Skip to main content
NCBI home page
Frontiers in Parasitology logoLink to Frontiers in Parasitology
. 2026 Sep 15;5:1948035. doi: 10.3389/fpara.2026.1948035

Molecular detection and genetic characterization of Giardia duodenalis in temple stray cats in Bangkok, Thailand

Vy Thi Tuong Le 1,†, Pornkamol Phoosangwalthong 1,†, Minh-Trang Thi Hoang 2, Tawin Inpankaew 1,*
PMCID: PMC13619830  PMID: 42812357

Abstract

Introduction

Giardia duodenalis is a ubiquitous enteric protozoan infecting humans, domestic animals, and wildlife worldwide. In Thailand, high densities of stray animals represent an important management challenge. However, molecular epidemiological data regarding stray cats remain limited. This study estimated the prevalence of G. duodenalis, characterized the identified genetic assemblages, and explored factors associated with PCR positivity in temple stray cats in Bangkok, Thailand.

Methods

Fecal samples were collected from 500 stray cats residing across 43 temples in 24 districts of Bangkok. Detection of G. duodenalis was performed using nested PCR targeting the small subunit ribosomal RNA (SSU rRNA) gene. Positive samples were further characterized by genotyping at the glutamate dehydrogenase (gdh) and triosephosphate isomerase (tpi) loci. Phylogenetic analyses were conducted using the Maximum Likelihood method based on the Tamura 3-parameter model. Associated factors were evaluated using multivariable logistic regression.

Results

The overall prevalence of G. duodenalis was 10.8% (54/500; 95% CI: 8.4–13.8%), with positive cases identified in 12 of the 24 surveyed districts and 19 of the 43 sampled temples. Eight isolates were successfully genotyped, identifying assemblage B (sub-assemblage BIV, n = 4), assemblage F (n = 3), and assemblage A (sub-assemblage AI, n = 1). The absence of human contact was identified as an exploratory variable associated with higher odds of PCR positivity (adjusted odds ratio [aOR] = 8.80; 95% CI: 2.15–35.98; P = 0.002), while demographic factors (age, sex), geographic zone, and deworming history showed no statistically significant associations.

Discussion

Assemblages previously reported in humans and various animals were detected among a small number of successfully genotyped isolates, while the source, direction of transmission, and the reservoir status of temple stray cats could not be determined.

Keywords: associated factors, feline giardiasis, molecular epidemiology, phylogenetic analysis, zoonotic assemblage

1. Introduction

Giardiasis is a widespread intestinal parasitic infection of significant veterinary and public health concern, recognized as one of the most common waterborne and foodborne diseases (Jerez Puebla et al., 2017; Sun et al., 2023). It is estimated that 200 million people are infected globally (Certad et al., 2017). Giardiasis transmission can occur through the fecal-oral route, either directly via contact with feces from infected humans or animals, or indirectly through the consumption of food and water contaminated with infective cysts (Ballweber et al., 2010; Dixon, 2021). Clinical manifestations range from asymptomatic to acute or chronic infection, with common symptoms including diarrhea, weight loss, abdominal pain, and malabsorption (Jerez Puebla et al., 2017; Kurnosova et al., 2024).

G. duodenalis is the only species within the genus Giardia known to infect both humans and a wide variety of domesticated and wild mammals (Guadaño Procesi et al., 2022; Sprong et al., 2009). Despite morphological similarities, molecular genotyping has classified the species into eight distinct genetic assemblages (A-H) (Kraft et al., 2017; Rahimi et al., 2023; Zajaczkowski et al., 2021). Assemblages A and B are considered zoonotic, infecting a broad range of hosts including humans and various animals (Cai et al., 2021; Tangtrongsup et al., 2020), whereas assemblages C–H exhibit host specificity. Assemblages C and D primarily infect canids, assemblage E is found in domestic and wild ungulates, assemblage F mainly infects felines, and assemblages G and H are commonly found in rodents and seals, respectively (Ryan et al., 2021).

Sub-assemblages have been further characterized within the zoonotic assemblages A (AI, AII, and AIII) and B (BIII and BIV) (Feng and Xiao, 2011; Piekara-Stępińska et al., 2020; Ryan and Cacciò, 2013). Sub-assemblage AI is considered zoonotic (Faria et al., 2017; Hernández et al., 2019), and AII mainly infects humans but retains zoonotic potential (Ryan and Cacciò, 2013), while AIII is primarily restricted to wild hoofed animals (Cacciò et al., 2008; Feng and Xiao, 2011; Iwashita et al., 2020). Sub-assemblages BIII and BIV are commonly found in humans (Zajaczkowski et al., 2021) and have also been reported in various animal hosts (Sprong et al., 2009). The broad host range of G. duodenalis increases the risk of cross-species transmission, making human giardiasis a continuing public health concern (Hatam-Nahavandi et al., 2025).

Companion animals may play a role in the zoonotic transmission dynamics of giardiasis (Sun et al., 2023). Globally, G. duodenalis infection in cats has an estimated pooled prevalence of 14.5% (Sun et al., 2023). Notably, cats can harbor not only the feline-adapted assemblage F but also the zoonotic assemblages A and B, and occasionally canine-adapted assemblages C and D (Li et al., 2024; Saleh et al., 2019; Yun et al., 2023). Thailand has a large population of abandoned and stray cats (Phoosangwalthong et al., 2023). They often lack veterinary attention and are exposed to extensive environmental contamination, increasing their susceptibility to parasitic infections (Phoosangwalthong et al., 2022). These stray cats frequently reside in public areas, particularly temples, facilitating contact with humans and other animals. This close contact with humans and shared environment make this population highly relevant for molecular epidemiological investigation.

In Thailand, G. duodenalis has been reported in humans (Kitvatanachai et al., 2021; Pipatsatitpong et al., 2018; Siripattanapipong et al., 2011; Tungtrongchitr et al., 2010), livestock (Inpankaew et al., 2015; Khurajog et al., 2014), wildlife (Sricharern et al., 2016; Tangtrongsup et al., 2019), companion animals, including dogs (Inpankaew et al., 2007; Khine et al., 2021; Rojekittikhun et al., 2014; Tangtrongsup et al., 2017, 2020), and cats (Jitsamai et al., 2021; Rojekittikhun et al., 2014; Tangtrongsup et al., 2020), as well as exotic pets (Kamyingkird et al., 2022). Despite these reports, epidemiological information on G. duodenalis infection in cats in Thailand remains limited. To date, few studies have investigated G. duodenalis infection in owned and sheltered cats in Thailand, while stray cat populations remain uninvestigated. Among the existing studies, only one performed molecular characterization (Tangtrongsup et al., 2020), whereas the remaining studies relied solely on microscopic examination or coproantigen detection without genotyping (Jitsamai et al., 2021; Rojekittikhun et al., 2014).

The present study aimed to determine the prevalence of G. duodenalis in temple stray cats in Bangkok, Thailand, characterize the identified genetic assemblages using molecular methods, and explore factors associated with PCR positivity.

2. Materials and methods

2.1. Study area and sample collection

A cross-sectional study was conducted from June to December 2015 among temple stray cats in Bangkok, Thailand. Temple stray cats were defined as unowned cats residing within the temple grounds, comprising both semi-domesticated and feral cats. Based on a stratified random sampling method, 43 temples that host an accessible population of stray cats were randomly selected from 24 districts, with one to three temples per district. A minimum sample size was calculated using the formula n=N1+N(e)2 (Yamane, 1967), assuming a large population size (N = 90,000) with a 5% margin of error (e = 0.05). To account for potential sample loss or degradation, the target was increased to 500 samples. Samples were collected from 2 to 25 cats per temple based on convenience sampling. Fecal samples were collected individually from the rectum of each cat and sampled cats were temporarily marked to ensure each cat contributed only one sample. Samples were immediately placed into labeled plastic bags, and maintained at 4 °C during transportation to the Department of Parasitology, Faculty of Veterinary Medicine, Kasetsart University.

A structured questionnaire was used to interview the monks or animal caretakers to collect information on age, sex, deworming history, human contact, and sampling zone. Human contact was operationally defined by the cat’s habitual, daily behavioral tolerance toward people. Cats were classified as “yes” if they accepted routine feeding, physical handling, or close proximity to caretakers. Cats were classified as “no” if they exhibited strictly feral behavior, actively avoided human approach, and relied exclusively on scavenging.

This study protocol was approved by the Kasetsart University Institutional Animal Care and Use Committee under the Ethical Review Board of the Office of the National Research Council of Thailand (Approval No. ACKU60-VET-006). Informed consent was obtained from the monks or animal caretakers before sample collection.

2.2. DNA extraction

Genomic DNA was extracted from approximately 200 mg of each fecal sample using the E.Z.N.A.® Stool DNA Kit (Omega Bio-tek Inc., Norcross, GA, USA) according to the manufacturer’s instructions and eluted in 100 µL of elution buffer. DNA concentration and purity were measured using a BioSpectrometer (Eppendorf AG, Hamburg, Germany) and stored at -20 °C until further analysis.

2.3. Molecular detection

A nested PCR assay targeting the small subunit ribosomal RNA (SSU rRNA) locus was utilized for the initial screening of G. duodenalis (Hopkins et al., 1997; Read et al., 2002). Positive samples were subsequently characterized by amplifying the glutamate dehydrogenase (gdh) (Cacciò et al., 2008) and triosephosphate isomerase (tpi) loci (Sulaiman et al., 2003) to identify specific assemblages and sub-assemblages. All primer sequences and thermocycling conditions are detailed in Table 1.

Table 1.

Oligonucleotide primers and thermocycling conditions used for the molecular detection and genotyping of G. duodenalis.

Primer name Primer sequences (5’-3’) Cycling condition Size (bp) Reference
SSU rRNA 94 °C/3 min
RH11 CATCCGGTCGATCCTGCC (94 °C/45 s 292 (Hopkins et al., 1997)
RH4 AGTCGAACCCTGATTCTCCGCCAGG 54 °C/45 s
GiarF GACGCTCTCCCCAAGGAC 72 °C/1 min) ×35 174 (Read et al., 2002)
GiarR CTGCGTCACGCTGCTCG 72 °C/3 min
gdh 94 °C/3 min
Gdh1 TTCCGTRTYCAGTACAACTC (94 °C/30 s 754 (Cacciò et al., 2008)
Gdh2 ACCTCGTTCTGRGTGGCGCA 50 °C/30 s
Gdh3 ATGACYGAGCTYCAGAGGCACGT 72 °C/1 min) ×35 530
Gdh4 GTGGCGCARGGCATGATGCA 72 °C/7 min
tpi 95 °C/5 min
TPI-F3 AATAAATIATGCCTGCTCGTCG (94 °C/45 s 605 (Sulaiman et al., 2003)
TPI-R3 ATGGACITCCTCTGCCTGCTC 50 °C/45 s
TPI-F4 CCCTTCATCGGIGGTAACTTCAA 72 °C/1 min) ×35 530
TPI-R2 GTGGCCACCACICCCGTGCC 72 °C/10 min
Open in a new tab

PCR amplifications were performed in a final volume of 25 µL. The reaction mixture for the SSU rRNA assay consisted of 16.8 µL of nuclease-free water, 2.5 µL of 10× PCR buffer, 0.75 µL of MgCl2 (50 mM), 0.5 µL of dNTPs (10 mM), 1.0 µL each of forward and reverse primers (10 µM), 0.2 µL of i-Taq™ DNA Polymerase (5 U/µL; iNtRON Biotechnology, Seongnam, South Korea), 1.25 µL of DMSO, and 1.0 µL of template DNA (genomic DNA for the primary round, or the primary amplicon for the secondary round). For the gdh and tpi assays, the reaction mixture was identical except that DMSO was not included, and the volume of nuclease-free water was adjusted to 18.05 µL. A confirmed G. duodenalis-positive DNA sample was included as a positive control, and nuclease-free water was included as a negative control in each PCR run. The secondary PCR products were visualized by electrophoresis on a 1.5% agarose gel.

2.4. Sequencing and phylogenetic analysis

The positive amplicons were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and submitted to AITbiotech (AITbiotech Pte. Ltd., Singapore) for sequencing. Chromatograms were visually inspected, and consensus sequences were generated using SnapGene® Viewer version 8.2.2 (Dotmatics, Boston, MA, USA). Sequences were compared with reference sequences available in the GenBank database using the Basic Local Alignment Search Tool (BLAST; https://blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple sequence alignments and phylogenetic analyses were performed using MEGA 12 (Kumar et al., 2024). A Maximum Likelihood tree was constructed based on the Tamura 3-parameter substitution model with 1,000 bootstrap replicates.

2.5. Statistical analysis

Data were analyzed using IBM SPSS Statistics version 27 (IBM Corp., Armonk, NY, USA). Prevalence was estimated with 95% confidence intervals (CIs) using the Wilson score method. To evaluate factors associated with PCR positivity, univariable analysis was performed using Pearson’s Chi-square or Fisher’s exact tests. Variables with P < 0.25 in the univariable analysis were entered into a multivariable logistic regression model. Model fit was assessed using the Hosmer-Lemeshow goodness-of-fit test. Cluster-adjusted analyses were attempted but failed to converge due to sparse data. Standard multivariable logistic regression was retained. Final results are reported as adjusted odds ratios (aOR) with 95% CIs. Associations were considered statistically significant at P < 0.05.

3. Results

3.1. Prevalence of G. duodenalis in stray cats

Based on nested PCR amplification of the SSU rRNA gene, the overall prevalence of G. duodenalis in the sampled stray cat population was 10.8% (54/500; 95% CI: 8.4–13.8%). The parasite was detected in 12 of the 24 surveyed districts (50.0%) and in 19 of the 43 sampled temples (44.2%). The highest prevalence was observed in Bang Sue district at 30.0% (3/10; 95% CI: 10.8–60.3%), followed by Khlong Sam Wa at 27.6% (8/29; 95% CI: 14.7–45.7%) and Sai Mai at 27.3% (9/33; 95% CI: 15.1–44.2%) (Table 2, Figure 1).

Table 2.

Prevalence of G. duodenalis infection in temple stray cats stratified by surveyed districts in Bangkok, Thailand.

District No. temples examined No. positive temples No. cats examined No. cats positive Prevalence % (95% CI)
Bang Sue 2 2 10 3 30.0 (10.8–60.3)
Khlong Sam Wa 2 2 29 8 27.6 (14.7–45.7)
Sai Mai 3 2 33 9 27.3 (15.1–44.2)
Samphanthawong 2 2 23 6 26.1 (12.5–46.5)
Min Buri 3 3 35 8 22.9 (12.1–39.0)
Bang Kho Laem 2 1 21 4 19.0 (7.7–40.0)
Dusit 2 1 24 4 16.7 (6.7–35.9)
Lat Krabang 3 2 30 5 16.7 (7.3–33.6)
Taling Chan 2 1 19 3 15.8 (5.5–37.6)
Bangkok Noi 1 1 18 2 11.1 (3.1–32.8)
Don Mueang 2 1 24 1 4.2 (0.7–20.2)
Phasi Charoen 2 1 26 1 3.8 (0.7–18.9)
Phra Nakhon 1 0 5 0 0.0 (0.0–43.4)
Bang Khen 1 0 10 0 0.0 (0.0–27.8)
Ratchathewi 1 0 10 0 0.0 (0.0–27.8)
Nong Chok 1 0 14 0 0.0 (0.0–21.5)
Bangkok Yai 1 0 15 0 0.0 (0.0–20.4)
Thon Buri 2 0 16 0 0.0 (0.0–19.4)
Chom Thong 1 0 18 0 0.0 (0.0–17.6)
Lat Phrao 1 0 18 0 0.0 (0.0–17.6)
Yan Nawa 1 0 19 0 0.0 (0.0–16.8)
Chatuchak 1 0 25 0 0.0 (0.0–13.3)
Bang Khun Thian 3 0 26 0 0.0 (0.0–12.9)
Pom Prap Sattru Phai 3 0 32 0 0.0 (0.0–10.7)
Total 43 19 500 54 10.8 (8.4–13.8)
Open in a new tab

Figure 1.

Map of a city divided into districts, color-coded to indicate prevalence rates with a legend: white for 0% (negative), pale pink for less than 10% (low), medium pink for 10% to 20% (medium), and dark red for more than 20% (high). Several districts are shaded, while non-studied districts are hatched. A numbered list of district names corresponds to labels on the map. An inset map shows the city's location within a country outline.

Open in a new tab

Sampling area and prevalence of G. duodenalis infection in temple stray cats across 24 surveyed districts in Bangkok, Thailand. Source: Map generated using QGIS version 3.44.8. Based on data from the Global Administrative Areas (GADM) database.

3.2. Sequence analysis and genotyping of G. duodenalis

Representative SSU rRNA sequences showed 100% identity to the G. duodenalis reference sequence KT595651. Among the 54 positive samples, 7.4% (4/54) and 11.1% (6/54) were successfully genotyped at the gdh and tpi loci, respectively. Overall, genotyping was achieved for eight isolates: two isolates were characterized at the gdh locus only, four isolates at the tpi locus only, and multilocus genotyping data were available for two isolates.

Assemblage B (sub-assemblage BIV) was identified in 50.0% (4/8) of the genotyped isolates across the gdh (n = 2; 99.37–99.59% identity to OM116001) and tpi (n = 2; 99.59–100% identity to ON037509) loci. Assemblage F was detected in 37.5% (3/8) of the isolates, with two isolates at the gdh locus (99.79–100% identity to EF507608.1) and three isolates at the tpi locus (99.38–99.59% identity to AB569392.1), including the two multilocus-characterized isolates. Assemblage A (sub-assemblage AI) was found in a single isolate (12.5%) at the tpi locus (99.58% identity to ON037510).

Complete concordance was observed between BLAST sequence identities and phylogenetic analyses. The sequences generated in this study clustered with their respective reference sequences for sub-assemblages AI and BIV, and assemblage F (Figures 2, 3). All sequences obtained in this study were deposited in the GenBank database under the accession numbers PZ715188–PZ715196 (SSU rRNA), PZ587430–PZ587433 (gdh), and PZ587434–PZ587439 (tpi).

Figure 2.

Phylogenetic tree diagram showing genetic relationships among various host species including dogs, cats, humans, cattle, sheep, and pigs from different countries. Major clades labeled A, B, C, D, E, and F, with further subgroup divisions such as AI, AII, AIII, BIII, and BIV. Each entry lists a genetic accession number, host, and location. Bootstrap values are indicated at branch nodes, and color-coded backgrounds distinguish major groups. Scale bar at the bottom left represents genetic distance.

Open in a new tab

Phylogenetic tree of G. duodenalis at the tpi locus constructed using the maximum likelihood method based on the Tamura 3-parameter model with 1,000 bootstrap replicates. Bootstrap values lower than 50% are not displayed. Filled rhombuses (♦) represent sequences obtained in this study. The labels (A–F) denote assemblages (A–F), respectively; AI, AII, and AIII denote sub-assemblages within assemblage A, while BIII and BIV denote sub-assemblages within assemblage B. G. ardeae was used as the outgroup. The scale bar represents 0.05 nucleotide substitutions per site. Source: Generated using MEGA 12. Based on GenBank sequences identified in the article by their accession numbers.

Figure 3.

Phylogenetic tree diagram illustrating relationships among viral or genetic sequences from various hosts including humans, cats, dogs, cattle, pigs, and wildlife, categorized into groups A through F with color-coded regions. Each sequence is labeled with an accession number, host, and country, and certain branches have bootstrap values indicating statistical support. Group names and subdivisions such as AI, AII, and BIII are indicated alongside taxon labels, and the scale bar at the bottom left denotes genetic distance.

Open in a new tab

Phylogenetic tree of G. duodenalis at the gdh locus constructed using the maximum likelihood method based on the Tamura 3-parameter model with 1,000 bootstrap replicates. Bootstrap values lower than 50% are not displayed. Filled rhombuses (♦) represent sequences obtained in this study. The labels (A–F) denote assemblages (A–F), respectively; AI, AII, and AIII denote sub-assemblages within assemblage A, while BIII and BIV denote sub-assemblages within assemblage B. G. ardeae was used as the outgroup. The scale bar represents 0.05 nucleotide substitutions per site. Source: Generated using MEGA 12. Based on GenBank sequences identified in the article by their accession numbers.

3.3. Factors associated with PCR positivity of G. duodenalis

The univariable and multivariable logistic regression analyses of associated factors are detailed in Table 3. In the multivariable model, the absence of human contact was identified as an exploratory factor associated with higher odds of PCR positivity (aOR = 8.80; 95% CI: 2.15–35.98; P = 0.002). Although sex and geographic zone passed the univariable screening, neither was retained as a significant predictor in the final model (P = 0.128 and P = 0.068, respectively). Age group and deworming history showed no significant association with G. duodenalis PCR positivity.

Table 3.

Univariable and multivariable logistic regression analyses of factors associated with G. duodenalis PCR positivity in temple stray cats.

Factor No. examined Positive (%) Univariable OR (95% CI) P-value Multivariable aOR (95% CI) P-value
Sex 0.145 0.128
Female 213 28 (13.1%) Ref Ref
Male 287 26 (9.1%) 0.66 (0.37–1.16) 0.64 (0.36–1.14)
Age group 0.934 –
< 1 year 104 11 (10.6%) Ref – –
≥ 1 year 396 43 (10.9%) 1.03 (0.51–2.08) – –
Human contact 0.016*a 0.002*
Yes 485 49 (10.1%) Ref Ref
No 15 5 (33.3%) 4.45 (1.46–13.55) 8.80 (2.15–35.98)
Deworming 0.811 –
Yes 123 14 (11.4%) Ref – –
No 377 40 (10.6%) 0.92 (0.48–1.76) – –
Zone 0.203 0.068
Inner city 218 19 (8.7%) Ref Ref
Suburban 177 25 (14.1%) 1.72 (0.91–3.24) 0.092 1.74 (0.92–3.29) 0.086
Urban fringe 105 10 (9.5%) 1.10 (0.49–2.46) 0.812 0.64 (0.23–1.76) 0.384
Open in a new tab

* P< 0.05. aP calculated using Fisher’s exact test. Dashes (–) indicate that the variable was not retained in the final multivariable model. OR, odds ratio; aOR, adjusted odds ratio; CI, confidence interval.

4. Discussion

G. duodenalis is among the most common intestinal protozoa in humans and a diverse range of animals (Adam, 2021; Feng and Xiao, 2011). Globally, it has been reported in cats across 23 countries with a pooled prevalence of 14.5% (Sun et al., 2023). In this study, the prevalence of G. duodenalis in stray cats was 10.8% (54/500; 95% CI: 8.4–13.8%). This prevalence is comparable to findings from Australia at 10.1% (Yang et al., 2015), Southern China at 9.8% (Zheng et al., 2015), and Spain at 9.2% (Gil et al., 2017). While lower prevalences have been reported in Iran at 1.5% (Karimi et al., 2023), South Korea at 3.8% (Kwak and Seo, 2020), and parts of China at 2.0–5.8% (Li et al., 2019; Li et al., 2024; Pan et al., 2018), considerably higher infection rates are documented with prevalences reaching 17.9% in Germany (Sommer et al., 2018), 25.0% in Mexico (Veyna-Salazar et al., 2023), 27.9% in Jordan (Mukbel et al., 2024), and 29.9% in Bangladesh (Nahar et al., 2026). This significant variation in prevalence is also documented in Thailand. A study reported a high prevalence of 27.3% (Tangtrongsup et al., 2020), whereas significantly lower infection rates were found at 3.9% (Jitsamai et al., 2021) and 0.3% (Rojekittikhun et al., 2014). Methodological differences may explain these discrepancies. Tangtrongsup et al. (2020) employed a highly sensitive combination of diagnostic techniques, including zinc sulfate centrifugal flotation, immunofluorescent assay (IFA), and molecular analysis. This approach can yield a higher prevalence than studies relying solely on coproantigen ELISA testing (Jitsamai et al., 2021) or conventional microscopic examination (Rojekittikhun et al., 2014). In addition to diagnostic sensitivity, the prevalence of G. duodenalis depends on the studied population, environmental conditions, and geographic locations (Enemark et al., 2020; Piekara-Stępińska et al., 2020; Tangtrongsup et al., 2020; Wang et al., 2021).

Determining the G. duodenalis assemblage and sub-assemblage is crucial for understanding its zoonotic potential (Guadaño Procesi et al., 2022; Zajaczkowski et al., 2021). While the multi-copy SSU rRNA gene provides superior sensitivity, its highly conserved sequences are primarily utilized for confirming the presence of G. duodenalis DNA rather than resolving specific sub-assemblages (Jerez Puebla et al., 2017; Zajaczkowski et al., 2021). Achieving high-resolution genotyping requires highly discriminatory single-copy genes, including gdh and tpi (Thompson and Ash, 2016; Zajaczkowski et al., 2021). In this study, assemblages B (n = 4), F (n = 3), and A (n = 1) were detected in the surveyed temple stray cats. While the host-adapted assemblage F is predominantly reported in cats globally (Ito et al., 2017; Sun et al., 2023), zoonotic assemblage B emerged as the most frequently detected assemblage among successfully genotyped isolates in this study, followed by assemblage F. This finding aligns with recent epidemiological data from stray cats in Jordan and South Korea (Mukbel et al., 2024; Yun et al., 2023). This apparent similarity should be interpreted cautiously due to potential differences in study populations, sampling strategies, and genotyping methods. The detection of zoonotic assemblages A and B is consistent with findings from various regions, including Germany (Sommer et al., 2018), Japan (Iijima et al., 2018), Spain (Barrera et al., 2026), and Bangladesh (Nahar et al., 2026).

Within assemblages A and B, all successfully genotyped isolates in this study belonged to sub-assemblages AI and BIV, respectively, both of which are considered to have high zoonotic potential (Sprong et al., 2009). Among felines, AI is frequently documented, occasionally followed by AII (Barrera et al., 2026; Iijima et al., 2018; Li et al., 2024; Yang et al., 2015). While the broader assemblage B is frequently reported in dogs and other animals, assigning feline isolates to a specific sub-assemblage is rarely reported, though Barrera et al. (2026) previously identified sub-assemblage BIII in Spanish cats. This limitation is largely attributed to the high genetic polymorphism within assemblage B, which frequently results in double peaks in sequence chromatograms, making definitive identification highly challenging (Zajaczkowski et al., 2021). The detection of sub-assemblages AI and BIV in this study carries particular epidemiological relevance in Thailand, where both sub-assemblages have been found among humans, domestic animals, and wildlife (Kamyingkird et al., 2022; Pipatsatitpong et al., 2018; Siripattanapipong et al., 2011; Tangtrongsup et al., 2019, 2020; Tungtrongchitr et al., 2010). Furthermore, a case of human infection with the feline-adapted assemblage F has been reported in the country (Kotepui et al., 2025). The identification of these assemblages mirrors prior findings in Bangkok temple communities, where concurrent anthroponotic, zoonotic, and dog-specific cycles have been previously proposed (Traub et al., 2009). Although previous epidemiological studies in the region identified cat contact as a risk factor for human giardiasis (Boontanom et al., 2011), the current cross-sectional data cannot determine if the sampled cats actively contribute to zoonotic transmission. As stray cats naturally congregate and share common soil or sand areas for defecation within temple grounds, it is theoretically possible that environmentally robust cysts may accumulate in these communal sites (Barrera et al., 2026; Hatam-Nahavandi et al., 2025). However, genotyping data alone is insufficient to definitively confirm the source of infection or active cross-species transmission. Confirming a zoonotic cycle requires further epidemiological investigation into food, water, and environmental contamination, combined with genetic comparisons of isolates from humans and animals living in the same communities (Cai et al., 2021).

In the surveyed temple stray cat population, the absence of human contact was identified as an exploratory factor associated with G. duodenalis PCR positivity. This association may be influenced by socioecological, environmental, and nutritional factors. Stray cats that avoid human contact might exhibit more feral behaviors, potentially relying on scavenging and hunting wild prey. These prey animals, including rodents, which have been reported to harbor assemblages A, B, and F (Li et al., 2023), and reptiles, identified as hosts for zoonotic assemblage B in Thailand (Sutthikornchai et al., 2025), represent plausible sources of exposure. Scavenging activities could theoretically increase the likelihood of exposure to environmental sources that might be contaminated with infective cysts, such as water and soil (Li et al., 2023). In contrast, human interaction may serve as a proxy variable for caregiving. Temple cats that tolerate human contact might be fed by monks and local people, potentially receiving better food and cleaner drinking water. This caregiving could reduce their environmental exposure and reliance on hunting. Furthermore, nutrition can modulate susceptibility to G. duodenalis (Gutiérrez and Bartelt, 2024), as inadequate protein intake has been linked to increased susceptibility to giardiasis (Silva et al., 2009). Since these specific scavenging, caregiving, environmental, and nutritional variables were not directly evaluated in this study, they remain untested hypotheses that require further investigation.

Study zones showed no statistically significant association with G. duodenalis PCR positivity, consistent with previous studies (Gil et al., 2017; Karimi et al., 2023; Nahar et al., 2026). In this study, G. duodenalis was detected across 12 districts and multiple zones. This widespread distribution, combined with the free-roaming behavior of these stray cats, may explain the zone-independent pattern. Deworming history was not associated with PCR positivity, corroborating findings that are widely reported (Nahar et al., 2026; Sun et al., 2023; Yang et al., 2015). The absence of an association can be attributed to the broad timeframe over which treatments were recorded and potential misclassification of the specific anthelmintics administered (Le et al., 2026). In our study, age and sex were not significantly associated with G. duodenalis PCR positivity. This demographic-independent pattern has been widely documented for age (Gil et al., 2017; Guadaño Procesi et al., 2022; Li et al., 2019; Nahar et al., 2026; Piekara-Stępińska et al., 2020; Sun et al., 2023) and sex (Gil et al., 2017; Guadaño Procesi et al., 2022; Nahar et al., 2026; Sun et al., 2023; Veyna-Salazar et al., 2023; Yun et al., 2023). Although some studies have reported age and sex as statistical predictors for G. duodenalis infection, the literature remains highly inconsistent. While kittens are more susceptible to G. duodenalis (Pan et al., 2018; Veyna-Salazar et al., 2023), other research has reported a higher prevalence in elderly cats compared to young cats (Yang et al., 2015). The immunological vulnerability that makes kittens more susceptible to G. duodenalis (Kraft et al., 2017) can be offset by the more frequent roaming activities of adult cats for hunting and mating, likely leading to the lack of an age association (Le et al., 2026). Regarding sex, male cats have been reported to have higher infection rates than females (Li et al., 2019), while another study found females to be more susceptible than males (Lider et al., 2025). These differences likely reflect the variability of the studied populations and environments. Given that stray cats have frequent contact with other animals and contaminated environments, this shared ecological exposure can result in similar PCR positivity rates between both sexes.

Several limitations should be considered when interpreting these findings. Since individual cats within the temples were selected via convenience sampling, the findings should be generalized only to the sampled temple stray cats rather than to the wider stray cat population of Bangkok. The reliance on a single cross-sectional sampling may have underestimated the true prevalence of G. duodenalis due to the intermittent shedding of cysts. Sparse data prevented the convergence of cluster-adjusted models, meaning potential temple-level clustering could not be statistically controlled. Additionally, the exploratory association identified between PCR positivity and the absence of human contact was based on a highly imbalanced subgroup of only 15 cats; the resulting wide confidence intervals necessitate cautious interpretation. The relatively low genotyping success rate for the tpi and gdh loci in this study introduces additional diagnostic uncertainty. Such amplification challenges are well-recognized methodological constraints when amplifying single-copy G. duodenalis genes directly from fecal samples (Barrera et al., 2026), and were likely compounded by prolonged DNA storage in this study. Because of these constraints, although no mixed assemblage infections were detected in the present study, their presence cannot be entirely ruled out. Addressing these diagnostic challenges is critical in Thailand, where molecular techniques are underutilized, restricting the generation of comprehensive epidemiological data regarding G. duodenalis assemblage distribution, which is essential for fully understanding host specificity and transmission sources (Kotepui et al., 2025).

To our knowledge, this is the first molecular epidemiological study of G. duodenalis in temple stray cats in Thailand, providing baseline data on its prevalence and the detection of both host-adapted and zoonotic assemblages. Exploratory analysis identified the absence of human contact as a factor associated with PCR positivity. Future studies incorporating paired sampling across human, animal, and environmental interfaces are necessary to elucidate actual transmission pathways and to evaluate potential One Health interventions.

Acknowledgments

The authors are grateful to the staff and graduate students of the Department of Parasitology, Faculty of Veterinary Medicine, Kasetsart University, for their assistance during sample collection, and to the monks, nuns, and animal caretakers for their participation and cooperation.

Funding Statement

The author(s) declared that financial support was received for this work and/or its publication. This work was supported in part by the Center of Excellence on Agricultural Biotechnology, Science and Technology Postgraduate Education and Research Development Office (PERDO), Office of the Higher Education Commission, Ministry of Education, Thailand (AG-BIO/PERDO-CHE) (grant number: AG-BIO/60-004-002), the Faculty of Veterinary Medicine, Kasetsart University (CVRI.VET.KU2026-RF20); and the Thailand Scholarships (Year 2025), awarded by the Ministry of Higher Education, Science, Research and Innovation, Thailand, and Kasetsart University.

Footnotes

Edited by: Joyce Siwila, University of Zambia, Zambia

Reviewed by: Aleksandar Cvetkovikj, Ss. Cyril and Methodius University in Skopje, North Macedonia

Jurairat Jongthawin, Mahaasarakham University, Thailand

Data availability statement

Publicly available datasets were analyzed in this study. This data can be found here: NCBI GenBank, accessions PZ715188–PZ715196 (SSU rRNA), PZ587430–PZ587433 (gdh), and PZ587434–PZ587439 (tpi).

Ethics statement

The animal study was approved by the Institutional Animal Care and Use Committee of Kasetsart University, in accordance with the ethical guidelines of the National Research Council of Thailand. The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

VL: Investigation, Visualization, Software, Data curation, Formal analysis, Writing – original draft. PP: Investigation, Data curation, Writing – review & editing, Visualization, Formal analysis. M-TH: Writing – review & editing, Investigation. TI: Funding acquisition, Resources, Conceptualization, Validation, Methodology, Project administration, Writing – review & editing, Supervision.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that Generative AI was used in the creation of this manuscript. During the preparation of this work, the author(s) used Gemini to assist with the language and improve the readability of the manuscript. After using this tool/service, the author(s) reviewed and edited the content as needed and take full responsibility for the content of the published article.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  1. Adam R. D. (2021). Giardia duodenalis: biology and pathogenesis. Clin. Microbiol. Rev. 34, e00024-19. doi:  10.1128/CMR.00024-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ballweber L. R., Xiao L., Bowman D. D., Kahn G., Cama V. A. (2010). Giardiasis in dogs and cats: update on epidemiology and public health significance. Trends Parasitol. 26, 180–189. doi:  10.1016/j.pt.2010.02.005 [DOI] [PubMed] [Google Scholar]
  3. Barrera J. P., Montoya A., de Lucio A., Köster P. C., Bailo B., Carmena D., et al. (2026). Molecular characterization and zoonotic potential of Giardia and Cryptosporidium infections in dogs and cats in central Spain. Food Waterborne Parasitol. 44, e00351. doi:  10.1016/j.fawpar.2026.e00351 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Boontanom P., Mungthin M., Tan-ariya P., Naaglor T., Leelayoova S. (2011). Epidemiology of giardiasis and genotypic characterization of Giardia duodenalis in preschool children of a rural community, central Thailand. Trop. Biomed. 28, 32–39. [PubMed] [Google Scholar]
  5. Cacciò S. M., Beck R., Lalle M., Marinculic A., Pozio E. (2008). Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int. J. Parasitol. 38, 1523–1531. doi:  10.1016/j.ijpara.2008.04.008 [DOI] [PubMed] [Google Scholar]
  6. Cai W., Ryan U., Xiao L., Feng Y. (2021). Zoonotic giardiasis: an update. Parasitol. Res. 120, 4199–4218. doi:  10.1007/s00436-021-07325-2 [DOI] [PubMed] [Google Scholar]
  7. Certad G., Viscogliosi E., Chabé M., Cacciò S. M. (2017). Pathogenic mechanisms of cryptosporidium and giardia. Trends Parasitol. 33, 561–576. doi:  10.1016/j.pt.2017.02.006 [DOI] [PubMed] [Google Scholar]
  8. Dixon B. R. (2021). Giardia duodenalis in humans and animals – transmission and disease. Res. Vet. Sci. 135, 283–289. doi:  10.1016/j.rvsc.2020.09.034 [DOI] [PubMed] [Google Scholar]
  9. Enemark H. L., Starostka T. P., Larsen B., Takeuchi-Storm N., Thamsborg S. M. (2020). Giardia and Cryptosporidium infections in Danish cats: risk factors and zoonotic potential. Parasitol. Res. 119, 2275–2286. doi:  10.1007/s00436-020-06715-2 [DOI] [PubMed] [Google Scholar]
  10. Faria C. P., Zanini G. M., Dias G. S., da Silva S., Sousa M. C. (2017). New multilocus genotypes of Giardia lamblia human isolates. Infect. Genet. Evol. 54, 128–137. doi:  10.1016/j.meegid.2017.06.028 [DOI] [PubMed] [Google Scholar]
  11. Feng Y., Xiao L. (2011). Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 24, 110–140. doi:  10.1128/CMR.00033-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gil H., Cano L., de Lucio A., Bailo B., de Mingo M. H., Cardona G. A., et al. (2017). Detection and molecular diversity of Giardia duodenalis and Cryptosporidium spp. in sheltered dogs and cats in Northern Spain. Infect. Genet. Evol. 50, 62–69. doi:  10.1016/j.meegid.2017.02.013 [DOI] [PubMed] [Google Scholar]
  13. Guadaño Procesi I., Carnio A., Berrilli F., Montalbano Di Filippo M., Scarito A., Amoruso C., et al. (2022). Giardia duodenalis in colony stray cats from Italy. Zoonoses Public Health 69, 46–54. doi:  10.1111/zph.12894 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gutiérrez L., Bartelt L. (2024). Current understanding of Giardia lamblia and pathogenesis of stunting and cognitive deficits in children from low- and middle-income countries. Curr. Trop. Med. Rep. 11, 28–39. doi:  10.1007/s40475-024-00314-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hatam-Nahavandi K., Ahmadpour E., Badri M., Eslahi A. V., Anvari D., Carmena D., et al. (2025). Global prevalence of Giardia infection in nonhuman mammalian hosts: a systematic review and meta-analysis of five million animals. PloS Negl.Trop. Dis. 19, e0013021. doi:  10.1371/journal.pntd.0013021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hernández P. C., Morales L., Chaparro-Olaya J., Sarmiento D., Jaramillo J. F., Ordoñez G. A., et al. (2019). Intestinal parasitic infections and associated factors in children of three rural schools in Colombia. A cross-sectional study. PloS One 14, e0218681. doi:  10.1371/journal.pone.0218681 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hopkins R. M., Meloni B. P., Groth D. M., Wetherall J. D., Reynoldson J. A., Thompson R. C. A. (1997). Ribosomal RNA sequencing reveals differences between the genotypes of Giardia isolates recovered from humans and dogs living in the same locality. J. Parasitol. 83, 44–51. doi:  10.2307/3284315 [DOI] [PubMed] [Google Scholar]
  18. Iijima Y., Itoh N., Ito Y., Kimura Y. (2018). Multilocus genotyping of Giardia duodenalis isolates from household cats and pet shop kittens. Vet. Parasitol. 259, 44–48. doi:  10.1016/j.vetpar.2018.06.022 [DOI] [PubMed] [Google Scholar]
  19. Inpankaew T., Jiyipong T., Thadtapong N., Kengradomkij C., Pinyopanuwat N., Chimnoi W., et al. (2015). Prevalence and genotype of Giardia duodenalis in dairy cattle from northern and northeastern part of Thailand. Acta Parasitol. 60, 459–461. doi:  10.1515/ap-2015-0063 [DOI] [PubMed] [Google Scholar]
  20. Inpankaew T., Traub R. J., Thompson R. C., Sukthana Y. (2007). Canine parasitic zoonoses in Bangkok temples. Southeast. Asian J. Trop. Med. Public Health 38, 247–255. [PubMed] [Google Scholar]
  21. Ito Y., Iijima Y., Itoh N., Kimura Y. (2017). Multilocus genotyping of Giardia duodenalis isolates from breeding cattery cats in Japan. J. Feline Med. Surg. Open Rep. 3, 2055116917745237. doi:  10.1177/2055116917745237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Iwashita H., Sugamoto T., Takemura T., Tokizawa A., Vu T. D., Nguyen T. H., et al. (2020). Molecular epidemiology of Giardia spp. in northern Vietnam: potential transmission between animals and humans. Parasite Epidemiol. Control 12, e00193. doi:  10.1016/j.parepi.2020.e00193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jerez Puebla L. E., Núñez F. A., Santos L. P., Rivero L. R., Silva I. M., Valdés L. A., et al. (2017). Molecular analysis of Giardia duodenalis isolates from symptomatic and asymptomatic children from La Habana, Cuba. Parasite Epidemiol. Control 2, 105–113. doi:  10.1016/j.parepi.2017.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jitsamai W., Khrutkham N., Hunprasit V., Chandrashekar R., Bowman D., Sukhumavasi W. (2021). Prevalence of endoparasitic and viral infections in client-owned cats in metropolitan Bangkok, Thailand, and the risk factors associated with feline hookworm infections. Vet. Parasitol. Reg. Stud. Rep. 25, 100584. doi:  10.1016/j.vprsr.2021.100584 [DOI] [PubMed] [Google Scholar]
  25. Kamyingkird K., Phoosangwalthong P., Klinkaew N., Leelanupat A., Kengradomkij C., Chimnoi W., et al. (2022). Detection of Giardia duodenalis zoonotic assemblages AI and BIV in pet prairie dogs (Cynomys ludovicianus) in Bangkok, Thailand. Animals 12, 1949. doi:  10.3390/ani12151949 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Karimi P., Shafaghi-Sisi S., Meamar A. R., Razmjou E. (2023). Molecular identification of Cryptosporidium, Giardia, and Blastocystis from stray and household cats and cat owners in Tehran, Iran. Sci. Rep. 13, 1554. doi:  10.1038/s41598-023-28768-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Khine N. O., Chimnoi W., Kamyingkird K., Kengradomkij C., Saetiew N., Simking P., et al. (2021). Molecular detection of Giardia duodenalis and Cryptosporidium spp. from stray dogs residing in monasteries in Bangkok, Thailand. Parasitol. Int. 83, 102337. doi:  10.1016/j.parint.2021.102337 [DOI] [PubMed] [Google Scholar]
  28. Khurajog B., Masakul A., Inpankaew T., Kamyingkird K., Wongpanit K., Jittapalapong S. (2014). Prevalence of Giardia duodenalis and factors associated with its infection in water buffaloes in Northeast Thailand. J. Trop. Med. Parasitol. 37, 35–42. [Google Scholar]
  29. Kitvatanachai S., Jantrapanukorn B., Supcharoengoon U., Atasilp C. (2021). Enteropathogenic bacterial and intestinal parasitic infections among asymptomatic food handlers in Rangsit University canteens, central Thailand. J. Parasitol. Res. 2021, 5565014. doi:  10.1155/2021/5565014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kotepui M., Popruk S., Kotepui K. U., Masangkay F. R., Wangdi K., Mahittikorn A. (2025). Prevalence and genotyping of Giardia duodenalis infections in humans in Thailand: a systematic review and meta-analysis. BMC Infect. Dis. 26, 131. doi:  10.1186/s12879-025-12372-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kraft M. R., Klotz C., Bücker R., Schulzke J. D., Aebischer T. (2017). Giardia’s epithelial cell interaction in vitro: mimicking asymptomatic infection? Front. Cell. Infect. Microbiol. 7, 421. doi:  10.3389/fcimb.2017.00421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kumar S., Stecher G., Suleski M., Sanderford M., Sharma S., Tamura K. (2024). MEGA12: molecular evolutionary genetic analysis version 12 for adaptive and green computing. Mol. Biol. Evol. 41, 1–9. doi:  10.1093/molbev/msae263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kurnosova O. P., Panova O. A., Arisov M. V. (2024). Prevalence of Giardia duodenalis in dogs and cats: age-related predisposition, symptomatic, and asymptomatic cyst shedding. Vet. World 17, 379–383. doi:  10.14202/vetworld.2024.379-383 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kwak D., Seo M. G. (2020). Genetic analysis of zoonotic gastrointestinal protozoa and microsporidia in shelter cats in South Korea. Pathogens 9, 894. doi:  10.3390/pathogens9110894 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Le V. T. T., Hoang M. T. T., Ngo V. P., Ng-Nguyen D., Inpankaew T. (2026). Molecular detection of Giardia duodenalis and the absence of Cryptosporidium spp. in owned dogs from central Vietnam. Front. Parasitol. 5, 1860216. doi:  10.3389/fpara.2026.1860216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Li J., Dan X., Zhu K., Li N., Guo Y., Zheng Z., et al. (2019). Genetic characterization of Cryptosporidium spp. and Giardia duodenalis in dogs and cats in Guangdong, China. Parasitol. Vectors 12, 571. doi:  10.1186/s13071-019-3822-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Li J., Qin H., Li X., Zhang L. (2023). Role of rodents in the zoonotic transmission of giardiasis. One Health 16, 100500. doi:  10.1016/j.onehlt.2023.100500 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Li L., Sui Y., Li X., Song P., Chen G., Liu H., et al. (2024). Molecular characterization of Cryptosporidium spp. and Giardia duodenalis in pet cats in Henan Province, central China. Acta Trop. 254, 107188. doi:  10.1016/j.actatropica.2024.107188 [DOI] [PubMed] [Google Scholar]
  39. Lider L. A., Kiyan V., Seitkamzina D. M., Ussenbayev A., Akmambaeva B. E., Uakhit R. S., et al. (2025). Prevalence, risk factors, and zoonotic implications of gastrointestinal parasites in urban cats in Kazakhstan: a cross-sectional multicity study. Vet. World 18, 1748–1758. doi:  10.14202/vetworld.2025.1748-1758 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Mukbel R., Hammad H., Enemark H., Alsabi R., Al-Sabi M. (2024). Molecular characterization of Giardia duodenalis, Cryptosporidium spp. and Entamoeba spp. infecting domestic and feral/stray cats in Jordan. Parasitol. Res. 123, 351. doi:  10.1007/s00436-024-08358-z [DOI] [PubMed] [Google Scholar]
  41. Nahar A., Hasan M. F., Harun A. B., Bayazid A. A., Sultana T., Rehena J., et al. (2026). Molecular detection and zoonotic potential of Cryptosporidium spp. and Giardia duodenalis in cats and dogs from metropolitan areas of Bangladesh. Food Waterborne Parasitol. 42, e00314. doi:  10.1016/j.fawpar.2025.e00314 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Pan W., Wang M., Abdullahi A. Y., Fu Y., Yan X., Yang F., et al. (2018). Prevalence and genotypes of Giardia lamblia from stray dogs and cats in Guangdong, China. Vet. Parasitol. Reg. Stud. Rep. 13, 30–34. doi:  10.1016/j.vprsr.2018.03.012 [DOI] [PubMed] [Google Scholar]
  43. Phoosangwalthong P., Kamyingkird K., Kengradomkij C., Chimnoi W., Odermatt P., Inpankaew T. (2023). Molecular detection and genetic characterization of zoonotic hookworm in semi-domesticated cats residing in monasteries in Bangkok, Thailand. Trop. Med. Infect. Dis. 8, 122. doi:  10.3390/tropicalmed8020122 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Phoosangwalthong P., Luong N. H., Wongwigkan J., Kamyingkird K., Phasuk J., Pattanatanang K., et al. (2022). Toxocara canis and Toxocara cati in stray dogs and cats in Bangkok, Thailand: molecular prevalence and risk factors. Parasitologia 2, 88–94. doi:  10.3390/parasitologia202000930654563 [DOI] [Google Scholar]
  45. Piekara-Stępińska A., Piekarska J., Gorczykowski M., Bania J. (2020). Genotypes of Giardia duodenalis in household dogs and cats from Poland. Acta Parasitol. 66, 428–435. doi:  10.1007/s11686-020-00292-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Pipatsatitpong D., Aunpad R., Siripattanapipong S., Mungthin M., Leelayoova S. (2018). Prevalence and genotype of Giardia duodenalis of asymptomatic individual in a child care center, Bangkok, Thailand. Sci. Technol. Asia 23, 22–27. doi:  10.14456/scitechasia.2018.20 [DOI] [Google Scholar]
  47. Rahimi H. M., Javanmard E., Taghipour A., Haghighi A., Mirjalali H. (2023). Multigene typing of Giardia duodenalis isolated from tuberculosis and non-tuberculosis subjects. PloS One 18, e0283515. doi:  10.1371/journal.pone.0283515 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Read C., Walters J., Robertson I. D., Thompson R. C. A. (2002). Correlation between genotype of Giardia duodenalis and diarrhoea. Int. J. Parasitol. 32, 229–231. doi:  10.1016/s0020-7519(01)00340-x [DOI] [PubMed] [Google Scholar]
  49. Rojekittikhun W., Chaisiri K., Mahittikorn A., Pubampen S., Sa-nguankiat S., Kusolsuk T., et al. (2014). Gastrointestinal parasites of dogs and cats in a refuge in Nakhon Nayok, Thailand. Southeast. Asian J. Trop. Med. Public Health 45, 31–39. [PubMed] [Google Scholar]
  50. Ryan U., Cacciò S. M. (2013). Zoonotic potential of giardia. Int. J. Parasitol. 43, 943–956. doi:  10.1016/j.ijpara.2013.06.001 [DOI] [PubMed] [Google Scholar]
  51. Ryan U. M., Feng Y., Fayer R., Xiao L. (2021). Taxonomy and molecular epidemiology of Cryptosporidium and Giardia – a 50-year perspective, (1971–2021). Int. J. Parasitol. 51, 1099–1119. doi:  10.1016/j.ijpara.2021.08.007 [DOI] [PubMed] [Google Scholar]
  52. Saleh M. N., Lindsay D. S., Leib M. S., Zajac A. M. (2019). Giardia duodenalis assemblages in cats from Virginia, USA. Vet. Parasitol. Reg. Stud. Rep. 15, 100257. doi:  10.1016/j.vprsr.2018.100257 [DOI] [PubMed] [Google Scholar]
  53. Silva R. R., da Silva C. A. M., de Jesus Pereira C. A., de Carvalho Nicolato R. L., Negrão-Corrêa D., Lamounier J. A., et al. (2009). Association between nutritional status, environmental and socio-economic factors and Giardia lamblia infections among children aged 6–71 months in Brazil. Trans. R. Soc Trop. Med. Hyg. 103, 512–519. doi:  10.1016/j.trstmh.2008.10.019 [DOI] [PubMed] [Google Scholar]
  54. Siripattanapipong S., Leelayoova S., Mungthin M., Thompson R. A., Boontanom P., Saksirisampant W., et al. (2011). Clonal diversity of the glutamate dehydrogenase gene in Giardia duodenalis from Thai isolates: evidence of genetic exchange or mixed infections? BMC Microbiol. 11, 206. doi:  10.1186/1471-2180-11-206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Sommer M. F., Rupp P., Pietsch M., Kaspar A., Beelitz P. (2018). Giardia in a selected population of dogs and cats in Germany – diagnostics, coinfections and assemblages. Vet. Parasitol. 249, 49–56. doi:  10.1016/j.vetpar.2017.11.006 [DOI] [PubMed] [Google Scholar]
  56. Sprong H., Cacciò S. M., Van Der Giessen J. W. B. (2009). Identification of zoonotic genotypes of Giardia duodenalis. PloS Negl.Trop. Dis. 3, e558. doi:  10.1371/journal.pntd.0000558 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Sricharern W., Inpankaew T., Keawmongkol S., Supanam J., Stich R. W., Jittapalapong S. (2016). Molecular detection and prevalence of Giardia duodenalis and Cryptosporidium spp. among long-tailed macaques (Macaca fascicularis) in Thailand. Infect. Genet. Evol. 40, 310–314. doi:  10.1016/j.meegid.2016.02.004 [DOI] [PubMed] [Google Scholar]
  58. Sulaiman I. M., Fayer R., Bern C., Gilman R. H., Trout J. M., Schantz P. M., et al. (2003). Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg. Infect. Dis. 9, 1444–1452. doi:  10.3201/eid0911.030084 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Sun J., Qin Z., Fu Y., Qin H., Sun M., Dong H., et al. (2023). Assessment of potential zoonotic transmission of Giardia duodenalis from dogs and cats. One Health 17, 100651. doi:  10.1016/j.onehlt.2023.100651 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Sutthikornchai C., Pintong A. R., Udonsom R., Khulmanee T., Chiabchalard R., Mahittikorn A., et al. (2025). Detection of Cryptosporidium and Giardia duodenalis in reptiles in Thailand. Vet. Med. Sci. 12, e70704. doi:  10.1002/vms3.70704 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Tangtrongsup S., Scorza A. V., Reif J. S., Ballweber L. R., Lappin M. R., Salman M. D. (2017). Prevalence and multilocus genotyping analysis of Cryptosporidium and Giardia isolates from dogs in Chiang Mai, Thailand. Vet. Sci. 4, 26. doi:  10.3390/vetsci4020026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Tangtrongsup S., Scorza A. V., Reif J. S., Ballweber L. R., Lappin M. R., Salman M. D. (2020). Seasonal distributions and other risk factors for Giardia duodenalis and Cryptosporidium spp. infections in dogs and cats in Chiang Mai, Thailand. Prev. Vet. Med. 174, 104820. doi:  10.1016/j.prevetmed.2019.104820 [DOI] [PubMed] [Google Scholar]
  63. Tangtrongsup S., Sripakdee D., Malaivijitnond S., Angkuratipakorn R., Lappin M. (2019). Intestinal parasites and the occurrence of zoonotic Giardia duodenalis genotype in captive gibbons at Krabokkoo Wildlife Breeding Center, Thailand. Front. Vet. Sci. 6, 110. doi:  10.3389/fvets.2019.00110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Thompson R. C. A., Ash A. (2016). Molecular epidemiology of Giardia and Cryptosporidium infections. Infect. Genet. Evol. 40, 315–323. doi:  10.1016/j.meegid.2015.09.028 [DOI] [PubMed] [Google Scholar]
  65. Traub R. J., Inpankaew T., Reid S. A., Sutthikornchai C., Sukthana Y., Robertson I. D., et al. (2009). Transmission cycles of Giardia duodenalis in dogs and humans in Temple communities in Bangkok—a critical evaluation of its prevalence using three diagnostic tests in the field in the absence of a gold standard. Acta Trop. 111, 125–132. doi:  10.1016/j.actatropica.2009.03.006 [DOI] [PubMed] [Google Scholar]
  66. Tungtrongchitr A., Sookrung N., Indrawattana N., Kwangsi S., Ongrotchanakun J., Chaicumpa W. (2010). Giardia intestinalis in Thailand: identification of genotypes. J. Health Popul. Nutr. 28, 42–52. doi:  10.3329/jhpn.v28i1.4522 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Veyna-Salazar N. P., Cantó-Alarcón G. J., Olvera-Ramírez A. M., Ruiz-López F. J., Bernal-Reynaga R., Bárcenas-Reyes I., et al. (2023). Occurrence of Giardia duodenalis in cats from Queretaro and the risk to public health. Animals 13, 1098. doi:  10.3390/ani13061098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Wang Y. G., Zou Y., Yu Z. Z., Chen D., Gui B. Z., Yang J. F., et al. (2021). Molecular investigation of zoonotic intestinal protozoa in pet dogs and cats in Yunnan Province, southwestern China. Pathogens 10, 1107. doi:  10.3390/pathogens10091107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Yamane T. (1967). Statistics: An Introductory Analysis. 2nd Edn (New York, NY: Harper & Row; ). [Google Scholar]
  70. Yang R., Ying J. L. J., Monis P., Ryan U. (2015). Molecular characterisation of Cryptosporidium and Giardia in cats (Felis catus) in Western Australia. Exp. Parasitol. 155, 13–18. doi:  10.1016/j.exppara.2015.05.001 [DOI] [PubMed] [Google Scholar]
  71. Yun C. S., Moon B. Y., Lee K., Kang S. M., Ku B. K., Hwang M. H. (2023). The detection and phylogenetic characterization of Cryptosporidium, Cystoisospora, and Giardia duodenalis of cats in South Korea. Front. Cell. Infect. Microbiol. 13, 1296118. doi:  10.3389/fcimb.2023.1296118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Zajaczkowski P., Lee R., Fletcher-Lartey S. M., Alexander K., Mahimbo A., Stark D., et al. (2021). The controversies surrounding Giardia intestinalis assemblages A and B. Curr. Res. Parasitol. Vector-Borne Dis. 1, 100055. doi:  10.1016/j.crpvbd.2021.100055 [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Zheng G., Hu W., Liu Y., Luo Q., Tan L., Li G. (2015). Occurrence and molecular identification of Giardia duodenalis from stray cats in Guangzhou, southern China. Korean J. Parasitol. 53, 119–123. doi:  10.3347/kjp.2015.53.1.119 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Publicly available datasets were analyzed in this study. This data can be found here: NCBI GenBank, accessions PZ715188–PZ715196 (SSU rRNA), PZ587430–PZ587433 (gdh), and PZ587434–PZ587439 (tpi).

Articles from Frontiers in Parasitology are provided here courtesy of Frontiers Media SA

RESOURCES