ABSTRACT
Post-translational modifications, including ubiquitination, have emerged as important regulators of viral infection and the host innate immune response. We screened the proteins of SARS-CoV-2 for ubiquitination and identified the RNA-dependent RNA polymerase (RdRp) NSP12 as being ubiquitinated, which has not previously been reported. Importantly, we confirmed that NSP12 is ubiquitinated during SARS-CoV-2 infection, and the NSP12 proteins of different coronaviruses are differentially associated with ubiquitin chains. SARS-CoV-2 NSP12 was primarily associated with K63-linked polyubiquitin chains, which increased SARS-CoV-2 NSP12 stability relative to OC43 NSP12, which was associated with K48 chains. Additionally, we identify the atypical E3 ubiquitin ligase MYCBP2 as a mediator of serine ubiquitination of SARS-CoV-2 NSP12 on serine-564 and observe that MYCBP2 promotes SARS-CoV-2 replication in cell-based assays. Substitution of this single residue (S564A) in CoV-2 NSP12 prevented recovery of infectious virus in three independent attempts, precluding direct genetic validation of its role in viral replication. To our knowledge, these findings provide the first evidence of serine ubiquitination of a viral protein and suggest a previously unrecognized role for RdRp ubiquitination in coronavirus biology.
IMPORTANCE
Viruses often hijack host post-translational modification systems, including ubiquitination, to enhance the functions of their proteins and evade host innate immune responses. We screened the viral proteins of SARS-CoV-2 and found that NSP2, NSP5, NSP12, NSP15, and NSP16 are ubiquitinated. Focusing on NSP12, the RNA-dependent RNA polymerase (RdRp), we found that it is associated with multiple types of ubiquitin modifications, and RdRp proteins from other coronaviruses are differentially ubiquitinated. We also found that SARS-CoV-2 RdRp undergoes ubiquitination on a serine, rather than a canonical lysine residue, mediated by the atypical E3 ubiquitin ligase, MYCBP2. Consistent with this, MYCBP2 promotes efficient SARS-CoV-2 replication in cell-based assays. To our knowledge, this study provides the first evidence of non-lysine ubiquitination of a viral protein and demonstrates the serine selectivity of MYCBP2 for the first time in a cellular context. These findings raise important questions about the regulatory function of serine NSP12 ubiquitination in coronavirus replication and its potential contribution to viral pathogenicity.
KEYWORDS: SARS-CoV-2, ubiquitination, coronavirus, RNA-dependent RNA polymerase, posttranslational modifications, MYCBP2
INTRODUCTION
Viruses encode a limited set of proteins, and post-translational modifications (PTMs) can enhance the functional capabilities of viral proteins. Viruses have evolved sophisticated mechanisms of hijacking the host PTM machinery to enhance their replication. Ubiquitination is essential for innate antiviral immune signaling, and its role in the activation of the RIG-I-like receptors RIG-I and MDA5 and downstream signaling cascades is well-studied (1–6). Unsurprisingly, the ubiquitin system is therefore a frequent target of viral manipulation. These ubiquitin-virus interactions can tip the balance in favor of either the host or the virus and are a key focus of host-virus interaction studies (7–12).
SARS-CoV-2 is no exception. Early studies described SARS-CoV-2-induced alterations to the host ubiquitin landscape (13, 14). More recent studies have focused on understanding the functional roles of ubiquitin and ubiquitin-like modifications of SARS-CoV-2 viral proteins (15–27). The importance of ubiquitination for SARS-CoV-2 infection and the potential translational aspects of this understanding are evidenced by several reviews on the topic (28, 29).
We examined ubiquitination of SARS-CoV-2 non-structural protein 12 (NSP12), the virus’s essential RNA-dependent RNA polymerase (RdRp). Unlike reports on ubiquitination or sumoylation of non-essential viral accessory proteins (30–33), RdRp in other RNA viruses such as influenza A virus (IAV) (34–36) has been shown to be ubiquitinated by host factors and required for efficient activity. Thus, we asked if and how NSP12 ubiquitination influences SARS-CoV-2 replication.
RESULTS
We initially performed a screen of 20 SARS-CoV-2 proteins. Expression plasmids for each HA-tagged viral protein were transfected into HEK293T cells, and the viral proteins were subjected to immunoprecipitation and western blotting to detect endogenous ubiquitin association (Fig. S1). From this screen, we identified SARS-CoV-2 NSP2, NSP5, NSP12, NSP15, and NSP16 as ubiquitinated when overexpressed in HEK293T cells (Fig. 1A). SARS-CoV-2 NSP5 and NSP16 ubiquitination has previously been described (25, 26, 37). Thus, we focused on SARS-CoV-2 NSP12, as it has not previously been reported to undergo ubiquitination. To rule out the possibility of the NSP12 ubiquitin signal coming from co-precipitating ubiquitinated proteins, and not from NSP12 itself, we immunoprecipitated HA-NSP12 from HEK293T cells using lysis and wash buffers containing different amounts of NP-40 and SDS, high salt concentration, or urea. NSP12 ubiquitination was maintained across all conditions, supporting the conclusion that NSP12 is associated with covalent polyubiquitin chains (Fig. 1B and C). We also performed a double immunoprecipitation experiment, which further confirmed that NSP12 itself is ubiquitinated, and the ubiquitinated species is a minority of the total NSP12 (Fig. S2A and B). We confirmed NSP12 ubiquitination during SARS-CoV-2 infection by immunoprecipitating NSP12 from infected VeroE6 cells (Fig. 1D and E). Two ~100 kDa species were detected, with the slower migrating band corresponding to ubiquitinated NSP12, as confirmed by ubiquitin immunoblotting (Fig. 1E). Reciprocal ubiquitin pull-down revealed multiple higher-molecular-weight NSP12 species and a polyubiquitin-association smear (Fig. 1F). Because endogenous NSP12 was analyzed under conditions optimized for protein recovery (multiplicity of infection [MOI] = 5, 24 h post-infection), the present study does not define the temporal kinetics of NSP12 polyubiquitination during infection. Future studies examining earlier stages of infection will be required to determine whether this modification occurs during the period of active viral RNA synthesis and contributes directly to SARS-CoV-2 replication. Together, these data demonstrate that SARS-CoV-2 NSP12 is ubiquitinated in the context of viral infection.
Fig 1.
NSP12 is ubiquitinated during SARS-CoV-2 infection. (A) HEK293T cells were transfected with HA-tagged SARS-CoV-2 protein expression constructs, followed by anti-HA immunoprecipitation and immunoblotting for ubiquitination. (B) The ubiquitinated SARS-CoV-2 proteins identified in Fig. S1A were expressed in HEK293T cells and immunoprecipitated using anti-HA beads under different salt concentrations. Horvath lysis buffer (HLB) contains 280 mM NaCl. A more stringent buffer containing 550 mM NaCl is expected to disrupt non-covalent interactions with the immunoprecipitated protein. (C) Proteins were expressed as in panel A under increasingly harsh conditions: HLB, RIPA, or a denaturing 6 M urea buffer (50 mM Tris-HCl pH 8.0 [Sigma], 6 M urea, 350 mM NaCl, 0.5% [vol/vol] IGEPAL CA-630 [Sigma], and 40 mM imidazole), which is expected to disrupt all non-covalent interactions with the immunoprecipitated protein. (D and E) VeroE6 cells were infected with SARS-CoV-2 at MOI = 5 for 24 h, followed by immunoprecipitation using an anti-NSP12 antibody or rabbit IgG control. IP and whole-cell lysates (WCLs) were analyzed for ubiquitination by immunoblotting. (F) Reciprocal pull-down of HA-tagged ubiquitin followed by immunoblotting to probe for NSP12 association. HEK293T cells were transfected with HA-tagged ubiquitin and FLAG-tagged NSP12.
Because polyubiquitin chain topology can dictate substrate fate beyond proteasomal degradation, we next characterized the ubiquitin linkages associated with SARS-CoV-2 NSP12. K48- and K63-linked ubiquitin species were detected on NSP12 immunoprecipitated from SARS-CoV-2-infected cells (Fig. 2A), consistent with the diverse signaling functions attributed to distinct ubiquitin chain types. K48-linked chains are classically associated with proteasomal turnover, whereas K63-linked chains frequently regulate protein trafficking, signaling, and protein-protein interactions.
Fig 2.
The NSP12 proteins of diverse CoVs are differentially ubiquitinated. (A) VeroE6 cells were infected at MOI = 1 for 24 h, followed by immunoprecipitation using an anti-NSP12 antibody. The IP was probed for specific ubiquitin linkages, and the whole-cell lysate (WCL) probed for total NSP12 and actin. Asterisk indicates non-specific band. (B) Phylogenetic tree showing evolutionary relationships of the coronavirus NSP12s used in the panel. Scale bar represents evolutionary distance in amino acid substitutions per site. Node values indicate the percentage of 100 bootstraps having the indicated phylogenetic relationship. (C) HEK293T cells were transfected with the indicated FLAG-tagged coronavirus NSP12 construct, followed by immunoprecipitation using anti-FLAG beads. The IP and WCL were probed for ubiquitination by immunoblotting. Values represent the mean densitometric intensities of Ub-bands normalized to IP-FLAG bands. (D) HEK293T cells were transfected with the indicated HA-tagged expression constructs, followed by IP using anti-HA beads and immunoblotting for specific ubiquitin linkages with linkage-specific antibodies. (E and F) NSP12 stability assays. HEK293T cells were transfected with HA-tagged CoV-2 NSP12 (D) or OC43 NSP12 (E) for 18 h, followed by treatment with the indicated inhibitors (CHX: cycloheximide 50 µg/mL; MG132: 20 mM), and whole cell lysates were collected every 3 h. NSP12 levels in WCLs were analyzed by immunoblotting WCLs. Values represent the mean densitometric intensities of HA bands normalized to GAPDH. An asterisk indicates non-specific binding.
We next assessed whether NSP12 ubiquitination was conserved across coronaviruses using FLAG-tagged NSP12 constructs from a panel of coronaviruses (Fig. 2B). Ubiquitination levels varied among NSP12 proteins, with notably higher ubiquitination of HCoV-OC43 NSP12 and increased ubiquitination of SARS-CoV-2 Delta variant NSP12 compared to the ancestral SARS-CoV-2 WA1 strain (Fig. 2C). We note that the levels of NSP12-FLAG proteins in the whole-cell lysate (WCL) were not uniform, which is likely due to a combination of different transfection efficiencies and differences in protein stability when overexpressed in HEK293T cells without the addition of cofactors such as NSP7/8. In the case of IBV, reduced stability could be due to the species mismatch between human HEK293T cells and the natural avian hosts for this virus. Despite these different expression levels in the WCL, we successfully loaded equivalent amounts of immunoprecipitated protein (slightly less for IBV), which allowed for comparison of ubiquitination levels across the different coronavirus RdRps.
To compare ubiquitination profiles among coronavirus polymerases, HA-tagged SARS-CoV-2 and OC43 NSP12 proteins were expressed in HEK293T cells, immunoprecipitated, and analyzed using linkage-specific ubiquitin antibodies. SARS-CoV-2 NSP8, previously shown to undergo K48-linked ubiquitination, served as a positive control (15). Both SARS-CoV-2 and OC43 NSP12 were associated with K48-linked ubiquitin chains; however, K48-linked ubiquitination was more prominent on OC43 NSP12. In contrast, SARS-CoV-2 NSP12 exhibited a stronger association with K63-linked ubiquitin chains than OC43 NSP12 (Fig. 2D). These findings indicate that although both polymerases undergo K48- and K63-linked ubiquitination, the relative abundance of these linkage types differs between SARS-CoV-2 and OC43 NSP12.
Given their differential K48 association, we tested whether the stability differed between SARS-CoV-2 and OC43 NSP12. HEK293T cells expressing SARS-CoV-2 or OC43 HA-NSP12 were treated with proteasomal and/or translation inhibitors, and NSP12 levels were monitored over 6 h. SARS-CoV-2 NSP12 was stable following cycloheximide treatment, whereas OC43 NSP12 was rapidly degraded and stabilized by MG132 treatment (Fig. 2E and F). Thus, OC43 NSP12 exhibits reduced stability compared to SARS-CoV-2 NSP12 in this system, consistent with its increased association with K48-linked ubiquitin chains.
Ubiquitination requires a cascade of three enzymes: an E1 activating enzyme, an E2 conjugating enzyme, and an E3 ligase. The E3 ligase imparts substrate selectivity to the process and, together with their cognate E2s, determines ubiquitin linkage type and functional outcomes. We therefore sought to identify the E3 ligase(s) responsible for SARS-CoV-2 NSP12 ubiquitination. Leveraging the SARS-CoV-2 protein interactome published by Gordon et al. (38), we identified MYCBP2, a ~514 kDa atypical RING-Cys-relay (RCR) E3 ubiquitin ligase that catalyzes ubiquitin transfer to serine and threonine residues through a unique relay mechanism, as a candidate E3 ligase for NSP12 (39, 40). MYCBP2 was the only E3 ligase reported to interact with NSP12. This was consistent with our mass-spectrometry data identifying ubiquitinated serine and threonine residues on NSP12 during SARS-CoV-2 infection (Fig. 3A).
Fig 3.
MYCBP2 ubiquitinates NSP12 at S564. (A) Post-translational modifications associated with NSP12 identified by tandem LC-MS/MS. NSP12 was immunoprecipitated from infected VeroE6 cells, resolved by SDS-PAGE, and analyzed by LC-MS/MS. Data were analyzed in PEAKS DB to calculate P-values. (B) HEK293T cells were transfected with increasing amounts of MYCBP2 plasmid and a constant amount of HA-NSP12, or MYCBP2 was knocked down prior to and during NSP12 transfection. NSP12 was immunoprecipitated using anti-HA beads, and the IPs were probed for ubiquitination. Values represent the mean densitometric intensities of Ub bands normalized to HA bands. (C) HEK293T cells were transfected with HA-NSP12 and increasing amounts of MYCBP2 plasmid, followed by immunoprecipitation using anti-HA beads. The IPs were probed for MYCBP2 co-precipitation and ubiquitination by immunoblotting. (D) Biochemical confirmation of ubiquitinated sites identified by LC-MS/MS analysis, peptides shown in panel A. HA-tagged expression constructs encoding the mutant NSP12s were transfected into HEK293T cells, followed by anti-HA IP and immunoblotting for ubiquitination. Values represent the mean densitometric intensities of Ub-bands normalized to HA bands. (E) HEK293T cells were transfected with HA-WT-NSP12 or HA-S564A-NSP12 with increasing amounts of MYCBP2 plasmid, followed by anti-HA immunoprecipitation. IPs were analyzed for ubiquitination by immunoblotting.
MYCBP2 knockdown markedly reduced SARS-CoV-2 NSP12 ubiquitination in transfected HEK293T cells, whereas MYCBP2 overexpression increased SARS-CoV-2 NSP12 ubiquitination in a dose-dependent manner (Fig. 3B and C). Mass spectrometry identified several ubiquitination sites in SARS-CoV-2 NSP12 (Fig. 3A). To confirm that these sites are ubiquitinated, we generated point mutations to an HA-NSP12 construct and probed for the effects on total ubiquitin levels. Multiple individual point mutations reduced NSP12 ubiquitination, with S564A having the largest effect (Fig. 3D). We therefore chose to follow up on the significance of this residue. Consistently, MYCBP2 overexpression did not enhance ubiquitination of an NSP12 S564A mutant, suggesting that MYCBP2 targets NSP12 at residue S564 (Fig. 3D and E). While individual point mutations to NSP12 reduced the level of ubiquitination, a triple mutant (S564A/T565A/T567A) restored ubiquitin levels. We hypothesize that this is a result of the activation of cryptic or compensatory ubiquitination sites, a commonly observed phenomenon in the field in which the mutation of preferred ubiquitination sites results in the targeting of new residues for ubiquitination due to structural changes in the target protein (18, 35, 41, 42).
To assess the contribution of MYCBP2-mediated ubiquitination to SARS-CoV-2 replication, we initially attempted to generate MYCBP2 knockout cell lines; however, these displayed a severe growth defect. We therefore performed siRNA-mediated knockdown in A549-AT cells (Fig. 4A). Knockdown of MYCBP2 reduced viral titers by ~0.7–1 log at 48 h post-infection, while knockdown of the E2 conjugating enzyme UBE2D3 reduced SARS-CoV-2 titers by ~0.4 log compared with a scramble control (Fig. 4B). Notably, despite achieving only 46% knockdown of MYCBP2 expression, potentially reflecting the large size and stability of the protein, we observed a statistically significant reduction in viral replication in siMYCBP2 cells. These findings suggest that more complete depletion of MYCBP2 would be expected to produce an even greater replication defect. Combined knockdown of UBE2D3 and MYCBP2 resulted in an ~1.5 log reduction in viral titers, which could suggest that the UBE2D3-MYCBP2 axis contributes to efficient SARS-CoV-2 replication (Fig. 4B). However, as the double knockdown reduced cell viability, the effect on viral replication could be due to impaired cell growth. As MYCBP2 knockdown did not result in cell loss, we can conclude that MYCBP2 contributes to efficient SARS-CoV-2 replication. Given the role of NSP12 in viral genome replication and transcription, we hypothesized that knockdown of MYCBP2 might affect NSP12 activity at early timepoints in infection. To measure this, we performed qRT-PCR on cDNA synthesized from RNA samples collected from si-treated cells at 0, 6, 12, 24, and 48 h post-infection. In support of our hypothesis, the most significant differences in viral genome levels between MYCBP2 knockdown cells and mock-treated cells were observed at 6 h post-infection (Fig. 4C). Consistent with our plaque assay results, knockdown of MYCBP2 alone reduced viral genome levels at 48 h post-infection, with double knockdown of UBE2D3 and MYCBP2 having a larger effect (Fig. 4C), although the reduction in cell viability may confound this effect. Although the differences in viral genome levels at 12 h post-infection did not reach statistical significance due to larger variability in the replicates, we observed the same trend as at 6, 24, and 48 h.
Fig 4.
The UBE2D3-MYCBP2 axis is utilized for efficient SARS-CoV-2 replication. (A) Confirmation of siRNA-mediated knockdown in A549-AT cells. Densitometry analysis of protein of interest normalized to loading control. (B) A549-AT cells were treated with the indicated siRNA for 48 h prior to infection with SARS-CoV-2 at MOI = 0.1 for 48 h. Supernatants were collected and analyzed by plaque assay to measure viral titers. Statistical significance was determined by Dunnett’s multiple comparison test. (C) Viral genome kinetics measured by qRT-PCR. A549-AT cells were treated with siRNA and infected as described in panel B. Statistical significance was determined by Dunnett’s multiple comparison test. (D) HEK293T cells were transfected with FLAG-WT-NSP12 or FLAG-S564A-NSP12, with or without co-transfection with HA-tagged NSP7 and NSP8, followed by anti-HA or anti-FLAG immunoprecipitation. Interaction between NSP7-8 and WT or mutant NSP12 was analyzed by immunoblotting.
Attempts to rescue a recombinant SARS-CoV-2 expressing NSP12 S564A using previously described and validated bacterial artificial chromosome-based reverse genetics (43) were unsuccessful in three independent attempts, whereas wild-type SARS-CoV-2 was consistently recovered under the same conditions, preventing direct assessment of the role of S564 ubiquitination in viral replication. The inability to recover the mutant virus is unlikely due to impaired replication-transcription complex assembly, as mutant S564A NSP12 retained interaction with NSP8 (Fig. 4D).
DISCUSSION
In this study, we found that SARS-CoV-2 NSP12 is ubiquitinated during infection and modified by both K48- and K63-linked polyubiquitin chains, whereas OC43 NSP12 is predominantly modified by K48-linked chains, consistent with reduced stability relative to SARS-CoV-2 NSP12. We further identified SARS-CoV-2 NSP12 S564 as a site of serine ubiquitination mediated by the E3 ligase MYCBP2 and observed that this modification is associated with enhanced SARS-CoV-2 replication in cell-based assays. To our knowledge, this represents the first report of serine ubiquitination on a viral protein. Additionally, although MYCBP2 has previously been characterized biochemically for serine/threonine ubiquitin transfer activity in cell-free systems, our findings provide evidence that MYCBP2 targets serine/threonine residues in a cellular context.
Previous studies reported SARS-CoV-2 NSP12 ubiquitination following heat and arsenic trioxide treatment (44, 45). Under those conditions, Maimaitiyiming et al. and Yang et al. found that ubiquitination promoted NSP12 degradation and reduced viral titers. In contrast, in the context of SARS-CoV-2 infection and without destabilizing stimuli, we found that NSP12 is stable against proteasomal degradation, and ubiquitination appears to promote viral replication.
Based on NSP12-NSP7-NSP8-RNA structures, we hypothesize that S564 ubiquitination in SARS-CoV-2 NSP12 may regulate RNA binding, as reported for IAV polymerase (36). The site is located directly adjacent to residues that interact with RNA in the binding groove (Fig. S3B). Attempts to rescue a recombinant SARS-CoV-2 with the S564A mutation in NSP12 were unsuccessful in three different attempts, despite consistent recovery of wild-type virus under identical conditions. While this may suggest an important functional constraint at this position, as the residue is highly conserved across coronaviruses (Fig. S3A), it cannot be genetically confirmed in the context of infectious virus. The inability to recover the mutant virus is unlikely due to major structural destabilization, as S564 resides within an ⍺-helix, and alanine substitutions stabilize ⍺-helices. Although S564 is not on the protein surface in NSP12’s folded equilibrium conformation, it may still potentially be accessible for ubiquitination during folding prior to NSP12 achieving its final conformation. We also note that additional residues are likely ubiquitinated on NSP12 as indicated by the mass spectrometry and western blotting results of NSP12 mutants. Although our findings suggest that S564 is a major contributor to NSP12 ubiquitination, future studies will be needed to determine the relative contributions of additional ubiquitination sites to NSP12 modification and viral replication. One unanswered question raised by our results is where MYCBP2 and NSP12 interact within the cell. Viral RNA replication and transcription occur in convoluted membranes remodeled from the ER, and NSP12 is primarily sequestered in these viral double-membrane vesicles (DMVs) (46–48). MYCBP2 is primarily cytoplasmic with some nuclear localization under certain signaling conditions (49, 50). Given the large size of MYCBP2, it is unlikely to be able to enter DMVs, and furthermore, there is no evidence that this occurs. We therefore hypothesize that MYCBP2 ubiquitinates NSP12 after NSP12 translation in the cytoplasm but before NSP12 is recruited to DMVs. Future studies using high-resolution microscopy and sub-cellular fractionation would improve our understanding of when NSP12 ubiquitination occurs during the viral life cycle and what function this serves for the host and virus.
Ubiquitin regulation of viral RdRp activity has been reported for other viruses. The polymerase subunits of IAV are ubiquitinated by K48, K63, and K29 linkages, and this regulates dynamic structural changes, viral RNA and NP binding, and polymerase dimerization, all of which promote viral replication and gene expression (34–36). Our results demonstrated that the ubiquitination of SARS-CoV-2 NSP12 does not serve a primarily degradative function. Similarly, the polymerase of Senecavirus A is ubiquitinated, and this stabilizes and prevents its proteasomal degradation (51). Knockout of the host E3 ligase responsible for polymerase ubiquitination reduces Senecavirus A viral titers, similar to what we observed with MYCBP2 silencing with SARS-CoV-2 infection.
Although our study establishes a role for MYCBP2-mediated ubiquitination of NSP12 in regulating coronavirus replication, several important questions remain. The molecular consequences of S564 ubiquitination on NSP12 activity have not yet been defined and should be addressed through future analyses of RNA binding, polymerase function, protein conformation, and replicase complex assembly. In addition, our observations suggest that differential NSP12 ubiquitination may contribute to phenotypic differences among coronaviruses and SARS-CoV-2 variants. Determining whether variation in NSP12 ubiquitination influences viral fitness, replication dynamics, or pathogenicity represents an important direction for future studies.
MATERIALS AND METHODS
Cell culture
All cells were maintained in Dulbecco’s modified Eagle medium (DMEM) (Gibco) supplemented with 10% fetal bovine serum (FBS) at 37°C, 5% CO2. Viral infections were performed in DMEM supplemented with 2% FBS.
Plasmids
Coronavirus NSP12 sequences were obtained from GenBank, synthesized by Twist Biosciences, and cloned into a pCMV vector with either an N-terminal HA tag or a C-terminal 3×FLAG tag. The MYCBP2 plasmid was obtained from Dr. C. James Hastie of the MRC PPU at the University of Dundee.
Transfections and immunoprecipitations
HEK293T cells were transfected with Lipofectamine 2000 (Thermo Fisher) for 24 h. Cells were lysed in a lysis buffer containing 0.5% NP40. Cleared lysates were incubated with EZview Red anti-HA or FLAG beads (Millipore; see Table 2), or primary antibody, for 2–24 h at 4°C with end-over-end rotation. After incubation with primary antibody, lysates were incubated with protein A/G agarose beads for 2 h. Beads were washed with lysis buffer, except for MYCBP2 experiments, for which a 0.05% NP40 buffer was used, and resuspended in 2× Laemmli buffer (BioRad).
Western blotting
MYCBP2 samples were run on NuPAGE tris-acetate mini protein gels, 3%–8% gradient, using NuPAGE running buffer (Thermo Fisher). Proteins were transferred to polyvinylidene difluoride (PVDF) membranes using 20 V for 16 h using NuPAGE transfer buffer. For all other experiments, tris-glycine Mini-PROTEAN gels (BioRad) were used, and transfers were performed using the BioRad Trans-Blot Turbo transfer system. Membranes were blocked with TBST containing 5% bovine serum albumin (BSA) for 1 h at room temperature, incubated with primary antibodies overnight at 4°C (see Table 1 for antibodies and dilutions). After 3× washes, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature, developed with SuperSignal West HRP (Thermo Fisher) substrate, and imaged using a Chemidoc MP. Molecular weight markers were carefully verified for each blot.
TABLE 1.
Key resource table—antibodies
| Antibody | Source | Cat no. | Dilution |
|---|---|---|---|
| Rabbit mAb anti-ubiquitin | Cell Signaling | 43124 | 1:1,000 |
| Rabbit pAb anti-UBE2D1/2/3 | Proteintech | 11677-1-AP | 1:500 |
| Goat anti-rat IgG HRP | Jackson Immunoresearch | 112-035-167 | 1:1,000 |
| Goat anti-rabbit IgG HRP | Jackson Immunoresearch | 111-035-144 | 1:5,000 |
| Goat anti-mouse IgG HRP | Jackson Immunoresearch | 115-035-146 | 1:5,000 |
| Rabbit mAb anti-K63 polyubiquitin | Cell Signaling | 5621 | 1:500 |
| Rabbit mAb anti-K48 polyubiquitin | Cell Signaling | 8081 | 1:500 |
| Rabbit pAb anti-MYCBP2 | Abcam | ab86078 | 1:1,000 |
| Rat mAb anti-GRP94 | Enzo | ADI-SPA-850-D | 1:1,000 |
| Rabbit pAb anti-NSP12 | GeneTex | GTX135467 | 1:1,000 (WB); 1:50 (IP) |
| Normal rabbit IgG | Cell Signaling | 2729 | 1:50 (IP) |
| Rabbit pAb anti-HA | Millipore Sigma | Sigma Aldrich | 1:1,000 |
| Rabbit pAb anti-FLAG | Millipore Sigma | F7425 | 1:1,000 |
| Mouse mAb anti-beta actin | Proteintech | 66009-1-Ig | 1:5,000 |
Viral protein ubiquitination screen
A SARS-CoV-2 plasmid expression library was kindly obtained from Dr. Adolfo Garcia-Sastre (Mt. Sinai). HEK293T cells were transfected with each individual HA-tagged protein as described above, and immunoprecipitations were performed using anti-HA beads as described. Lysates and pull-downs were subjected to western blotting as described above and probed with an anti-HA or anti-Ub antibody to identify ubiquitinated proteins.
Sequential immunoprecipitation
Total FLAG-NSP12 was immunoprecipitated from HEK293T cells as described in “Transfections and immunoprecipitations.” The beads were pelleted by centrifugation, then incubated with 1% SDS containing 5 mM dithiothreitol (DTT) at 100°C for 5 min. The DTT was inactivated with 1% Triton X-100 in 0.15 M NaCl, 25 mM Tris, pH 7.4. Beads were pelleted, and the supernatant was removed, transferred to a new tube containing the anti-HA beads, and the mixture was incubated for 60 min at 4°C with end-over-end rotation. After three washes in 0.1% Triton X-100 in TBS, the samples were heated in 2× Laemmli buffer and analyzed by western blotting.
Multiple sequence alignment and phylogenetic tree
Coronavirus NSP12 sequences (AMO03400; AFR58671.1; ACJ12832.1; ATG21344.1; QHU79203.1; AAT8435.1) were downloaded from GenBank. A multiple sequence was generated using Clustal Omega version 1.2.4. The alignment was used to construct a neighbor-joining tree in MegaX using the following parameters: 100 bootstraps, Poisson distribution, and gamma distance rate of 1.
Mass spectrometry
VeroE6 cells were infected with SARS-CoV-2 WA1 strain at MOI = 5 for 24 h. Cell lysates were immunoprecipitated with an anti-NSP12 antibody (GeneTex). Lysates were subjected to SDS-PAGE, stained with colloidal Coomassie, and bands were excised and sent to the Whitehead Institute at MIT for analysis. Data were analyzed in PEAKS DB.
Plaque assays
Plaque assays were performed on VeroE6 cells using an overlay medium containing DMEM, 2% FBS, 0.6% Avicel (see Table 2). Plaques were read using crystal violet staining after 48 h post-infection and titers calculated accordingly.
TABLE 2.
Key resource table—reagents
| Reagent | Source | Cat no. |
|---|---|---|
| Ezview Red Anti-HA Affinity Gel | Millipore Sigma | E6779 |
| Lipofectamine 2000 | Thermo Fisher | 11668019 |
| Lipofectamine 3000 | Thermo Fisher | L300008 |
| Lipofectamine RNAiMAX | Thermo Fisher | 13778075 |
| Ube2D3 Silencer Select siRNA assay | Thermo Fisher | s14579 |
| MYCBP2 Silencer Select siRNA assay | Thermo Fisher | s22982 |
| Silencer Select Negative Control siRNA | Thermo Fisher | 4390843 |
| Protease Inhibitor Cocktail complete EDTA-free | Roche | 11873580001 |
| 4× Laemmli sample buffer | BioRad | 1610747 |
| TBS-T 10× | Apex Bioresearch | 18-235B |
| 5× Trans-Blot Turbo Transfer Buffer | BioRad | 10026938 |
| ImProm-II Reverse Transcriptase | Promega | A3801 |
| MgCl2 25 mM | Promega | A3511 |
| AmpliTaq Gold DNA polymerase | Thermo Fisher | 4311806 |
| Random hexamer primer mix | Roche | 11034731001 |
| DMEM powder high glucose | Gibco | 12100046 |
| Avicel RC-581 | Dupont | RC581-NFDR080I |
siRNA gene knockdown
siRNA and siRNA controls were ordered from ThermoFisher. Knockdowns were performed for 2 days using Lipofectamine RNAiMAX (Thermo Fisher Scientific) following the manufacturer’s instructions. See Table 2 for details on siRNA used.
Quantitative reverse transcription polymerase chain reaction
Cells in 24-well plates were lysed in 200 µL Trizol at 0, 6, 12, 24, and 48 h post-infection. Four replicates were collected for each time point. Total RNA was extracted using the Direct-zol-96 RNA kit from Zymo Research. Five microliters of RNA (≤200 ng/µL) was incubated with random hexamer primers for 5 min at 70°C, then cDNA was synthesized using ImProm-II reverse transcriptase (Promega). To measure SARS-CoV-2 replication, quantitative real-time PCR was performed on 2 µL of cDNA product using AmpliTaq Gold DNA polymerase (Thermo Fisher) for 40 cycles with primers and probes specific for SARS-CoV-2 N: forward primer, 5′ GACCCCAAAATCAGCGAAAT-3′; reverse primer, 5′ TCTGGTTACTGCCAGTTGAATCTG 3′; probe, 5′ 6FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′. RQ (2−ΔΔCt) values were calculated for each sample by normalizing to beta actin using specific primers and probes: forward primer, 5′ GGATCAGCAAGCAGGAGTAT 3′; reverse primer, 5′ AGAAAGGGTGTAACGCAACTAA 3′; probe, 5′ 6FAM-TCGTCCACC-ZEN-GCAAATGCTTCTAGG-IABkFQ 3′. The following samples had no detectable beta-actin amplification and were excluded from analysis: siCtrl 24 h, siUBE2D3 12 h and 48 h, siUBE2D3 + MYCBP2 24 h and 48 h. Data were plotted in GraphPad Prism and statistical significance was determined by ANOVA and Dunnett’s multiple comparisons test. See Table 3 for list of primers and Table 2 for details of enzymes used.
TABLE 3.
Key resource table—primers
| Primer target | Sequence 5' → 3' |
|---|---|
| SARS-CoV-2 N forward | GACCCCAAAATCAGCGAAAT |
| SARS-CoV-2 N reverse | TCTGGTTACTGCCAGTTGAATCTG |
| SARS-CoV-2 N probe | 6FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 |
| Human beta actin forward | GGATCAGCAAGCAGGAGTAT |
| Human beta actin reverse | AGAAAGGGTGTAACGCAACTAA |
| Human beta actin probe | 6FAM-TCGTCCACC-ZEN-GCAAATGCTTCTAGG-IABkFQ |
Structural mapping of residues
The RdRp complex consisting of NSP12, NSP7, and 2×NSP8 was downloaded from the Protein Database (PDB ID 9pyw), and UCSF ChimeraX (1.12rc202605220400 [22 May 2026]) was used to visualize and map residues of interest.
Contributor Information
Maudry Laurent-Rolle, Email: maudry.laurent-rolle@yale.edu.
Andrew Pekosz, Johns Hopkins University Bloomberg School of Public Health, Baltimore, Maryland, USA.
SUPPLEMENTAL MATERIAL
The following material is available online at https://doi.org/10.1128/msphere.00373-26.
Fig. S1 to S3.
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.
REFERENCES
- 1. Maelfait J, Beyaert R. 2012. Emerging role of ubiquitination in antiviral RIG-I signaling. Microbiol Mol Biol Rev 76:33–45. doi: 10.1128/MMBR.05012-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Diamond MS, Kanneganti TD. 2022. Innate immunity: the first line of defense against SARS-CoV-2. Nat Immunol 23:165–176. doi: 10.1038/s41590-021-01091-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Chan YK, Gack MU. 2015. RIG-I-like receptor regulation in virus infection and immunity. Curr Opin Virol 12:7–14. doi: 10.1016/j.coviro.2015.01.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Kanayama A, Seth RB, Sun L, Ea C-K, Hong M, Shaito A, Chiu Y-H, Deng L, Chen ZJ. 2004. TAB2 and TAB3 activate the NF-κB pathway through binding to polyubiquitin chains. Mol Cell 15:535–548. doi: 10.1016/j.molcel.2004.08.008 [DOI] [PubMed] [Google Scholar]
- 5. Ohtake F, Saeki Y, Ishido S, Kanno J, Tanaka K. 2016. The K48-K63 branched ubiquitin chain regulates NF-κB signaling. Mol Cell 64:251–266. doi: 10.1016/j.molcel.2016.09.014 [DOI] [PubMed] [Google Scholar]
- 6. Rajsbaum R, García-Sastre A, Versteeg GA. 2014. TRIMmunity: the roles of the TRIM E3-ubiquitin ligase family in innate antiviral immunity. J Mol Biol 426:1265–1284. doi: 10.1016/j.jmb.2013.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Boytz R, Laurent-Rolle M. 2024. Balancing acts: the posttranslational modification tightrope of flavivirus replication. PLoS Pathog 20:e1012626. doi: 10.1371/journal.ppat.1012626 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Giraldo MI, Xia H, Aguilera-Aguirre L, Hage A, van Tol S, Shan C, Xie X, Sturdevant GL, Robertson SJ, McNally KL, Meade-White K, Azar SR, Rossi SL, Maury W, Woodson M, Ramage H, Johnson JR, Krogan NJ, Morais MC, Best SM, Shi P-Y, Rajsbaum R. 2020. Envelope protein ubiquitination drives entry and pathogenesis of Zika virus. Nature 585:414–419. doi: 10.1038/s41586-020-2457-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Chamontin C, Bossis G, Nisole S, Arhel NJ, Maarifi G. 2021. Regulation of viral restriction by post-translational modifications. Viruses 13:2197. doi: 10.3390/v13112197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. El Motiam A, Vidal S, Seoane R, Bouzaher YH, González-Santamaría J, Rivas C. 2020. SUMO and cytoplasmic RNA viruses: from enemies to best friends. Adv Exp Med Biol 1233:263–277. doi: 10.1007/978-3-030-38266-7_11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Dawson AR, Mehle A. 2018. Flu’s cues: exploiting host post-translational modifications to direct the influenza virus replication cycle. PLoS Pathog 14:e1007205. doi: 10.1371/journal.ppat.1007205 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Oswald J, Constantine M, Adegbuyi A, Omorogbe E, Dellomo AJ, Ehrlich ES. 2023. E3 ubiquitin ligases in gammaherpesviruses and HIV: a review of virus adaptation and exploitation. Viruses 15:1935. doi: 10.3390/v15091935 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Stukalov A, Girault V, Grass V, Karayel O, Bergant V, Urban C, Haas DA, Huang Y, Oubraham L, Wang A, et al. 2021. Multilevel proteomics reveals host perturbations by SARS-CoV-2 and SARS-CoV. Nature 594:246–252. doi: 10.1038/s41586-021-03493-4 [DOI] [PubMed] [Google Scholar]
- 14. Zhang H, Zheng H, Zhu J, Dong Q, Wang J, Fan H, Chen Y, Zhang X, Han X, Li Q, Lu J, Tong Y, Chen Z. 2021. Ubiquitin-modified proteome of SARS-CoV-2-infected host cells reveals insights into virus–host interaction and pathogenesis. J Proteome Res 20:2224–2239. doi: 10.1021/acs.jproteome.0c00758 [DOI] [PubMed] [Google Scholar]
- 15. Fan L, Zhou Y, Wei X, Feng W, Guo H, Li Y, Gao X, Zhou J, Wen Y, Wu Y, Shen X, Liu L, Xu G, Zhang Z. 2024. The E3 ligase TRIM22 restricts SARS-CoV-2 replication by promoting proteasomal degradation of NSP8. mBio 15:e02320-23. doi: 10.1128/mbio.02320-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Lear TB, Boudreau ÁN, Lockwood KC, Chu E, Camarco DP, Cao Q, Nguyen M, Evankovich JW, Finkel T, Liu Y, Chen BB. 2023. E3 ubiquitin ligase ZBTB25 suppresses beta coronavirus infection through ubiquitination of the main viral protease MPro. J Biol Chem 299:105388. doi: 10.1016/j.jbc.2023.105388 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Guo G, Gao M, Gao X, Zhu B, Huang J, Luo K, Zhang Y, Sun J, Deng M, Lou Z. 2021. SARS-CoV-2 non-structural protein 13 (nsp13) hijacks host deubiquitinase USP13 and counteracts host antiviral immune response. Signal Transduct Target Ther 6:119. doi: 10.1038/s41392-021-00509-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Hua F, Hao W, Wang L, Song K, Hasan A, Wu Y, Li K, Lin Z, Sun Y, Li S. 2024. Linear ubiquitination mediates coronavirus NSP14-induced NF-κB activation. Cell Commun Signal 22:573. doi: 10.1186/s12964-024-01949-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Li Z, Hao P, Zhao Z, Gao W, Huan C, Li L, Chen X, Wang H, Jin N, Luo Z-Q, Li C, Zhang W. 2023. The E3 ligase RNF5 restricts SARS-CoV-2 replication by targeting its envelope protein for degradation. Sig Transduct Target Ther 8:1. doi: 10.1038/s41392-023-01335-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Mao S, Cai X, Niu S, Wei J, Jiang N, Deng H, Wang W, Zhang J, Shen S, Ma Y, Wu X, Peng Q, Huang A, Wang D. 2023. TRIM21 promotes ubiquitination of SARS-CoV-2 nucleocapsid protein to regulate innate immunity. J Med Virol 95:e28719. doi: 10.1002/jmv.28719 [DOI] [PubMed] [Google Scholar]
- 21. Nishitsuji H, Iwahori S, Ohmori M, Shimotohno K, Murata T. 2022. Ubiquitination of SARS-CoV-2 NSP6 and ORF7a facilitates NF-κB activation. mBio 13:e00971-22. doi: 10.1128/mbio.00971-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Ren J, Wang S, Zong Z, Pan T, Liu S, Mao W, Huang H, Yan X, Yang B, He X, Zhou F, Zhang L. 2024. TRIM28-mediated nucleocapsid protein SUMOylation enhances SARS-CoV-2 virulence. Nat Commun 15:244. doi: 10.1038/s41467-023-44502-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Yuan Z, Hu B, Xiao H, Tan X, Li Y, Tang K, Zhang Y, Cai K, Ding B. 2022. The E3 ubiquitin ligase RNF5 facilitates SARS-CoV-2 membrane protein-mediated virion release. mBio 13:e03168-21. doi: 10.1128/mbio.03168-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Zhou J, Zhou Y, Wei X, Fan L, Gao X, Li Y, Wu Y, Feng W, Shen X, Liu L, Xu G, Zhang Z. 2024. TRIM6 facilitates SARS‐CoV‐2 proliferation by catalyzing the K29‐typed ubiquitination of NP to enhance the ability to bind viral genomes. J Med Virol 96:e29531. doi: 10.1002/jmv.29531 [DOI] [PubMed] [Google Scholar]
- 25. Zhou L, Liu R, Pathak H, Wang X, Jeong GH, Kumari P, Kumar M, Yin J. 2024. Ubiquitin ligase parkin regulates the stability of SARS-CoV-2 main protease and suppresses viral replication. ACS Infect Dis 10:879–889. doi: 10.1021/acsinfecdis.3c00418 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Zhou Y, Feng W, Yang C, Wei X, Fan L, Wu Y, Gao X, Shen X, Zhang Z, Zhao J. 2024. E3 ubiquitin ligase FBXO22 inhibits SARS-CoV-2 replication via promoting proteasome-dependent degradation of NSP5. J Med Virol 96:e29891. doi: 10.1002/jmv.29891 [DOI] [PubMed] [Google Scholar]
- 27. Zhu J, Liu G, Sayyad Z, Goins CM, Stauffer SR, Gack MU. 2024. ISGylation of the SARS-CoV-2 N protein by HERC5 impedes N oligomerization and thereby viral RNA synthesis. J Virol 98:e00869-24. doi: 10.1128/jvi.00869-24 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Zhao M, Zhang M, Yang Z, Zhou Z, Huang J, Zhao B. 2023. Role of E3 ubiquitin ligases and deubiquitinating enzymes in SARS-CoV-2 infection. Front Cell Infect Microbiol 13. doi: 10.3389/fcimb.2023.1217383 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Pellman J, Goldstein A, Słabicki M. 2024. Human E3 ubiquitin ligases: accelerators and brakes for SARS-CoV-2 infection. Biochem Soc Trans 52:2009–2021. doi: 10.1042/BST20230324 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Cao Z, Xia H, Rajsbaum R, Xia X, Wang H, Shi PY. 2021. Ubiquitination of SARS-CoV-2 ORF7a promotes antagonism of interferon response. Cell Mol Immunol 18:746–748. doi: 10.1038/s41423-020-00603-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Liu Z, Fu Y, Huang Y, Zeng F, Rao J, Xiao X, Sun X, Jin H, Li J, Yang J, Du W, Liu L. 2022. Ubiquitination of SARS-CoV-2 ORF7a prevents cell death induced by recruiting BclXL to activate ER stress. Microbiol Spectr 10:e01509-22. doi: 10.1128/spectrum.01509-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Yu M, Li J, Gao W, Li Z, Zhang W. 2024. Multiple E3 ligases act as antiviral factors against SARS-CoV-2 via inducing the ubiquitination and degradation of ORF9b. J Virol 98:e01624-23. doi: 10.1128/jvi.01624-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Zhang L, Hao P, Chen X, Lv S, Gao W, Li C, Li Z, Zhang W. 2024. CRL4B E3 ligase recruited by PRPF19 inhibits SARS-CoV-2 infection by targeting ORF6 for ubiquitin-dependent degradation. mBio 15:e03071-23. doi: 10.1128/mbio.03071-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Kirui J, Mondal A, Mehle A. 2016. Ubiquitination upregulates influenza virus polymerase function. J Virol 90:10906–10914. doi: 10.1128/JVI.01829-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Karim M, Biquand E, Declercq M, Jacob Y, van der Werf S, Demeret C. 2020. Nonproteolytic K29-linked ubiquitination of the PB2 replication protein of influenza A viruses by proviral cullin 4-based E3 ligases. mBio 11:e00305-20. doi: 10.1128/mBio.00305-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Günl F, Krischuns T, Schreiber JA, Henschel L, Wahrenburg M, Drexler HCA, Leidel SA, Cojocaru V, Seebohm G, Mellmann A, Schwemmle M, Ludwig S, Brunotte L. 2023. The ubiquitination landscape of the influenza A virus polymerase. Nat Commun 14:787. doi: 10.1038/s41467-023-36389-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Tian L, Zhao Z, Gao W, Liu Z, Li X, Zhang W, Li Z. 2025. SARS-CoV-2 nsp16 is regulated by host E3 ubiquitin ligases, UBR5 and MARCHF7. eLife 13:RP102277. doi: 10.7554/eLife.102277 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Gordon DE, Jang GM, Bouhaddou M, Xu J, Obernier K, White KM, O’Meara MJ, Rezelj VV, Guo JZ, Swaney DL, et al. 2020. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature 583:459–468. doi: 10.1038/s41586-020-2286-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Mabbitt PD, Loreto A, Déry M-A, Fletcher AJ, Stanley M, Pao K-C, Wood NT, Coleman MP, Virdee S. 2020. Structural basis for RING-Cys-relay E3 ligase activity and its role in axon integrity. Nat Chem Biol 16:1227–1236. doi: 10.1038/s41589-020-0598-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Pao K-C, Wood NT, Knebel A, Rafie K, Stanley M, Mabbitt PD, Sundaramoorthy R, Hofmann K, van Aalten DMF, Virdee S. 2018. Activity-based E3 ligase profiling uncovers an E3 ligase with esterification activity. Nature 556:381–385. doi: 10.1038/s41586-018-0026-1 [DOI] [PubMed] [Google Scholar]
- 41. Gottwein E, Jäger S, Habermann A, Kräusslich HG. 2006. Cumulative mutations of ubiquitin acceptor sites in human immunodeficiency virus type 1 gag cause a late budding defect. J Virol 80:6267–6275. doi: 10.1128/JVI.02177-05 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Gonzalez-Orozco M, Tseng H-C, Hage A, Xia H, Behera P, Afreen K, Peñaflor-Tellez Y, Giraldo MI, Huante M, Puebla-Clark L, et al. 2024. TRIM7 ubiquitinates SARS-CoV-2 membrane protein to limit apoptosis and viral replication. Nat Commun 15:10438. doi: 10.1038/s41467-024-54762-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Xie X, Lokugamage KG, Zhang X, Vu MN, Muruato AE, Menachery VD, Shi P-Y. 2021. Engineering SARS-CoV-2 using a reverse genetic system. Nat Protoc 16:1761–1784. doi: 10.1038/s41596-021-00491-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Maimaitiyiming Y, Yang T, Wang QQ, Feng Y, Chen Z, Björklund M, Wang F, Hu C, Hsu C-H, Naranmandura H. 2022. Heat treatment promotes ubiquitin-mediated proteolysis of SARS-CoV-2 RNA polymerase and decreases viral load. Research (Washington, DC) 2022:9802969. doi: 10.34133/2022/9802969 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Yang T, Zhu CY, Yu PH, Yang C, Naranmandura H. 2025. Arsenic trioxide could promote SARS-CoV-2 NSP12 protein degradation. J Gen Virol 106:002121. doi: 10.1099/jgv.0.002121 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Cortese M, Lee J-Y, Cerikan B, Neufeldt CJ, Oorschot VMJ, Köhrer S, Hennies J, Schieber NL, Ronchi P, Mizzon G, et al. 2020. Integrative imaging reveals SARS-CoV-2-induced reshaping of subcellular morphologies. Cell Host Microbe 28:853–866. doi: 10.1016/j.chom.2020.11.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Andronov L, Han M, Zhu Y, Balaji A, Roy AR, Barentine AES, Patel P, Garhyan J, Qi LS, Moerner WE. 2024. Nanoscale cellular organization of viral RNA and proteins in SARS-CoV-2 replication organelles. Nat Commun 15:4644. doi: 10.1038/s41467-024-48991-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Snijder EJ, Limpens RWAL, de Wilde AH, de Jong AWM, Zevenhoven-Dobbe JC, Maier HJ, Faas FFGA, Koster AJ, Bárcena M. 2020. A unifying structural and functional model of the coronavirus replication organelle: tracking down RNA synthesis. PLoS Biol 18:e3000715. doi: 10.1371/journal.pbio.3000715 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Dörr A, Pierre S, Zhang DD, Henke M, Holland S, Scholich K. 2015. MYCBP2 is a guanosine exchange factor for ran protein and determines its localization in neurons of dorsal root ganglia. J Biol Chem 290:25620–25635. doi: 10.1074/jbc.M115.646901 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Holland S, Coste O, Zhang DD, Pierre SC, Geisslinger G, Scholich K. 2011. The ubiquitin ligase MYCBP2 regulates transient receptor potential vanilloid receptor 1 (TRPV1) internalization through inhibition of p38 MAPK signaling. J Biol Chem 286:3671–3680. doi: 10.1074/jbc.M110.154765 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Li L, Bai J, Fan H, Yan J, Li S, Jiang P. 2020. E2 ubiquitin-conjugating enzyme UBE2L6 promotes Senecavirus A proliferation by stabilizing the viral RNA polymerase. PLoS Pathog 16:e1008970. doi: 10.1371/journal.ppat.1008970 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1 to S3.