Dietary Echinacea purpurea Attenuates Oxidative Stress and Alters Cytokine Gene Expression Among Heat‐Stressed Broiler Chickens at High Altitude

ABSTRACT

Objectives

The combination of high‐altitude and heat stress promotes oxidative damage and immune dysfunction in broiler chickens. This study investigated the potential of dietary Echinacea purpurea to mitigate these detrimental effects.

Methods

In a 42‐day trial, 108 one‐day‐old male Ross 308 broilers were randomly assigned to one of three dietary regimens: an unsupplemented basal diet (Control), or the basal diet supplemented with 0.25% (E0.25) or 0.75% (E0.75) hydroalcoholic E. purpurea extract. Birds were reared at 2100 m altitude and exposed to chronic heat stress. On Day 42, serum was analysed for nitric oxide (NO) and malondialdehyde (MDA). Hepatic relative telomere length was quantified via qPCR, and the expression of cytokine genes (IL10, IL1β, TNFα and IFNγ) was assessed by RT‐qPCR.

Results

Dietary E. purpurea at both levels significantly lowered serum NO and MDA concentrations compared to the control group (p < 0.05). Relative telomere length was unaffected by treatment. Gene expression analysis revealed that the E0.75 group had significantly elevated transcripts of IL‐10 (900% increase) and IFN‐γ (351% increase), while IL‐1β and TNF‐α remained unchanged. Consequently, the composite pro‐/anti‐inflammatory cytokine ratio [(IFNγ + IL‐1β + TNFα)/IL‐10] was reduced in both supplemented groups (P < 0.05).

Conclusion

Supplementation with E. purpurea alleviated systemic oxidative stress and induced a distinct immunomodulatory response, upregulating key cytokines IL‐10 and IFN‐γ in broilers under dual environmental stress. Telomere length in liver tissue was not preserved under these conditions. These results indicate that E. purpurea is a promising phytogenic feed additive for enhancing broiler resilience in challenging environments.

Dietary Echinacea purpurea (0.75%) alleviated oxidative stress (↓NO, ↓MDA) and selectively upregulated IL‐10 and IFN‐γ expression in heat‐stressed broilers at high altitude, shifting the cytokine balance toward an anti‐inflammatory state without affecting telomere length.

1. Introduction

The global broiler chicken industry operates under immense pressure to meet the escalating demand for animal protein, driving a constant pursuit of enhanced productivity and efficiency. However, this pursuit is often challenged by environmental stressors that compromise bird health, welfare, and ultimately, economic returns (Acheampong 2024). Among the most formidable challenges are the combined stressors of high altitude and heat stress, which are prevalent in many poultry‐rearing regions worldwide (Bhagat et al. 2023). High altitude imposes a condition of chronic hypoxic (low oxygen) stress, forcing physiological adaptations to maintain adequate oxygen delivery to tissues (Gera et al. 2025). Concurrently, heat stress, either seasonally or due to suboptimal housing, disrupts thermoregulation, leading to a state of physiological and metabolic imbalance (Apalowo et al. 2024; Sesay 2022). When these two stressors converge, they could create a uniquely demanding environment that severely depresses growth performance and jeopardizes overall health (Askew 2022).

The pathophysiological consequences of this dual stress are profound and interconnected. At a cellular level, the combination of hypoxia and hyperthermia is a potent inducer of oxidative stress, where the production of reactive oxygen species (ROS) overwhelms the body's antioxidant defences (Ahmadipour et al. 2025). This oxidative damage ravages cellular lipids, proteins, and DNA, disrupting essential biological functions (Aryal et al. 2025). Furthermore, these stressors trigger a complex immune response, often leading to dysregulation. The expression of pro‐inflammatory and anti‐inflammatory cytokines (key signalling molecules of the immune system) can become imbalanced, potentially leading to chronic inflammation that diverts energy from growth and productivity (Park et al. 2019). More recently, the concept of cellular aging under stress has gained attention in chickens (Bahadoran et al. 2025; Hassanpour et al. 2023). Telomeres, the protective nucleoprotein caps at the ends of chromosomes, are highly susceptible to oxidative damage. Accelerated telomere shortening is a marker of cellular aging and senescence, and its potential link to stress‐induced performance decline in poultry is a critical yet underexplored area of research (Farhadi et al. 2025). In this context, Bahadoran et al. (2026) recently investigated the effects of E. purpurea on broilers reared under high‐altitude conditions (without heat stress), providing foundational evidence for its immunomodulatory properties in a hypoxic environment. However, that study examined a single stressor and, notably, reported that 0.75% E. purpurea supplementation unexpectedly increased serum nitric oxide and malondialdehyde levels, suggesting a context‐dependent pro‐oxidant effect under mild oxidative challenge. The present study extends this work by introducing chronic heat stress as a compounding factor, a scenario far more representative of commercial poultry production in high‐altitude regions where seasonal or housing‐related thermal stress is common. This dual‐stress model (hypoxia + hyperthermia) creates a substantially greater oxidative burden, which we hypothesised would unmask the antioxidant and immunomodulatory potential of E. purpurea that remained undetected under single‐stress conditions. Furthermore, while Bahadoran et al. (2026) focused solely on gene expression changes, the present investigation integrates effect size quantification to determine the biological magnitude of treatment effects and composite cytokine ratio analysis to assess net inflammatory balance rather than individual gene changes. Additionally, we characterised the volatile fraction of the hydroalcoholic E. purpurea extract using GC‐MS to provide a chemical fingerprint of the supplement used; however, the primary bioactive constituents (phenolic acids and alkamides) were quantified by the manufacturer using HPLC, as these polar compounds are not amenable to GC‐MS analysis. These methodological and conceptual advances allow us to test whether E. purpurea functions as a stress‐responsive adaptogen, exerting effects that are quantitatively and qualitatively distinct under compounded environmental duress.

The declining use of antibiotic growth promoters, driven by regulatory pressures and consumer concerns, has accelerated the search for natural alternatives (Zheng et al. 2025). Among these, phytogenic feed additives (plant‐derived compounds) have gained prominence for their diverse biological properties (Aminullah et al. 2025). The purple coneflower, Echinacea purpurea, is one such botanical renowned for its immunomodulatory and antioxidant properties. Rich in bioactive compounds such as alkamides, caffeic acid derivatives, and polysaccharides, E. purpurea has been shown to enhance immune function and mitigate oxidative damage in various species (Burlou‐Nagy et al. 2022). Its potential to act as a natural adaptogen, helping animals cope with environmental challenges, makes it a compelling intervention for broilers facing the compounded stress of high altitude and heat. However, the specific protective effects of dietary E. purpurea on the underlying molecular mechanisms, namely, the orchestration of cytokine gene expression, the preservation of telomere integrity, and the restoration of oxidative balance, in broilers under this specific dual‐stress condition remain largely unknown. Therefore, this study was designed to investigate the hypothesis that dietary supplementation with E. purpurea will ameliorate the adverse effects of high altitude and heat stress in broiler chickens. We aimed to elucidate its efficacy by evaluating key molecular markers: the expression of critical cytokine genes (IL10, IL1β, TNFα and IFNγ), the relative telomere length as an indicator of cellular health and aging, and the systemic oxidative status (lipid peroxidation and nitric oxide levels) through key antioxidant and oxidative damage parameters. The findings aim to provide a scientific basis for using E. purpurea as a strategic nutritional intervention to enhance resilience and productivity in sustainable poultry production systems.

2. Materials and methods

2.1. E. purpurea Extract Preparation and Volatile Profile Characterisation by Gas Chromatography–Mass Spectrometry (GC–MS)

The hydroalcoholic extract of E. purpurea aerial parts was obtained commercially (Raha Exir Pharmed Co., Iran). According to the manufacturer's certificate of analysis, the extract was prepared by macerating dried plant material in a 70:30 (v/v) ethanol:water solution for 72 h, followed by filtration and low‐pressure evaporation at 40°C. The resulting dry extract had a total phenolic content equivalent to 4.2% gallic acid and a total alkamide content of 0.8%, as determined by spectrophotometric and HPLC methods, respectively. The extract was stored at 4°C in the dark until being incorporated into the feed.

The GC–MS analysis was performed to characterise the volatile fraction of the hydroalcoholic extract. However, this approach primarily detects non‐polar volatile compounds and does not quantify the major polar bioactive constituents (phenolic acids, alkamides) that are characteristic of hydroalcoholic E. purpurea extracts. The manufacturer's HPLC data (total phenolics 4.2% GAE, alkamides 0.8%) provide the relevant characterisation of these primary bioactive fractions. Analysis was performed using an Agilent 7890B gas chromatograph coupled to a 5977B mass spectrometer (Agilent Technologies, USA). Separation was achieved on an HP‑5MS capillary column (30 m × 0.25 mm i.d., 0.25 µm film thickness). The oven temperature was programmed from 50°C (held for 3 min) to 250°C at a rate of 3°C/min, with a final hold time of 10 min. High‐purity helium (99.999%) was used as the carrier gas at a constant flow rate of 1.5 mL/min. The injector temperature was set to 250°C, and 1 µL of the extract (diluted 1:100 in hexane) was injected in splitless mode. The mass spectrometer operated in electron ionization (EI) mode at 70 eV, with an ion source temperature of 230°C and a quadrupole temperature of 150°C. The mass scan range was m/z 35–500. Compounds were tentatively identified by comparison with the NIST 2020 library and retention indices calculated from n‐alkanes (C₈–C₄₀). Relative composition was determined from normalized peak areas, and only compounds with ≥ 80% match probability and RI deviation < 20 units were reported.

2.2. Chicken Housing, Feeding and Sampling Procedures

This study was conducted at the Poultry Research Facility of Shahrekord University (altitude: 2100 m). A total of 108 one‐day‐old male Ross 308 broiler chicks (Behjoje Co., Iran) with an average initial body weight of 42.5 ± 1.2 g were wing‐banded and randomly assigned to one of three dietary treatments (36 birds/treatment, 12 birds/pen and 3 pens/treatment). The basal diet was formulated to meet Ross 308 requirements (Aviagen 2019) and consisted of corn and soybean meal. The E. purpurea hydroalcoholic extract (Raha Exir Pharmed Co.) was pre‐mixed with corn starch as a carrier at a ratio of 1:5 (extract: carrier, w/w) to facilitate even distribution. This pre‐mix was then gradually added to the basal diet at 0.25% or 0.75% (w/w) and blended using a horizontal feed mixer for 20 min. Each dietary group was then housed in three replicate pens, with 12 birds per pen. The 42‐day rearing period took place at an altitude of 2100 meters in uniformly sized (1.2 m²) deep‐litter floor pens. Standard management practices were applied, including 23 h of light per day, ad libitum access to feed and water, and controlled ventilation and humidity. For the heat stress protocol, the initial ambient temperature was 31°C on day one. Beginning on Day 12, the temperature was incrementally raised to reach 38°C by Day 21 and was subsequently maintained at this level. The basal diet was formulated to meet or exceed the nutrient requirements of Ross 308 broilers (Aviagen 2019). The starter (Days 1–10), grower (Days 11–24) and finisher (Days 25–42) diets were provided as crumbles and pellets, respectively. The detailed composition and nutritional values of the basal diets are provided in Table S1. Standardised vaccination and husbandry protocols were uniformly implemented across all pens. On the final day of the experiment (Day 42), blood samples were collected from 12 randomly selected birds per treatment group. To minimise stress per collection, blood was drawn in two steps: 2 mL in the morning (07:00–08:00) and 2 mL in the evening (18:00–19:00) from the brachial vein. The two samples were pooled for analysis. Birds were monitored after each collection; no mortality or adverse effects were observed. The pooled blood samples were centrifuged at 2500 g for 10 min to isolate serum. Subsequently, the chickens were humanely euthanized using carbon dioxide, after which their livers were immediately collected. All liver samples were flash‐frozen and stored at −70°C to preserve them for future DNA and RNA extraction.

Mortality was recorded daily throughout the 42‐day experimental period as a percentage per treatment group. Dead birds were weighed and necropsied to determine the cause of death.

2.3. Measurement of Serum Nitric Oxide

Given the instability of NO in the circulation, its concentration was assessed indirectly through quantification of nitrite, its primary metabolite. Nitrite levels were determined using the Griess reaction following cadmium‐facilitated reduction of nitrate to nitrite (Hasani et al. 2025). For sample preparation, 300 µL of serum was treated with 250 µL of 75 mmol/L zinc sulfate to precipitate proteins and then centrifuged at 10000 × g for 1 min at room temperature. The supernatant was mixed with 350 µL of 55 mmol/L NaOH and centrifuged again at 10000 × g for 3 min. From the clarified solution, 750 µL was combined with 250 µL of glycine buffer (45 g/L, pH 9.7). Nitrate reduction was achieved by adding activated cadmium granules preconditioned with 5 mmol/L CuSO₄ in glycine–NaOH buffer and stirring for 10 min. Nitrite concentrations were determined via the Griess reaction. In this assay, nitrite reacts with 75 µL of sulfanilamide (1%, C₆H₈N₂O₂S) under acidic conditions (5% phosphoric acid) to form a diazonium salt. This salt then couples with 80 µL of N‐(1‐naphthyl)ethylenediamine dihydrochloride (0.1%, C₁₂H₁₄Cl₂N₂), producing a red–violet azo dye (C₁₆H₁₄N₄O₃S; λ _max = 540 nm). The absorbance of this dye is directly proportional to the nitrite concentration within the linear range of the assay. A standard calibration curve was prepared using sodium nitrite (0–100 µM), and sample concentrations were calculated from the linear regression equation (Hasani et al. 2025). The limit of detection (LOD) for this in‐house assay, determined as 3.3 times the standard deviation of the blank divided by the slope of the calibration curve, was 0.85 µM, confirming the reliability of the detected NO concentration values.

2.4. Malondialdehyde Measurement

Serum malondialdehyde (MDA), an index of lipid peroxidation, was quantified using the thiobarbituric acid reactive substances (TBARS) assay (Li et al. 2023). Briefly, 250 µL of serum was mixed with an equal volume of 20% trichloroacetic acid (TCA) for protein precipitation and centrifuged. An aliquot of 250 µL from the supernatant was then combined with 250 µL of 0.67% thiobarbituric acid, followed by incubation in a 95°C water bath for 10 min. After cooling and a second centrifugation step, the absorbance of the supernatant was measured at 532 nm. MDA concentrations were calculated from a standard calibration curve prepared with known MDA solutions and expressed as µM MDA equivalents (Li et al. 2023). All chemicals were obtained from Sigma–Aldrich Chemical Co. (St. Louis, MO, USA).

2.5. DNA / RNA Extraction and cDNA Synthesis

Genomic DNA was isolated from whole blood using a commercial extraction kit (Sinaclon Co., Karaj, Iran). Total RNA was extracted from liver tissue with RNXPUS reagent (Sinaclon Co., Karaj, Iran) according to the manufacturer's protocol, and the resulting RNA preparations were treated with DNase to eliminate residual genomic DNA contamination. The purity of all nucleic acid samples was verified by NanoDrop spectrophotometry, and only extracts with an A260/A280 ratio between 1.8 and 2.0 were included in subsequent analyses. Complementary DNA (cDNA) was synthesised from DNase‐treated RNA using the PrimeScript Reverse Transcription Kit (Takara Bio Inc., Japan) with random hexamer primers. Genomic DNA and synthesised cDNA were stored at −70°C until analysis by quantitative real‐time PCR (RT‐qPCR).

2.6. RT‐qPCR Analysis of Telomere Length

Relative telomere length in liver tissue was assessed by quantitative real‐time PCR (RT‐qPCR) using a 2× SYBR Green master mix (Parstous Co., Mashhad, Iran). Primer sequences for telomere amplification and the reference gene YWHAZ were adopted from a previous study (Hassanpour et al. 2023); sequences and sources are listed in Table 1. Each reaction (10 µL) contained 15 ng of genomic DNA. For telomere amplification, forward and reverse primer concentrations were 250 nM and 750 nM, respectively, whereas both YWHAZ primers were used at 250 nM. All samples were analysed in triplicate on a Rotor‐Gene 6000 system (Qiagen, Australia). The telomere cycling program consisted of an initial denaturation at 95°C for 10 min, followed by 20 cycles of 95°C for 15 s and 54°C for 2 min. For YWHAZ, amplification was performed at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 62°C for 30 s. No‐template controls were included to monitor potential contamination, and melt‐curve analysis verified the presence of a single, specific product for each amplicon. Threshold cycle (Ct) values and mean amplification efficiencies (E) for telomere and YWHAZ reactions were obtained using LinRegPCR software (version 2012.0, Amsterdam, Netherlands). The average amplification efficiencies were 1.90 for telomere primers (R ² = 0.96) and 1.91 for the YWHAZ gene (R ² = 0.98). The relative telomere length was calculated using the formula E _YWHAZ ^{(Ct sample)} / E _telomere ^{(Ct sample)} representing telomere abundance normalized to the reference gene. Relative telomere length values were log10‐transformed prior to statistical analysis to improve normality.

TABLE 1.

Primers used for quantitative real‐time PCR analysis of chicken telomere and mRNAs.

Target	Primer	Tm (°C)	GC (%)	Accession No.	PCR production (bp)	Ta (°C)
Telomere	5′CGGTTTGTTTGGGTTTGGGTTTG GGTTTGGGTTTGGGTT‐3′	67.6	48.7	54	78	—
	5′‐GGCTTGCCTTACCCTTACCCTTAC CCTTACCCTTACCCT‐3′	69.7	53.8
IL10	5′‐TCACCGCTTCTTCACCTGC‐3′	60.3	57.9	60	82	NM_001004414.4
	5′‐CCCGTTCTCATCCATCTTCTCG‐3′	60.5	54.6
IL1β	5′‐AGTGCTTCGTGCTGGAGT‐3′	58.6	55.6	61	72	NM_204524.2
	5′‐CTTTCTGGCTGGAGGAGGG‐3′	59.4	63.2
IFNγ	5′‐ACAAGTCAAAGCCGCACAT‐3′	54.0	42.1	60	136	NM_205149.2
	5′‐CGCTGGATTCTCAAGTCGTT‐3′	60.0	50.1
TNFα	5′‐TGTTCTATGACCGCCCAGTTC‐3′	59.8	52.4	60	105	AY765397.1
	5′‐CACCACACGACAGCCAAGT‐3′	58.8	57.9
YWHAZ	5′‐AGGAGCCGAGCTGTCCAATG‐3′	62.2	60.0	62	83	NM_001031343.1
	5′‐TCCAAGATGACCTACGGGCTC‐3′	61.3	57.1

2.7. RT‐qPCR Analysis of IL10, IL1β, TNFα and IFNγ Gene Expression

Expression levels of IL10, IL1β, TNFα, and IFNγ were compared among the heat‐control, E0.25, and E0.75 groups using relative quantitative real‐time PCR. The YWHAZ gene was used as the internal reference for normalization. Gene‑specific primers (Table 1) were designed using Primer‑BLAST (NCBI) based on the Gallus gallus genome. Each reaction (10 µL), run in triplicate, contained 10 ng of cDNA together with 400 nM of the corresponding gene‐specific primers. The PCR program consisted of an initial denaturation at 94°C for 10 min, followed by 40 amplification cycles of 94°C for 15 s and 60°C–62°C for 60 s. No‐template and no‐reverse‐transcriptase controls were included to monitor contamination and genomic DNA carryover. Primer specificity was verified by the presence of a single melt‐curve peak and a single amplicon of the expected size on agarose gel electrophoresis.

2.8. Statistical Analysis

Data are expressed as mean ± standard error (SE). Normality of residuals was assessed using the Shapiro–Wilk test. Data were analysed using a linear mixed‐effects model (LMM) with treatment (control, E0.25 and E0.75) as a fixed effect and pen as a random effect nested within treatment. Group differences were assessed using restricted maximum likelihood (REML) estimation, followed by Tukey's post hoc test for pairwise comparisons when significant effects were observed.  Gene expression values were first normalized before statistical evaluation. The magnitude of treatment effects was quantified using marginal R ² (mR²) for mixed models, interpreted as small (≈ 0.01), medium (≈ 0.06), large (≈ 0.14) and very large (> 0.50). A probability level of p < 0.05 was considered indicative of statistical significance. The composite cytokine ratio [(IFNγ+IL‐1β+TNFα)/IL‐10] was calculated per individual bird from normalized expression values, and group means were derived from these individual ratios to preserve biological variability. Outlier detection was performed using Grubb's test (α = 0.05) for all dependent variables prior to statistical analysis. All statistical analyses were performed using IBM SPSS Statistics, version 26.0 (IBM Corp., Armonk, NY, USA).

3. Results

3.1. Volatile Profile of the Hydroalcoholic Extract

GC‐MS analysis of the hydroalcoholic extract of E. purpurea aerial parts revealed a volatile profile dominated by the sesquiterpene germacrene D (24.2%), followed by p‐cymene (5.8%) and α‐humulene (5.2%). Other major constituents included borneol (4.9%), caryophyllene oxide (4.6%), β‐caryophyllene (4.4%), β‐bisabolene (3.9%), and farnesol (3.5%). Monoterpenes such as α‐pinene, limonene, and β‐pinene were present in lower amounts (1.4%–2.4%). The chemical profile was characterised by a predominance of sesquiterpenoids, which together constituted the largest volatile fraction. Table 2 summarises the identified compounds along with their retention indices and relative percentages.

TABLE 2.

GC‐MS Analysis of Echinacea purpurea hydroalcoholic extract.

Compound name	Retention index	Percentage (%)
Germacrene D	1268	24.2
p‐Cymene	1018	5.8
α‐Humulene	1184	5.2
Borneol	1212	4.9
Caryophyllene oxide	1512	4.6
β‐Caryophyllene	1035	4.4
β‐Bisabolene	1440	3.9
Farnesol	1602	3.5
Myristicin	1502	2.5
α‐Pinene	919	2.4
Thymol	1284	2.4
Globulol	1532	2.3
Limonene	983	2.2
Myrtenal	1315	2.2
α‐Cadinene	1542	2.1
Pinocarvone	1115	1.5
β‐Pinene	966	1.4
Myrtenol	1193	1.4
Sabinene	928	1.3
Valencene	1607	1.2
β‐Elemene	1398	1.1
Terpinene‐4‐ol	1181	1.1
Copaene	1492	1.1
α‐Terpinene	1046	1.0
Bis(2‐ethylhexyl) phthalate	1661	0.9
Methyl acetate	1414	0.4
Carvacrol	1311	0.3
α‐Cadinol	1564	0.3
Spathulenol	1576	0.2
α‐Phellandrene	997	0.2
Phytol	2100	0.2

3.2. Serum NO, MDA and Liver Telomere Length Assessments

Figure 1A,B compares serum NO and MDA levels among three experimental groups of chickens. The NO and MDA levels decreased in the heat+E0.25 and heat+E0.75 groups compared to the heat control group (p < 0.05), whereas these parameters remained unchanged between the heat+E0.25 and heat+E0.75 groups (p > 0.05).

FIGURE 1.

Comparison of nitric oxide (NO, A): malondialdehyde (MDA, B) and telomere length (C) between heat control and two concentrations of Echinacea purpurea (Heat + E0.25: Echinacea 0.25%; Heat + E0.75: Echinacea 0.75%) groups. Data are presented as log10‐transformed relative telomere length. p < 0.05 is statistically considered significant.

Figure 1C compares relative telomere length levels in the liver of chickens among three experimental groups. This parameter did not change among the heat control, heat+E0.25 and heat+E0.75 groups (p > 0.05).

3.3. Expression of IL10, IL1β, TNFα and IFNγ Genes

Figure 2 compares the transcriptional levels of three cytokines between the control and two E. purpurea treatment groups (E0.25 and E0.75). The transcription of IFNγ (Figure 2A) only increased in the E0.75 group compared to the control group (351%; p < 0.05), while its transcription did not significantly change between the heat control and E0.25 or between the E0.25 and E0.75 groups (p > 0.05).

FIGURE 2.

Comparison of cytokine gene expression (A: IFNγ; B: IL10; C: IL1β, D: TNFα) and their ratio [E: (IFNγ + IL1β + TNFα) / IL10] between heat control and two concentrations of Echinacea purpurea (Heat + E0.25: Echinacea 0.25%; Heat + E0.75: Echinacea 0.75%) groups. p < 0.05 is statistically considered significant.

The transcription of IL10 (Figure 2B) increased in the E0.75 group compared to the control and E0.25 groups by 900% and 215.8%, respectively (p < 0.05), while its transcription did not significantly change between the heat control and E0.25 groups (p > 0.05).

The IL1β (Figure 2C) and TNFα (Figure 2D) transcription remained unchanged among the E0.25, E0.75 and control groups (p > 0.05).

The composite cytokine transcription ratio [(IFNγ + IL‑1β + TNFα) / IL‑10] was significantly reduced in both E0.25 and E0.75 groups compared to the control group (p < 0.05) by 67.7% and 90.7%, respectively, though no difference was observed between the E0.25 and E0.75 groups (p > 0.05) (Figure 2E).

3.4. Effect Size Analysis of Treatment Outcomes

To quantify the magnitude of treatment effects, mR² values were calculated for each outcome variable (Table 3). The effect of dietary E. purpurea on serum NO was statistically highly significant (p < 0.001) and corresponded to a very large effect size (mR²  =  0.721). Serum MDA levels were also significantly reduced (p  =  0.021), with a medium–large effect (mR²  =  0.119).

TABLE 3.

Effect sizes (Marginal R ²) and statistical significance of Echinacea purpurea supplementation on stress biomarkers and cytokine gene expression.

Outcome variable	Model p‐value	Marginal R 2	Magnitude
Oxidative stress markers
Serum NO	p < 0.001	0.721	Very large
Serum MDA	p = 0.021	0.119	Medium–large
Cytokine gene expression
IL‐10	p = 0.004	0.303	Large
IL‐1β	p = 0.242	0.085	Medium
IFN‐γ	p = 0.023	0.211	Large
TNF‐α	p = 0.496	0.053	Small
Composite cytokine ratio
(IFNγ + IL‐1β + TNFα) / IL‐10	p = 0.021	0.296	Large

Note: Effect magnitude interpretation: Marginal R² ≈ 0.01 (small), ≈ 0.06 (medium), ≈ 0.14 (large) and > 0.50 (very large). p‐values are from linear mixed‐effects model with pen as random effect.

Among cytokine genes, E. purpurea supplementation induced a large and significant upregulation of IL‐10 (P  =  0.004; mR²  =  0.303) and IFN‐γ (p  =  0.023; mR²  =  0.211) expression. In contrast, IL‐1β (p  =  0.242; mR²  =  0.085) and TNF‐α (P  =  0.496; mR²  =  0.053) showed non‐significant changes with medium and small effect sizes, respectively. Consequently, the composite pro‐/anti‐inflammatory cytokine ratio [(IFNγ + IL‐1β + TNFα)/IL‐10] was significantly lowered (p  =  0.021) with a large effect size (mR²  =  0.296). These results confirm that E. purpurea exerted strong and meaningful effects on oxidative stress markers and specific immune‐related genes, while leaving others largely unaffected.

3.5. Mortality Rate

The overall mortality rate during the 42‐day trial was 8% in the control group, 5% in the E0.25 group and 3% in the E0.75 group. Mortality was observed from 28 days with clinical signs consistent with heat stress and ascites syndrome.

4. Discussion

The present study provides novel molecular insights into the protective effects of dietary E. purpurea against the compounded stressors of high altitude and heat in broiler chickens. By integrating assessments of oxidative stress, inflammatory cytokine gene expression, and telomere integrity, our findings highlight the potential of this phytogenic additive as a modulator of stress‐induced physiological dysregulation.

The manufacturer's certificate of analysis indicated that the hydroalcoholic E. purpurea extract contained 4.2% total phenolics (as gallic acid equivalents) and 0.8% total alkamides, consistent with the expected composition of such extracts. Compounds of this class, such as cichoric acid and caftaric acid, are well‐established for their antioxidant and immunomodulatory activities (Ahmadi 2024). GC‐MS analysis characterised only the volatile fraction of the extract, identifying sesquiterpenes such as germacrene D as major volatile constituents. While these volatiles may contribute to the extract's overall bioactivity, the observed physiological effects are more plausibly attributed to the phenolic and alkamide fractions, based on the manufacturer's data and the established literature. We did not independently confirm the presence of individual phenolic compounds in the extract or quantify them in the finished feed, and future studies should address this limitation.

The mortality observed reflects the severity of the dual‐stress model (heat + altitude). This combination imposes a ‘double burden,’ heat stress increases oxygen demand while hypoxia limits supply predisposing broilers to pulmonary hypertension and ascites syndrome. The numerically lower mortality in supplemented groups suggests a potential protective effect of E. purpurea, possibly mediated through its antioxidant and anti‐inflammatory properties (Ashour et al. 2025).

The significant reduction in serum NO and MDA levels in broilers supplemented with E. purpurea indicates a clear attenuation of oxidative stress under combined high‐altitude and heat stress conditions. This finding is consistent with several studies that have reported the antioxidant capacity of Echinacea extracts in poultry through lowering MDA levels and enhancing antioxidant enzyme activities in broilers, aligning with our observation of reduced lipid peroxidation (Ashour et al. 2025; Lee et al. 2013; Zhang et al. 2025). However, the lack of a dose‐dependent effect between the 0.25% and 0.75% supplementation levels suggests that even the lower dose may be sufficient to elicit a maximal antioxidant response under these conditions, possibly due to saturation of bioactive compound absorption or activity. The reduction in NO, a molecule involved in both signalling and oxidative damage, may reflect a modulation of inflammatory pathways, as excessive NO production under stress is often linked to nitrosative stress and tissue injury (Ichikawa and Sugiura 2025).

Furthermore, the effect size analysis revealed a very large treatment effect on serum NO, indicating that E. purpurea supplementation was the predominant factor explaining variance in this oxidative stress marker under our experimental conditions. This strong effect underscores the potency of E. purpurea in mitigating nitrosative stress, which is particularly relevant given the hypoxic component of high‐altitude stress. The medium–large effect on MDA further supports its role in reducing lipid peroxidation, though with comparatively less explanatory power than for NO.

The lack of telomere change in liver may reflect the low turnover rate of hepatocytes compared to rapidly dividing tissues such as leukocytes or intestinal epithelium. In addition, the 21‐day stress period may be insufficient to induce measurable telomere attrition in this tissue. Telomere dynamics are tissue‐dependent, and future studies should examine multiple tissues to fully evaluate E. purpurea’s telomere‐protective potential. Previous research in birds has demonstrated that chronic environmental stressors, including heat stress and hypoxia, can accelerate telomere shortening (Badmus et al. 2022; Bahadoran et al. 2025; Hassanpour et al. 2023; Musa et al. 2025). Our results suggest that, within the study timeframe, the protective effects of E. purpurea on oxidative stress did not directly translate into telomere preservation. This is consistent with the absence of prior research showing a positive effect of E. purpurea on telomere length. The finding contrasts with stress‐model studies where antioxidant interventions mitigated telomere shortening (Gheytaspour et al. 2025; Tohidifar et al. 2023), highlighting the complexity of telomere biology in avian species (Frydrychová et al. 2024) and underlining the need for longer‐term studies or investigations in more telomere‐sensitive tissues. Furthermore, telomere length was assessed only in liver tissue; telomere dynamics vary across tissues depending on proliferative capacity and baseline telomerase expression, and it remains possible that protective effects could manifest in other tissues such as immune cells or intestinal epithelium.

The simultaneous upregulation of IL‐10 and IFNγ by E. purpurea reflects a balanced immunomodulatory response rather than a simple pro‐ or anti‐inflammatory bias. Mechanistically, these effects are attributable to distinct bioactive fractions acting through different receptors on macrophages. Alkylamides act as potent ligands for cannabinoid receptor 2 (CB2) on monocytes/macrophages, activating p38/MAPK, JNK, and NF‐κB signalling pathways to induce de novo cytokine gene transcription, including IFNγ and TNFα (Gertsch et al. 2004). Simultaneously, Echinacea polysaccharides engage toll‐like receptor 4 (TLR4) on macrophages, also activating NF‐κB and stimulating IL‐6, TNF, IL‐12 and nitric oxide production. Importantly, while these pathways can drive pro‐inflammatory gene transcription, alkylamides also potently inhibit LPS‐induced TNFα, IL‐1β and IL‐12p70 protein expression in a CB2‐independent manner, while concurrently upregulating IL‐10. This dual capacity, stimulating gene transcription while suppressing protein translation of pro‐inflammatory cytokines may explain the simultaneous elevation of IL‐10 (anti‐inflammatory) and IFNγ (Th1 effector) without overt inflammation. In the chicken model, it was demonstrated that Echinacea enhances IFNγ expression through TLR4‐NF‐κB pathway regulation. Thus, the net effect is a shift toward an anti‐inflammatory and Th1‐supportive cytokine milieu, consistent with the reduced composite pro‐/anti‐inflammatory ratio observed in our study (Catanzaro et al. 2018; Rady et al. 2023; Vlasheva et al. 2024). In contrast to the findings of Bahadoran et al. (2026), who reported that E. purpurea supplementation under high‐altitude conditions alone did not reduce (and at 0.75% increased) serum NO and MDA levels, the present study observed a significant reduction in both oxidative stress markers. The key distinction between the two studies is the imposition of chronic heat stress in our experimental model. It appears that under the more severe oxidative burden created by dual stress (high altitude + heat), the antioxidant capacity of E. purpurea becomes functionally apparent, whereas under high‐altitude conditions alone, this effect is not detected. The significant increase in IFN‐γ, a prototypical Th1 cytokine, suggests a simultaneous potentiation of cell‐mediated immune responses (Park et al. 2021). This dual effect, elevating both a regulatory cytokine (IL‐10) and an effector cytokine (IFN‐γ) may indicate an immunomodulatory “balancing” effect, priming the immune system without provoking excessive inflammation. The dramatic reduction in the composite pro‐ to anti‐inflammatory cytokine ratio [(IFNγ + IL‐1β + TNFα) / IL‐10] in both supplemented groups strongly supports an overall shift toward a more regulated and less inflammatory immune status. Effect size quantification reinforced this interpretation: IL‐10 and IFN‐γ showed large and significant effects, whereas IL‐1β and TNF‐α exhibited only medium and small non‐significant effects. This pattern confirms that E. purpurea’s immunomodulation is selective, strongly promoting an anti‐inflammatory and Th1‐oriented response without broadly activating pro‐inflammatory pathways. The large effect size for the composite cytokine ratio further emphasizes that the intervention substantially shifted the overall immune milieu toward a more regulated state. This finding is consistent with the concept of E. purpurea as an immunomodulator that can restore cytokine balance disrupted (Declerck et al. 2021; Oliveira et al. 2022).

This study provides molecular evidence for the protective role of E. purpurea; however, some limitations should be acknowledged. While birds were reared at 2100 m to model chronic hypoxic stress, key physiological indicators of hypoxia such as blood oxygen saturation (SpO₂) and haemoglobin concentration were not measured. Including these parameters would have offered a direct, quantitative link between the high‐altitude environment and the systemic stress response, thereby strengthening the interpretation of the oxidative and immunomodulatory outcomes. Future work should aim to integrate such haematological and gasometric measurements with molecular assays. In addition, extending the study duration, examining other metabolically active tissues (e.g., skeletal muscle, heart), and testing graded doses of E. purpurea could further elucidate its adaptogenic potential and optimal application in poultry production under environmental duress. We acknowledge that the GC‐MS analysis characterised only the volatile fraction of the raw extract and does not confirm the stability of these compounds in the finished pelleted feed. The sesquiterpenes identified are heat‐labile and may undergo thermal rearrangement or loss during pelleting. However, the key bioactive constituents of E. purpurea hydroalcoholic extracts, caffeic acid derivatives and alkamides are more polar and less volatile, and their stability in feed matrices warrants independent investigation. Future studies should quantify these marker compounds in finished feed to establish industrial relevance.

5. Conclusion

This study confirms that E. purpurea supplementation robustly alleviates oxidative stress, with particularly strong effects on nitrosative pathways (very large effect size for NO), and selectively modulates immune responses by upregulating IL‐10 and IFN‐γ (large effect sizes) while leaving pro‐inflammatory cytokines largely unaffected. These quantitatively substantial effects support E. purpurea as a promising natural supplement for enhancing broiler resilience under environmental stress. Specifically, dietary E. purpurea reduced oxidative damage and promoted a balanced cytokine profile, favouring anti‐inflammatory IL‑10 and IFN‑γ expression. However, telomere length remained unaffected, suggesting that E. purpurea's protective effects may not extend to telomere maintenance within this experimental context. Future studies should explore longer durations, additional tissues and optimized dosing to fully harness its potential in sustainable poultry production.

Author Contributions

Shahab Bahadoran: writing – original draft, software, methodology, investigation, formal analysis, supervision, resources, project administration, data curation. Hossein Hassanpour: methodology, writing – review and editing. Shadi Vaeznia: validation, data curation, methodology, investigation, conceptualization.

Funding

The authors have nothing to report.

Ethics Statement

The study underwent an ethical review and was approved (approved code: IR.SKU.REC.1404.019) by the Institutional Animal Care and Use Committee of Shahrekord University under the standard of the 1964 Declaration of Helsinki, and was carried out at the experimental facility of this university.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supporting File 1: vms371234‐sup‐0001‐TableS1.docx

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.