega-3 PUFAs in polytrauma is mediated through this integrated gut—liver—lung immunomodulatory mechanism.

Methods

Animals and Ethics Statement

Eighteen specific-pathogen-free (SPF) male Sprague-Dawley (SD) rats (aged 6–8 weeks, weighing 200–220 g) were procured from Beijing Sibeifu Bioscience Co., Ltd. (Beijing, China). Male Sprague-Dawley rats were selected for this study to avoid confounding variability introduced by estrogen signaling and estrous cycle fluctuations, factors reported to modulate systemic inflammatory responses and gut microbial composition. The animals were housed in a barrier-sustained SPF facility under strictly controlled environmental parameters (temperature: 22 ± 2 °C, relative humidity: 50 ± 10%, 12-h light/dark cycle). During the 7-day acclimatization period and throughout the entire experiment, all rats were provided ad libitum access to a standardized basal diet (AIN-93G diet, Trophic Animal Feed High-Tech Co., Ltd., China) and sterile drinking water. Notably, the AIN-93G diet utilizes soybean oil (7% w/w) as its sole lipid source, which inherently provides a high ratio of Omega-6 (primarily linoleic acid) to Omega-3 fatty acids. Maintaining this standard, high-n-6 dietary background across all groups allowed us to rigorously evaluate whether the targeted therapeutic administration of Omega-3 PUFAs (300 mg/kg/day) could effectively shift the host’s lipid balance toward an anti-inflammatory phenotype under severe traumatic stress. Given the downstream 16S rRNA gut microbiota analysis, stringent sterile protocols were implemented to preclude exogenous microbial contamination. All housing materials, including cages, bedding, and feed, were autoclaved prior to use, and routine husbandry was exclusively conducted within a laminar flow biosafety hood. No animals or data points were excluded from the analysis.

Sample size was determined a priori using a power analysis (G*Power 3.1). Based on our preliminary laboratory observations and published data from comparable polytrauma animal models,³⁷ we assumed a large effect size (Cohen’s f = 0.45) for the primary outcomes, including histological injury scores and serum pro-inflammatory cytokine concentrations, with α = 0.05 and desired power (1−β) = 0.80. The analysis indicated a minimum of 5 animals per group for one-way ANOVA; accordingly, we enrolled 6 animals per group to provide a modest margin for potential attrition. All 18 animals completed the experimental protocol without mortality or data exclusion. It should be acknowledged that although the power calculation supported n = 6 per group, this sample size remains relatively small, which may restrict the ability to detect subtle between-group differences. Follow-up experiments with larger cohorts would help confirm these preliminary findings.

All animal protocols and experimental procedures were formally approved by the Animal Ethics Committee of Peking University People’s Hospital (Approval No. 2023PHB071-001). Furthermore, the study was conducted in strict adherence to the NIH Guide for the Care and Use of Laboratory Animals and is reported in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines.

Establishment of the Severe Polytrauma Model and Therapeutic Intervention

We established a standardized polytrauma model designed to mimic severe polytrauma in humans with an estimated Injury Severity Score (ISS) > 16. This severity classification was derived from the combination of specific injuries: a standardized grade-II liver contusion,³⁸ a closed femur fracture, and a major soft tissue contusion. Unlike the human Abbreviated Injury Scale (AIS), injury severity in this model was determined by the mechanical parameters and the extent of macroscopic anatomical damage confirmed immediately after induction. Rats were fasted for 12 hours pre-procedure and anesthetized using isoflurane (5% for induction, 2% for maintenance via a nose mask). The specific trauma protocol consisted of two consecutive components:

1. Blunt Abdominal Trauma: A custom-made weight-drop impactor was utilized. A 200-g metal weight was dropped vertically through a guide tube from a height of 50 cm, impacting the upper abdomen (xiphoid–renal triangle) to induce severe visceral injury. The injury magnitude is roughly analogous to an Abbreviated Injury Scale (AIS) grade 3 lesion in human trauma classification, though formal human-derived AIS scoring cannot be directly applied to rodent models. Abdominal trauma was confirmed immediately post-impact via direct visualization of liver laceration depth and intraperitoneal hemorrhage volume.³⁹

2. Skeletal Fracture: Immediately following the abdominal impact, a unilateral closed tibial-fibular fracture was induced by clamping the mid-shaft of the lower limb with sterile bone rongeurs; this injury is also approximately comparable to an AIS grade 3 injury in human trauma taxonomy. Fracture formation was verified by palpable crepitus, abnormal movement at the injury site, and visible limb deformity.

This combined liver contusion plus long bone fracture paradigm has been utilized in several published rodent polytrauma investigations to produce a severe trauma phenotype representative of high-risk multiple injuries.^40,41 Physiological status was monitored perioperatively, and postoperative animal well-being was assessed daily using a standardized clinical scoring system covering posture, piloerection, spontaneous mobility, and feeding behavior. Humane endpoints were strictly predefined, including persistent respiratory depression (< 30 breaths per minute), complete loss of feeding capacity, or severe neurological dysfunction requiring early euthanasia. Notably, all animals in this study recovered successfully; none met the criteria for premature euthanasia, resulting in a 100% survival rate throughout the 7-day observation period.

Following acclimatization, the rats were randomly assigned into three experimental groups using a computer-generated randomization schedule (SPSS version 26.0, IBM Corp., Armonk, NY, USA): (1) Control group (Sham procedure + Vehicle); (2) Model group (Polytrauma induction + Vehicle); and (3) Omega-3 group (Polytrauma induction + Omega-3 PUFAs).

Dietary Omega-3 PUFA Intervention

Starting 24 hours post-trauma, rats in the Omega-3 group received a daily intragastric gavage of n-3 PUFAs at a dose of 300 mg/kg body weight. Severe traumatic insult triggers an immediate pro-inflammatory burst. Published rodent polytrauma data demonstrate that damage-associated molecular patterns such as HMGB1 rise within 6–24 h, accompanied by early expansion of MDSCs as an early marker of emerging immune suppression.⁴² The transition from predominant SIRS toward a mixed pro- and anti-inflammatory response phenotype occurs within the 24–72 h window,⁴³ marked by subsequent shifts in circulating TNF-α and IL-6.⁴⁴ We therefore selected 24 h post-trauma for intervention, a time point falling within this critical transitional interval to modulate progressive secondary inflammatory cascades.^45,46

High-purity eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) were purchased individually from Sigma-Aldrich (St. Louis, MO, USA; EPA: Catalog No. E2011, ≥99% purity; DHA: Catalog No. D2534, ≥98% purity). The EPA and DHA were mixed at a mass/weight ratio of 1.5:1 immediately prior to preparation of the daily gavage emulsion to ensure a constant EPA:DHA ratio and minimize oxidation. All emulsions were freshly prepared on each experimental day and protected from light to limit lipid peroxidation during administration. To guarantee uniform delivery, the lipid preparation was emulsified in sterile saline containing 1% Tween-80 to create a stable and homogenous suspension for accurate volumetric dosing. Crucially, an identical vehicle containing 1% Tween-80 was administered to both the Model and Control groups to rigorously control for any potential confounding effects of the surfactant on gut barrier integrity and gut microbiota composition.

To maintain strict experimental rigor and control for both gavage-induced stress and potential vehicle effects, rats in the Model and Control groups received an isovolumetric intragastric administration of the identical vehicle solution (sterile saline containing 1% Tween-80) daily. This nutritional intervention regimen was strictly maintained for 7 consecutive days. During the postoperative recovery period, all animals were intensively monitored daily for physiological status and signs of distress. To strictly comply with animal welfare standards while preserving the integrity of the post-traumatic inflammatory readouts, analgesics with potent peripheral anti-inflammatory properties (eg, NSAIDs) were strictly avoided. Instead, a standard opioid analgesic protocol was implemented. Subcutaneous buprenorphine (0.01–0.05 mg/kg) was administered immediately post-injury and every 12 hours for the first 48 hours to manage acute pain, ensuring ethical compliance without confounding the systemic immune response.

Randomization and Blinding

To minimize bias, investigators responsible for trauma induction and treatment allocation were strictly separated from outcome assessors. While surgical trauma induction and intragastric gavage were necessarily unblinded, all downstream outcome evaluations—including histological scoring, Western blot quantification, qRT-PCR measurement, and gut microbiome profiling—were performed by researchers blinded to group identities. Additionally, all statistical analyses were performed by an independent investigator who remained blinded to group allocation until the final results were consolidated.

Sample Collection and Preparation

Biological samples were collected at baseline (Day 0), Day 3, and the endpoint (Day 7) post-trauma (Figure 1). In the current study, to comprehensively evaluate the cumulative therapeutic efficacy of the 7-day Omega-3 PUFA intervention and to ensure a strict time-matched alignment across multi-omics data (microbiome, histology, and molecular pathways), the endpoint (Day 7) samples were selected a priori for all downstream comparative analyses. The intermediate samples (Day 0 and Day 3) were archived for internal validation of trauma induction and future longitudinal investigations.

Figure 1.

Schematic representation of the experimental design and immunonutritional intervention timeline. Rats were randomly allocated into three groups: Sham Control (Vehicle), Model (Polytrauma + Vehicle), and Omega-3 (Polytrauma + 300 mg/kg/day Omega-3 PUFAs). The timeline nodes indicate: (A) Day 0 (Baseline): Establishment of the standardized severe polytrauma model via blunt abdominal trauma combined with a closed tibial-fibular fracture. (B) 24h Post-Trauma: Initiation of the dietary oral gavage intervention (simulating early enteral nutrition), administered daily for 7 consecutive days. (C) Day 3 (Early Phase): Intermediate sample collection (blood and feces) to monitor dynamic changes. (D) Day 7 (Endpoint): Animal sacrifice and comprehensive sample collection (blood, feces, and tissues including liver, lung, and gut) for downstream histological, molecular, and 16S rRNA analyses.

Notes: While intermediate samples were collected, the present study focuses on the multidimensional endpoint analysis at Day 7 to evaluate the cumulative efficacy of the complete intervention cycle.

Fecal Sampling

Fresh fecal pellets were collected via gentle abdominal massage and rectal stimulation. To rigorously preserve microbial DNA integrity, the samples were collected into sterile cryotubes, immediately flash-frozen in liquid nitrogen, and stored at −80 °C until 16S rRNA gene sequencing.

Blood Sampling

Peripheral venous blood (approximately 0.5 mL) was obtained via the tail vein using a 24-gauge catheter. Samples were allowed to clot at room temperature for 30 min to ensure complete serum separation, followed by centrifugation at 1500× g for 15 min at 4 °C. The resulting serum was carefully aliquoted and stored at −80 °C for subsequent biochemical analysis and cytokine quantification (IL-6, IL-10, TNF-α).

Tissue Harvesting

At the study endpoint (Day 7), rats were deeply anesthetized with 3% sodium pentobarbital (50 mg/kg, i.p.) and humanely sacrificed via abdominal aortic exsanguination. Tissues from the lung (right lower lobe), liver (left lateral lobe), and distal colon were rapidly harvested. To facilitate multidimensional analysis, one portion of each tissue was immediately fixed in 4% paraformaldehyde for histological examination, while the remaining portions were snap-frozen in liquid nitrogen and stored at −80 °C for downstream protein and RNA extraction.

Cytokine Measurement

Serum concentrations of IL-6, IL-10, and TNF-α were quantified using commercial enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN, USA) strictly in accordance with the manufacturer’s protocols. Briefly, 50 μL of diluted serum or standard solution was added to 96-well microplates pre-coated with target-specific capture antibodies and incubated for 2 h at room temperature. After thorough washing, each well was incubated with the corresponding detection antibody for 1 h at room temperature. Subsequently, tetramethylbenzidine (TMB) substrate solution was added for color development in the dark, and the enzymatic reaction was terminated by sulfuric acid stop solution.

The optical density (OD) value was immediately measured at 450 nm with wavelength correction at 540 nm using a micro plate reader (Bio-Rad Model 680, Bio-Rad Laboratories, Hercules, CA, USA). The minimum detectable concentrations of the kits were 3.6 pg/mL for IL-6, 2.8 pg/mL for IL-10, and 5.0 pg/mL for TNF-α. The intra-assay coefficients of variation (CVs) were less than 6.0%, and the inter-assay CVs were less than 8.5%. All serum samples were measured in duplicate to ensure analytical accuracy and reproducibility. Samples exceeding the standard curve range were appropriately diluted and re-tested.

Biochemical Analysis

Serum samples, prepared as described in Sample Collection and Preparation, were analyzed to quantify the severity of polytrauma-induced systemic multiple organ dysfunction. Specifically, hepatic function was assessed via alanine aminotransferase (ALT) and aspartate aminotransferase (AST); renal function via urea levels; and skeletal muscle injury via creatine kinase (CK). All biochemical parameters were quantified using a Hitachi 7180 Automatic Biochemical Analyzer (Hitachi High-Technologies Corp., Tokyo, Japan). The assays were performed utilizing standard commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) in strict accordance with the manufacturer’s protocols.

Histological Examination and Injury Scoring

Harvested tissues from the lung, liver, and colon were subjected to routine histological processing. Briefly, tissue specimens were fixed in 4% paraformaldehyde for 24 hours, dehydrated through a graded ethanol series, cleared in xylene, and embedded in paraffin. Serial sections (4–5 μm thick) were prepared and stained with Hematoxylin and Eosin (H&E) according to standard protocols. To rigorously evaluate multi-organ injury, histopathological scoring was independently performed by two board-certified pathologists who remained fully blinded to experimental group allocation throughout the assessment.

Colon injury was quantitatively assessed using the established Chiu’s scoring system, which grades mucosal damage from 0 (normal villous architecture) to 5 (complete disintegration of the lamina propria and ulceration).⁴⁷ Lung and liver injuries were evaluated using a published semi-quantitative scoring scale ranging from 0 (no pathological changes) to 4 (severe injury). Lung scoring parameters included alveolar congestion, hemorrhage, neutrophil infiltration, and alveolar wall thickness,⁴⁸ while liver scoring focused on sinusoidal dilation, hepatocellular necrosis, and inflammatory cell aggregation.⁴⁹

The final score for each organ was determined by averaging the independent assessments to minimize observer bias. When substantial divergence between the two assessors occurred, the slides were re-evaluated jointly to reach a consensus.

Western Blot Analysis

To elucidate the molecular mechanisms underlying intestinal barrier restoration and the suppression of the inflammatory cascade, total protein was extracted from frozen distal colon tissues using ice-cold RIPA lysis buffer supplemented with 1% phenylmethanesulfonylfluoride (PMSF) and a phosphatase inhibitor cocktail. The homogenates were centrifuged at 12,000× g for 15 min at 4 °C to collect the supernatant. Protein concentrations were determined using a BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA).

Equal amounts of protein (30 μg) were separated via 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred onto 0.45 μm polyvinylidene fluoride (PVDF) membranes (Millipore, Burlington, MA, USA). To block non-specific binding, the membranes were incubated with 5% non-fat dry milk in Tris-buffered saline containing 0.1% Tween-20 (TBST) for 1 h at room temperature.

Subsequently, the membranes were probed overnight at 4 °C with the following specific primary antibodies (all sourced from Abcam, Cambridge, UK): anti-TLR4 (1:1000, ab22048), anti-NF-κB p65 (1:1000, ab16502), anti-p-NF-κB p65 (S536) (1:1000, ab76302), anti-NLRP3 (1:1000, ab263899), anti-ZO-1 (1:1000, ab216880), anti-PPAR-γ (1:1000, ab178860), and anti-GAPDH (1:1000, ab8245). After three consecutive washes with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG secondary antibodies (1:5000, Abcam) for 1 h at room temperature.

Protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Bio-Rad Laboratories, Hercules, CA, USA) and captured on a Bio-Rad ChemiDoc XRS+ imaging system. Densitometric quantification of the band intensities was performed using Image J software (NIH, Bethesda, MD, USA), with relative protein expression levels normalized to the internal control, GAPDH.

Quantitative Real-Time PCR (qRT-PCR) Analysis

To assess the transcriptional regulation of the targeted inflammatory and receptor pathways, total RNA was extracted from flash-frozen distal colon tissues (~30 mg) using the Trizol reagent (Invitrogen, Carlsbad, CA, USA). RNA purity and concentration were verified via a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), with strict inclusion criteria of an A260/A280 ratio between 1.8 and 2.0. Subsequently, 1 μg of RNA was reverse-transcribed into cDNA utilizing the Prime Script™ RT reagent Kit (Takara Bio, Shiga, Japan). Quantitative PCR was executed on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using the SYBR Green (Vazyme Biotech, Nanjing, China). The thermal cycling protocol comprised an initial denaturation at 95 °C for 30s, followed by 40 cycles of 95 °C for 10s and 60 °C for 30s, culminating in a standard melt curve analysis to confirm product specificity. Primer sequences, synthesized by Sangon Biotech (Shanghai, China), are detailed in Table 1 Relative mRNA expressions of the target genes (Tlr4, Rela, Nlrp3, Ffar4, Pparg) were calculated utilizing the 2^^(-ΔΔCt) method and normalized to the endogenous reference gene, β-actin.

Table 1.

Primer Sequences Used for qRT-PCR Analysis

Target Gene	Full Name	Forward Primer (5’–3’)	Reverse Primer (5’–3’)	Product Length (bp)
Tlr4	Toll-like receptor 4	GCAGAAAATGCCAGGATGATG	AAGTACCTCTATGCAGGGATTCAAG	110 bp
Rela	NF-κB p65	GACCTGACCTGGAGACTGG	GAGGAAGTGAGCGAGAAG	112 bp
Pparg	PPAR-γ	TCTCTCCGTAATGGAAGC	GTAGAGCTGAGTCCCGGA	128 bp
Nlrp3	NLRP3	GCCATCTTGACCGTGTCT	GAGGTCCACGTTGACTCT	140 bp
Ffar4	GPR120	CTGGCTACAACATCGTCAT	AGATGGCGTAGGAGATG	105 bp
Actb	β-actin	CCCATCTACGAGGGCTAT	CTTGCTCGAAGTCCAG	95 bp

Notes: Primers were designed using NCBI Primer-BLAST or obtained from established literature. All sequences are listed in the 5′ to 3′ direction. In the “Target Gene” column, gene symbols are italicized per official mouse gene nomenclature conventions. The symbol ′ (prime) in the primer column headers denotes the carbon position on the deoxyribose sugar (5′ = five-prime, 3′ = three-prime). Greek letters (β, γ, κ) denote beta, gamma, and kappa, respectively.

Abbreviations: bp, base pair; GPR120, G-protein coupled receptor 120; NLRP3, NOD-like receptor protein 3; PPAR-γ, peroxisome proliferator-activated receptor gamma.

Gut Microbiota Analysis (16S rRNA Sequencing)

DNA Extraction and Amplicon Sequencing: To evaluate the efficacy of Omega-3 PUFAs in reversing trauma-induced gut dysbiosis, total genomic DNA was extracted from flash-frozen fecal samples utilizing the E.Z.N.A.^® Soil DNA Kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s protocols. All procedures were conducted under sterile conditions. To rule out reagent background and potential cross-contamination, extraction blanks and PCR negative controls (nuclease-free water) were processed and sequenced alongside biological samples to monitor reagent-derived contamination. DNA concentration and purity were assessed via a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA), and integrity was confirmed by 1% agarose gel electrophoresis. The hypervariable V3–V4 regions of the bacterial 16S rRNA gene were amplified using the universal primer pair 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’). Purified amplicons were pooled in equimolar amounts and subjected to paired-end sequencing (2 × 250 bp) on an Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA) by Majorbio Bio-Pharm Technology Co., Ltd., Shanghai, China.

Bioinformatics and Statistical Analysis: Raw demultiplexed reads were processed via the QIIME 2 pipeline (v2022.08) using the DADA2 plugin for quality filtering, denoising, and chimera removal to generate high-resolution Amplicon Sequence Variants (ASVs). The feature table was rarefied to a uniform sequencing depth of 50,000 reads per sample; this threshold was selected after inspecting rarefaction curves to ensure sufficient saturation of microbial diversity. ASVs with a mean relative abundance <0.01% across all samples were filtered out to remove spurious low-abundance features. Taxonomic assignment was conducted using a Naive Bayes classifier trained on the SILVA database (release 138). Downstream ecological statistical analyses were predominantly executed in R software (v4.2.1). Alpha diversity (Shannon and Chao1 indices) was compared using the Kruskal–Wallis test. Beta diversity was visualized via Principal Coordinate Analysis (PCoA) based on Bray-Curtis dissimilarity, with statistical significance confirmed by Permutational Multivariate Analysis of Variance (PERMANOVA, 999 permutations). To identify specific microbial biomarkers driving community differences across groups, the Linear Discriminant Analysis (LDA) Effect Size (LEfSe) method was employed with a threshold LDA score > 3.5. Differential abundance of individual taxa was further validated using the Wilcoxon rank-sum test with Benjamini-Hochberg FDR correction to control for multiple testing (p < 0.05).

Finally, to elucidate the complex crosstalk between reconfigured gut microbiome and host systemic inflammation, Spearman’s rank correlation analysis was conducted between the relative abundances of the top 20 altered microbial genera and key host phenotypic indicators (ALT, AST, urea, IL-6, IL-10, and TNF-α). The resulting correlation matrix was visualized as a heatmap.

General Statistical Analysis

Sample sizes were determined based on preliminary experiments and power analysis to ensure sufficient statistical power (n = 6 animals per group at the experimental endpoint for all in vivo analyses). All data points presented in the figures represent biological replicates corresponding to individual experimental animals; technical replicates were averaged prior to statistical testing where applicable.

All quantitative data are expressed as the Mean ± Standard Deviation (SD). Statistical analyses were performed using GraphPad Prism (version 9.0) and SPSS statistics (version 26.0). Prior to comparative analysis, the normal distribution of datasets was rigorously evaluated using the Shapiro–Wilk test, and homogeneity of variances was assessed via Levene’s test. Comparisons among multiple groups were analyzed using a One-way Analysis of Variance (ANOVA) followed by Tukey’s post-hoc test. For datasets violating the assumptions of normality or homoscedasticity, the non-parametric Kruskal–Wallis H-test was employed, followed by Dunn’s multiple comparisons test. Spearman’s rank-order correlation coefficient was utilized for correlation matrix analysis. A two-tailed P-value of < 0.05 was considered statistically significant. Investigators remained blinded to group allocation during tissue evaluation, outcome measurement, and data analysis to minimize observer bias.

Results

Omega-3 PUFAs Attenuate Systemic Inflammation and Multi-Organ Dysfunction in Polytrauma Rats

To evaluate the effects of early n-3 PUFA administration, we examined histopathological changes across the gut–liver–lung axis, a tissue axis susceptible to severe polytrauma-induced injury. All histological analyses were performed using standardized scoring systems fully defined in the Methods section, including the lung injury scoring system, semi-quantitative liver injury scale, and Chiu’s intestinal mucosal injury scoring criteria; six animals were assigned to each experimental group (n = 6 per group).

As illustrated in Figure 2, H&E-stained tissue micrographs demonstrated that severe polytrauma disrupted the native structural architecture of the lung, liver, and small intestine. The Model group displayed evident pulmonary alveolar congestion and evident inflammatory cell infiltration (Figure 2A), widespread hepatic sinusoidal dilation accompanied by focal hepatocellular necrosis (Figure 2B), and substantial intestinal villous erosion and denudation (Figure 2C).

Figure 2.

Dietary Omega-3 PUFAs attenuate severe polytrauma-induced histopathological injury across the gut—liver—lung axis. (A–C) Representative hematoxylin and eosin (H&E) staining images demonstrating the microarchitecture of the (A) lung, (B) liver, and (C) distal colon tissues across groups (magnification: 100× and 200×; scale bars as indicated). (D–F) Quantitative histological evaluations confirming structural preservation: (D) Lung Injury Score, (E) Liver Injury Score, and (F) Intestinal Chiu’s Score. Data are expressed as the mean ± SD (n = 6 per group). ** P < 0.01, *** P < 0.001 vs Control group; ^# P < 0.05, ^## P < 0.01 vs Model group. Yellow dashed boxes indicate the regions selected for magnified observation of histopathological alterations in lung, liver and colonic tissues.

Quantitative histological scoring validated these morphological observations. Compared with Sham control animals, the Model group presented higher tissue injury scores: lung injury score (3.5 ± 0.3 vs 1.0 ± 0.1, P < 0.001), liver injury score (3.2 ± 0.2 vs 1.0 ± 0.1, P < 0.001), and Chiu’s intestinal injury score (3.2 ± 0.2 vs 1.0 ± 0.1, P < 0.001; Figure 2D–F).

Seven-day enteral supplementation with n-3 PUFAs limited parenchymal structural damage in all three organs, reduced inflammatory infiltrate abundance, and produced significant reductions in all three quantitative injury metrics relative to the Model group. Specifically, the Omega-3 treatment group yielded a lung injury score of 2.1 ± 0.2 (P = 0.012 vs Model), a liver injury score of 1.7 ± 0.3 (P = 0.005 vs Model), and a Chiu’s intestinal score of 1.6 ± 0.3 (P = 0.008 vs Model).

Targeted Omega-3 PUFAs Reinforce the Intestinal Mucosal and Physical Barrier Following Severe Polytrauma

Given that the gut is widely considered the “motor” driving post-traumatic MODS, we further investigated the integrity of the intestinal barrier, which serves as the primary defense against endotoxin translocation. The intestinal epithelium comprises two critical lines of defense: the mucus layer (mucosal barrier) and the tight junctions (physical barrier).

First, we evaluated the mucosal barrier and gross villus morphology using Alcian Blue-Periodic Acid Schiff (AB-PAS) staining (Figure 3A, left panels). In the Sham Control group, the colonic epithelium exhibited robust, densely packed villi with abundant mucin-secreting goblet cells. Following severe polytrauma, the Model group displayed marked mucosal atrophy, characterized by significant depletion of mucin-filled goblet cells (P < 0.001, Figure 3B) and a significantly blunted villus height (P < 0.001, Figure 3C). Crucially, dietary intervention with Omega-3 PUFAs counteracted this traumatic insult, significantly preserving villus architecture and restoring the goblet cell population (P < 0.05 and P < 0.01 vs Model, respectively).

Figure 3.

Omega-3 PUFAs reinforce the intestinal mucosal and physical barriers. (A) Representative histological images of the colonic mucosal barrier via Alcian Blue-Periodic Acid Schiff (AB-PAS) staining (left panels) and the physical tight junction network via ZO-1 immunofluorescence (right panels). (B and C) Quantitative analysis of the mucosal barrier integrity, including (B) the number of mucin-secreting goblet cells per villus and (C) the intact villus height. (D) Quantitative evaluation of the relative fluorescence intensity of the tight junction protein ZO-1. Data are expressed as the mean ± SD (n = 6 per group). *** P < 0.001 vs Control group; ^### P < 0.001 vs Model group. Yellow dashed boxes denote the selected regions for magnified observation of colonic mucosal architecture, and white arrowheads indicate ZO-1 positive signals.

Furthermore, we assessed the integrity of the physical barrier by examining the expression and distribution of Zonula Occludens-1 (ZO-1), a pivotal tight junction protein, via immunofluorescence (Figure 3A, right panels). In healthy Controls, ZO-1 manifested as a continuous, intense fluorescent network localizing at the apical cellular borders. The traumatic stress in the Model group markedly disrupted this network, resulting in weak, fragmented, and discontinuous ZO-1 signaling, alongside a significant decline in overall relative fluorescence intensity (P < 0.001, Figure 3D). In comparison, Omega-3 PUFAs supplementation effectively prevented the degradation of tight junctions, maintaining a highly continuous ZO-1 structural network that was quantitatively superior to that of the Model group (P < 0.01). Collectively, these findings suggest that early Omega-3 PUFA intervention is associated with preserved gut barrier integrity, which may correspond to reduced intestinal permeability and attenuated systemic inflammation.

Omega-3 PUFAs Treatment, GPR120/PPAR-γ Activation, and the TLR4/NF-κB/NLRP3 Inflammasome Signaling

All analyses were performed using n = 6 animals per group.

The compromised intestinal epithelial barrier facilitates the translocation of gut-derived endotoxins, which subsequently trigger the classic TLR4-mediated intracellular inflammatory cascade. To evaluate the molecular mechanisms underlying the protective effects of Omega-3 PUFAs, we assessed gene and protein expression profiles of the colonic GPR120/PPAR-γ axis and the TLR4/NF-κB/NLRP3 pathway.

Severe polytrauma induced detectable overactivation of pro-inflammatory signaling networks in the Model group. Both Western blot analyses (Figure 4A and B) and quantitative RT-PCR (Figure 5A) indicated upregulation of colonic TLR4 expression relative to the Control group (TLR4 protein: 3.22 ± 0.38 vs 1.00 ± 0.12, P < 0.01; Tlr4 mRNA: 7.74 ± 0.68 vs 1.00 ± 0.13, P < 0.001). Such receptor activation promoted downstream phosphorylation of the NF-κB p65 subunit, reflected by an elevation in the p-p65/total p65 ratio (4.31 ± 0.45 vs 1.00 ± 0.10, P < 0.01). The transition was accompanied by elevations in both Nlrp3 mRNA (8.26 ± 0.71 vs 1.00 ± 0.16, P < 0.001) and NLRP3 protein abundance (3.65 ± 0.42 vs 1.00 ± 0.13, P < 0.01) in the Model group. Moreover, consistent with our immunofluorescence results, Western blot analyses demonstrated a reduction in the tight junction protein ZO-1 after polytrauma (0.24 ± 0.07 vs 1.00 ± 0.11).

Figure 4.

Omega-3 PUFAs engage the colonic GPR120/PPAR-γ switch to suppress the TLR4/NLRP3 inflammatory cascade at the translational level. (A) Representative Western blot bands illustrating the protein expression of ZO-1, NLRP3, TLR4, p-p65, total NF-κB p65, GPR120, and PPAR-γ in distal colon tissues, with GAPDH serving as the internal loading control. (B) Densitometric quantification of the relative protein expression levels. Data are expressed as the mean ± SD (n = 6 per group). **P < 0.01, ***P < 0.001 vs Control group; ^## P < 0.01 vs Model group.

Figure 5.

Omega-3 PUFAs blunt systemic multiple organ dysfunction and suppress colonic pro-inflammatory gene transcription. (A) Quantitative RT-PCR analysis of relative mRNA expression levels for Nlrp3, TlrR4, Nf -κB, p65, Gpr120, and Ppar-γ in colonic tissues. (B) Circulating biochemical and immunological markers evaluating systemic injury, including liver function (ALT, AST), renal function (Urea), skeletal muscle trauma (CK), and the systemic pro-inflammatory cytokine TNF-α. Data are expressed as the mean ± SD (n = 6 per group). ** P < 0.01, *** P < 0.001 vs Control group; ^## P < 0.01, ^### P < 0.001 vs Model group.

Omega-3 PUFAs are known to act as high-affinity ligands for the lipid sensor GPR120. Our data demonstrated that the traumatic insult markedly decreased the colonic expression of GPR120 and its associated nuclear transcription factor, PPAR-γ. In the Model group, GPR120 protein was 0.32 ± 0.09 and PPAR-γ protein was 0.38 ± 0.10 (both P < 0.01 vs Control); Gpr120 mRNA was 0.33 ± 0.08 and Ppar-γ mRNA was 0.31 ± 0.07 (both P < 0.001 vs Control). Early enteral supplementation with Omega-3 PUFAs attenuated this trauma-induced suppression. The Omega-3 group exhibited significantly restored and upregulated expression of both GPR120 (protein: 0.76 ± 0.16, P < 0.01 vs Model; mRNA: 0.81 ± 0.12, P < 0.001 vs Model) and PPAR-γ (protein: 0.84 ± 0.13, P < 0.01 vs Model; mRNA: 0.80 ± 0.11, P < 0.01 vs Model) at both the mRNA and protein levels.

In parallel, Omega-3 intervention was associated with reduced TLR4 expression (protein: 1.68 ± 0.29, P < 0.01 vs Model; mRNA: 3.18 ± 0.44, P < 0.001 vs Model), lower phosphorylation and nuclear translocation of NF-κB p65 (p-p65/total p65 ratio: 2.16 ± 0.33, P < 0.01 vs Model), as well as attenuated NLRP3 inflammasome abundance (protein: 1.84 ± 0.31, P < 0.01 vs Model; mRNA: 3.41 ± 0.52, P < 0.001 vs Model). Concurrently, the protein expression of ZO-1 was significantly restored (0.62 ± 0.14, P < 0.01 vs Model). Taken together, these molecular data suggest that dietary Omega-3 PUFAs are associated with modulation of progressive secondary inflammatory cascades. These concurrent observations raise the possibility that modulation of the intestinal inflammatory cascade and preservation of mucosal barrier integrity may contribute to reduced systemic dissemination of inflammatory mediators following Omega-3 treatment.

As shown in Figure 5B, the severe structural disruption in the Model group was consistently observed alongside a significant release of intracellular enzymes and inflammatory cytokines into the systemic circulation. Quantitative serum biochemical analysis demonstrated that Omega-3 PUFA intervention reduced circulating organ injury markers. Relative to the Model group, Omega-3 treatment reduced serum ALT by 51.4% (51.3 ± 8.2 vs 105.6 ± 12.4 U/L, P = 0.008), AST by 42.4% (141.2 ± 18.5 vs 245.1 ± 22.3 U/L, P = 0.009), and CK by 48.2% (854.5 ± 112.4 vs 1650.3 ± 156.8 U/L, P < 0.001).

Compared to the Controls, polytrauma rats exhibited notable elevations in serum ALT, AST, Urea, and CK, indicating the clinical progression to acute hepatic, renal, and skeletal muscle dysfunction (all P < 0.01 or P < 0.001). Furthermore, the systemic inflammatory response was evidenced by a significant increase in circulating TNF-α levels (Figure 5B), alongside consistent alterations in other key cytokines (Supplementary Figure S1). Additionally, dietary Omega-3 supplementation attenuated these systemic changes, demonstrating a significant reduction in all aforementioned circulating injury markers and reducing the pro-inflammatory response (P < 0.01 vs Model). Collectively, these molecular and phenotypic data suggest that Omega-3 PUFAs are associated with systemic protection against polytrauma-induced MODS.

Targeted Administration of Omega-3 PUFAs Reconfigures Gut Microbial Ecology and Enriches Specific Taxa Associated with Homeostasis

To ascertain whether the multi-organ protection observed following Omega-3 PUFA treatment stems from the remediation of trauma-induced gut dysbiosis, we profiled the fecal microbiome using 16S rRNA gene amplicon sequencing. We first evaluated the global architecture of the gut microbiota. As shown in Figure 6, severe polytrauma resulted in a significant reduction in microbial alpha diversity, evidenced by decreased Shannon (3.41 ± 0.32 vs 4.05 ± 0.16, P = 0.007) and Chao1 indices (368.2 ± 39.1 vs 451.3 ± 36.8, P = 0.006) in the Model group compared to Controls (P = 0.004, Figure 6A and B). Intervention with Omega-3 PUFAs restored these alpha diversity indices towards baseline levels: Shannon index (4.02 ± 0.18, P = 0.008 vs Model), Chao1 index (442.6 ± 41.5, P = 0.006 vs Model). Beta diversity, visualized via Principal Coordinate Analysis (PCoA) revealed distinct clustering among the three groups (Figure 6C). The Omega-3 intervention group clustered separately from the Model group, indicating a significant shift in community structure towards the trajectory observed in Controls. Venn diagram analysis further confirmed that Omega-3 supplementation altered the composition of amplicon sequence variants (ASVs) compared to the Model group (Figure 6D).

Figure 6.

Dietary Omega-3 PUFAs reconfigure the gut microbial ecology and community structure. (A and B) Alpha diversity analysis demonstrating the recovery of intra-sample richness and evenness, represented by the (A) Shannon and (B) Chao1 indices. (C) Beta diversity evaluation via Principal Coordinate Analysis (PCoA) based on Bray-Curtis distances, illustrating distinct community topological clustering; coloured dashed ellipses enclose samples belonging to each experimental group. (D) Venn diagram highlighting shared and unique Amplicon Sequence Variants (ASVs) among the three groups. (E and F) Relative microbial taxonomic composition profiles at the (E) phylum and (F) genus levels (Top 10 taxa). Data are expressed as the mean ± SD (n = 6 per group). ** P < 0.01 vs Control group; ^## P < 0.01 vs Model group.

To identify specific taxonomic shifts associated with this structural recovery, we analyzed the community composition (Figure 6E and F) and performed Linear Discriminant Analysis Effect Size (LEfSe) to detect differential taxa (Figure 7A). The LEfSe analysis (LDA score > 3.5) indicated that trauma depleted several commensal taxa. In contrast, the Omega-3 intervention specifically enriched distinct genera, most notably Alistipes and Blautia. While 16S rRNA sequencing cannot directly quantify microbial metabolites, published work indicates that members of the genus Blautia may produce short-chain fatty acids (SCFAs) that are capable of supporting gut barrier integrity.⁵⁰ Similarly, existing literature suggests that Alistipes exerts complex effects regulating intestinal homeostasis and inflammatory responses.⁵¹ Accordingly, enrichment of these genera raises the possibility of partial recovery of microbial functional capacity; this inference relies entirely on external published datasets, and we did not perform metabolite quantification to confirm these functions in the current trauma model.

Figure 7.

Identification of homeostatic microbial biomarkers and their functional crosstalk with host systemic phenotypes. (A) Linear discriminant analysis (LDA) effect size (LEfSe) identifying specifically enriched, differentially abundant bacterial taxa (LDA score > 3.5). (B) Spearman’s rank correlation heatmap delineating the functional relationship between the top 20 altered microbial genera and host clinical systemic parameters (ALT, AST, Urea, TNF-α). Red tiles indicate positive correlations, whereas blue tiles indicate negative correlations. Significant correlations are marked: * P < 0.05, ** P < 0.01.

To assess the clinical relevance of these shifts, we performed a Spearman’s rank correlation analysis between the top 20 altered microbial genera and systemic injury markers (Figure 7B). We observed that the Omega-3-enriched genera, including Alistipes and Blautia, exhibited significant negative correlations with markers of organ injury (ALT, AST, Urea) and the pro-inflammatory cytokine TNF-α (all P < 0.05). Conversely, trauma-enriched pathobionts showed positive correlations with these parameters. Taken together, these correlations suggest that the Omega-3-induced remodeling of the gut microbiota, particularly the enrichment of taxa previously associated with intestinal homeostasis, is closely linked to the amelioration of post-traumatic injuries.

Discussion

Severe polytrauma remains a significant clinical challenge, frequently triggering a hyper-inflammatory and hyper-catabolic state that rapidly progresses to life-threatening Multiple Organ Dysfunction Syndrome (MODS).^52,53 While standard resuscitation and supportive care are cornerstones of intensive care units (ICUs),^54,55 they are often insufficient to halt progressive systemic inflammation following severe trauma. Consequently, there is need to identify specific bio-active lipid mediators capable of actively modulating host immunity.^56–58 In the present study, our in vivo data indicate that early dietary Omega-3 supplementation may act as an immunomodulatory strategy in this polytrauma rat model.⁵⁹ Rather than acting merely as metabolic substrates, Omega-3 PUFAs were associated with attenuated progression of post-traumatic MODS, accompanied by preserved intestinal barrier function, reshaped gut microbial ecology, and changes in the GPR120/PPAR-γ molecular switch to suppress TLR4/NLRP3-mediated inflammatory signaling.

The concept of the “gut—liver—lung axis” is central to understanding the pathogenesis of trauma-induced MODS.^60,61 Following severe physical insult, the initial systemic inflammatory response syndrome (SIRS) rapidly disseminates through the systemic circulation, inflicting collateral damage on distant, uninjured vital organs such as the lungs and liver.^62–64

Our macroscopic and biochemical data are consistent with this clinical trajectory. Polytrauma rats exhibited significant structural alterations in the pulmonary alveoli and hepatic sinusoids, accompanied by increased circulating transaminases (ALT, AST), renal dysfunction markers (Urea), and the pro-inflammatory cytokine TNF-α. Early targeted intervention with Omega-3 PUFAs was associated with improvements in these parameters. These multi-organ improvements suggest that the therapeutic efficacy of Omega-3 effects are not limited to local tissue changes. We hypothesize that Omega-3 treatment may act at an upstream intestinal node to limit systemic inflammatory spread, which could stabilize the gut–liver–lung axis.

The mechanistic origin of this systemic response appears to lie within the gastrointestinal tract, widely hypothesized to be the “motor” of critical illness.^65–67 Under severe traumatic stress, splanchnic vasoconstriction and subsequent ischemia-reperfusion injury compromise the intestinal epithelium, leading to the “leaky gut” phenomenon.^68–71 This barrier failure allows gut-derived endotoxins (eg, LPS) to translocate into the portal and systemic circulation, exacerbating systemic inflammation.^72–74 Histological assessments revealed that polytrauma impaired the dual-layered intestinal barrier. However, Omega-3 PUFA intervention was associated with improved intestinal physical barrier integrity, as evidenced by preserved mucin-secreting goblet cells. Notably, unlike conventional synthetic anti-inflammatory drugs, specific bioactive lipids like EPA and DHA inherently possess the capability to directly integrate into epithelial phospholipid bilayers,^75,76 thereby maintaining membrane fluidity and structural integrity during severe stress.^77,78

Beyond barrier maintenance, the interplay between bioactive lipids and the gut microenvironment is crucial.^79,80 Based on these concurrent observational changes, we put forward a hypothetical model: early enteral Omega-3 supplementation could mitigate post-traumatic systemic injury through two interrelated pathways. On the first track, luminal PUFAs exert a microbiome-remodeling effect in the gut lumen. They reconfigure the trauma-disrupted microbiome, notably increasing the relative abundance of the genera Alistipes and Blautia. Although members of these genera have been described as putative SCFA-producing taxa in published work,^51,53,81 we did not directly quantify luminal or circulating SCFA concentrations in the current experiment. Any link between enrichment of these taxa and altered SCFA availability remains inferred from known microbial functional traits, rather than empirically validated here. The observed enrichment of these taxa was associated with improved outcomes, but causal attribution to SCFA-mediated protective mechanisms requires validation through targeted metabolomic analyses or functional experiments such as fecal microbiota transplantation and antibiotic depletion models. On the second track, the absorbed fraction interacts with the mucosal immune system as ligands for GPR120.^25,82 Our data indicate that Omega-3 intervention is associated with elevated expression of the GPR120/PPAR-γ axis, suggesting that PPAR-γ may act as a potential transcriptional regulator of inflammatory signaling. This potential “trans-repression” appears to attenuate NF-κB nuclear functionalization,^83,84 which may contribute to the observed mitigation of NLRP3 inflammasome activity and downstream inflammatory signaling.⁸⁵ Taken together, our findings suggest that the multi-organ protective effects of Omega-3 PUFAs may involve interconnected processes: restoration of mucosal barrier integrity, modulation of gut microbial composition, and regulation of the GPR120/PPAR-γ signaling axis. However, the exact causal relationships among these interconnected pathways remain to be elucidated. Consistent with previous studies demonstrating the anti-inflammatory and barrier-protective effects of Omega-3 PUFAs in ischemia-reperfusion injury and sepsis-associated organ dysfunction,^86,87 our data support an immunomodulatory role for these lipids in critical illness. Earlier preclinical work showing improved intestinal integrity aligns with our histological observations of preserved goblet cells and tight junctions. However, most prior research examined isolated organs or chronic inflammation; our findings extend these results to acute multi-systemic severe polytrauma. Whereas many studies focus on single-organ outcomes and neglect systemic remote organ injury,⁸⁸ the present work assesses coordinated changes across the gut–liver–lung axis, indicating lipid-mediated inflammatory modulation acts across interconnected organs. Consistent with the findings reported in reference,⁸⁹ we found that GPR120/PPAR-γ modulation coincides with gut microbial shifts. Many published investigations evaluate GPR120 signaling or gut microbiota separately, rather than exploring their interplay.^86,87 Our data suggest these pathways function as an interconnected network during polytrauma. Furthermore, the enrichment of Alistipes and Blautia observed here agrees with Omega-3 microbiome findings from chronic metabolic disease models. By comparison, few studies have examined microbiota remodeling by Omega-3 within acute trauma settings.

While our findings highlight the protective role of Omega-3 PUFAs in this severe polytrauma model, it is important to acknowledge that their biological effects are highly context-dependent and are not universally beneficial across all experimental and clinical scenarios. Previous literature has reported inconsistent outcomes across different disease models, influenced by factors such as dosing regimens, timing of administration, route of delivery, and specific pathological contexts.⁹⁰ For instance, Omega-3 supplementation has produced controversial results in sepsis and ARDS;⁹¹ several meta-analyses have similarly acknowledged the heterogeneity in clinical outcomes,^92,93 and mixed results have been reported in mechanically ventilated ALI/ARDS populations.⁹⁴ Thus, the translational efficacy of Omega-3 supplementation requires careful, context-specific evaluation.

Clinical Implications and Limitations

While our preclinical model provides mechanistic insights into the GPR120/PPAR-γ axis and microbiome modulation, any direct translation of these results into clinical trauma management requires extreme caution given the limitations of the animal study.

First, practical translational hurdles surround the timing and feasibility of early enteral Omega-3 immunonutrition. Acute trauma frequently induces gastroparesis, complicating enteral tolerance and hindering early supplementation initiation. In addition, routine clinical management, including aggressive hemodynamic resuscitation and surgical damage control, may interfere with intestinal barrier function and alter the measurable protective effects observed within our controlled animal setting. Multiple critical confounding variables further complicate clinical evaluation: broad-spectrum antibiotics commonly prescribed to injured patients profoundly remodel gut microbial communities, and divergent enteral or parenteral nutritional regimens shape baseline microbiota and inflammatory status. Collectively, these interacting clinical factors may mask or modify the therapeutic signals of Omega-3 PUFAs identified under standardized laboratory conditions.

Second, regarding experimental design, the present study utilized male Sprague-Dawley rats with a relatively small sample size (n = 6 per group), which limits statistical power and precludes sex-based analysis, thereby restricting the generalizability of these findings to female populations. Moreover, inherent species differences in inflammatory regulation and gut microbiota composition must be acknowledged when extrapolating to human pathophysiology.

Third, only one fixed dosage (300 mg/kg/day) and a short 7-day observation window were tested. We therefore cannot define the optimal dose-response relationship, nor evaluate sustained long-term survival or functional outcomes.

Finally, while we demonstrated structural restoration of tight junctions and alterations in the GPR120/PPAR-γ pathway, direct functional assessments of intestinal permeability and profiling of specialized pro-resolving lipid mediators were beyond the scope of this study. Future work combining targeted metabolomics, receptor-specific antagonism, and microbiota transfer approaches will be essential to elucidate the causal links within this gut-immune axis. Furthermore, studies incorporating larger, mixed-sex cohorts and extended survival analysis are warranted to substantiate these preliminary observations.

Conclusions

In summary, this study suggests that early targeted administration of Omega-3 PUFAs may serve as a potential immunomodulatory strategy for severe polytrauma-induced Multiple Organ Dysfunction Syndrome (MODS). Rather than acting merely as metabolic substrates, Omega-3 bioactive lipid mediators may contribute to attenuating the gut-driven amplification of systemic inflammation through several plausible, non-mutually exclusive pathways: (1) potentially restoring the intestinal physical and mucosal barriers to limit endotoxin translocation; (2) reshaping dysbiotic gut microbiota, with enrichment of genera including Alistipes and Blautia (taxa reported as putative SCFA producers in published literature); (3) possibly modulating the GPR120/PPAR-γ axis, which may restrain TLR4/NF-κB/NLRP3 inflammatory signaling. These multi-layered protective pathways are summarized in Figure 8. These integrated structural, ecological, and molecular observations, which are predominantly derived from correlative measurements, provide preliminary evidence supporting further preclinical and translational investigation of Omega-3-based immunonutritional approaches in trauma care, with the aim of modulating inflammation within the gut—liver—lung axis.

Figure 8.

Schematic illustration of the proposed multimodal immunonutritional mechanisms of dietary Omega-3 PUFAs in severe polytrauma. Early enteral supplementation with Omega-3 PUFAs may reinforce the intestinal barrier (preserving mucin layers and ZO-1 tight junctions) and reshapes the gut microbiota, with enrichment of commensal genera previously reported as putative SCFA producers in published literature. Concurrently, Omega-3 PUFAs act as a ligand to activate the GPR120 receptor, promoting the PPAR-γ-mediated “trans-repression” of the TLR4/NF-κB signaling cascade and suppressing the NLRP3 inflammasome. Together, these ecological and molecular changes may limit gut-derived endotoxemia, thereby attenuating systemic inflammation and protecting against Multiple Organ Dysfunction Syndrome (MODS).Red upward-facing arrows indicate activating/promoting pathways; green downward-facing arrows denote inhibitory effects.

Funding Statement

This study was supported by the Peking University People’s Hospital Scientific Research Development Funds (grant number RDGS2023-07).

Data Sharing Statement

The original 16S rRNA sequencing datasets presented in this study are publicly available in the Genome Sequence Archive (GSA) of the China National Center for Bioinformation (CNCB) under the accession number CRA040458. The datasets can be accessed via the following link: https://ngdc.cncb.ac.cn/gsa/s/JUaRwNYK. All other data supporting the findings of this study are available from the corresponding author upon reasonable request.

Ethics Approval and Consent to Participate

All animal protocols and experimental procedures were formally approved by the Animal Ethics Committee of Peking University People’s Hospital (Approval No. 2023PHB071-001). The study was conducted in strict adherence to the NIH Guide for the Care and Use of Laboratory Animals. Consent to participate is not applicable as this study did not involve human subjects.

Author Contributions

Lei Wang: Conceptualization, Methodology, Software, Investigation, Writing - Original Draft.

Lichen Zhang: Methodology, Investigation, Data Curation, Writing - Original Draft.

Xiaoxia Liu: Formal Analysis, Visualization, Funding Acquisition, Writing - Review & Editing.

Shu Li: Investigation, Validation, Data Curation, Writing - Review & Editing.

Jiawei Shen: Resources, Software, Writing - Review & Editing.

Jie Zhao: Resources, Software, Writing - Review & Editing.

Xiujuan Zhao: Supervision, Project administration, Methodology, Writing - Review & Editing.

Feng Xue Zhu: Conceptualization, Supervision, Writing - Review & Editing, Funding Acquisition.

All authors gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

Disclosure

The authors declare no conflicts of interest.