Combined effects of urine exposure and cryopreservation on sperm quality: an in vitro study of retrograde ejaculation

Abstract

Sperm quality influences fertility and offspring health through both genomic inheritance and epigenetic inheritance. Thus, for use in clinical-assisted reproductive technology (ART), spermatozoa must have optimal genomic and epigenetic structures. In patients with retrograde ejaculation, spermatozoa are usually recovered from urine and then cryopreserved for ART. However, the effects of urine exposure and subsequent freeze–thaw cycles on sperm quality remain unclear. This is particularly true for epigenetic changes and their underlying mechanisms. In this study, we examined how different durations of urine exposure (10 min and 40 min) followed by freeze–thaw cycles affected sperm motility, DNA integrity, and methylation levels of imprinting genes (H19-imprinted maternally expressed transcript [H19], mesoderm-specific transcript [MEST], and the transposable element Alu [Alu]). As the duration of urine exposure increased, sperm motility (median [interquartile range]) decreased from 48.0% (39.0%−52.5%) to 1.0% (1.0%−5.0%), the DNA fragmentation index (DFI; median [interquartile range]) increased from 12.0% (9.3%−19.9%) to 23.5% (13.9%−33.9%), the MEST methylation level (mean ± standard deviation [s.d.]) increased from 3.8% ± 1.5% to 11.5 ± 1.2%, and the H19 methylation level (mean ± s.d.) decreased from 86.9% ± 0.9% to 82.1% ± 0.5%. The freeze–thaw process further reduced sperm motility, while the DFI and methylation levels of MEST and H19 did not significantly change. The Alu methylation level remained stable. These findings demonstrate that urine exposure affects sperm motility, DNA integrity, and methylation levels of some imprinting genes. These effects intensify over time. In contrast, the freeze–thaw process impacts only sperm motility. In clinical practice, minimizing exposure to urine might improve sperm quality.

INTRODUCTION

Retrograde ejaculation, which affects approximately 2% of infertile men, is one of several causes of male infertility.1,2 In patients with this condition, seminal fluid flows backward into the bladder during ejaculation rather than exiting through the urethral opening.3 Spermatozoa can be collected from the patient’s urine for use in assisted reproductive technology (ART) but may have been exposed to factors such as high osmolality, low pH, and excreted metabolites.3,4,5,6,7,8 Consequently, spermatozoa that have been collected from urine need to be treated, such as by urinary alkalization and osmolar adjustment, before being suitable for ART procedures.3,9 The timing of sperm retrieval can be challenging, as it must coincide with oocyte collection from the patient’s partner.3,10 Cryopreservation permits sperm storage. However, the combined effects of urine exposure and freezing may impair sperm function more than each factor alone. This can affect fertilization rates, embryonic development, and embryo quality.11

In clinical practice, sperm concentration, motility, and DNA integrity (measured by the DNA fragmentation index [DFI]) are used to evaluate sperm quality and fertility potential.12,13 Recent studies have shown that epigenetic sperm modifications, especially DNA methylation, influence pregnancy outcomes and offspring health.14,15,16 During spermatogenesis, primordial germ cells (PGCs) undergo the first wave of global genetic reprogramming, erasing all DNA methylation marks and establishing paternal-specific epigenetic signatures through imprinting marks at specific DNA sites.17 After fertilization, a second wave of epigenetic reprogramming occurs in which the zygote erases DNA methylation markers to begin embryonic development, while the paternal genomic imprinting marks are protected from demethylation.18 These imprinting marks are crucial for growth, metabolism, and development, including embryonic growth and postnatal development.17 Changes in the imprinting of fertility-related genes, including H19-imprinted maternally expressed transcript (H19), mesoderm-specific transcript (MEST), and the transposable element Alu (Alu), can lead to poor embryo development and adverse pregnancy outcomes.19,20,21,22 MEST, expressed mainly by the paternal allele, is involved in embryo survival, and increased MEST methylation in spermatozoa is correlated with infertility.19,23 H19, which encodes a long noncoding RNA on the maternal allele, influences fetal development, and reduced H19 methylation in spermatozoa is associated with male infertility.19,24,25,26,27 Lower methylation of the repetitive element Alu in spermatozoa may cause adverse pregnancy outcomes and infertility.20,21,28,29 Thus, maintaining the methylation levels of imprinting sperm genes is crucial for both fertilization and embryonic development.

Since urine exposure, sperm freezing, and ART manipulation occur alongside epigenetic reprogramming, these stressors may affect genomic imprinting, impacting conception, embryo development, and offspring health. However, little is known about how urine exposure and cryopreservation affect sperm function in patients with retrograde ejaculation. In this study, we investigated how different durations of urine exposure, followed by freeze–thaw cycles, affect sperm motility, DNA integrity, and methylation levels of certain imprinting genes (H19, MEST, and Alu).

MATERIALS AND METHODS

Ethics statement and sample preparation

This study was approved by the Ethics Committee of Guangdong Provincial Reproductive Science Institute, Guangdong Provincial Fertility Hospital (Guangzhou, China; Approval No. [2023] 27). The requirement for informed consent was waived by the committee, because the data used in the present study were collected from previously routine clinical procedures and were anonymous to investigators of this study.

We collected 27 semen samples from sperm donors at the Human Sperm Bank of Guangdong Province (Guangzhou, China), between March and September in 2023. Before sperm donation, each volunteer abstained from sexual activity for 2–7 days. The ejaculates were collected by masturbation into sterile disposable wide-mouth collectors and placed in an incubator at 37°C for liquefaction. Fresh urine samples were collected from healthy adult males approximately 30 min before the in vitro urine-semen model (IVUSM) was established. The IVUSM was established by combining fresh semen and urine at a 1:20 ratio (v/v).

Experimental design

The experimental workflow is illustrated in Figure 1. Each semen sample was divided into three groups: untreated control group, urine exposure group (UE), and freezing-after-urine-exposure group (FUE). Considering that sperm retrieval typically takes 10−30 min and never exceeds 40 min, we selected two exposure time points: 10 min and 40 min. Urine-exposed sperm samples were collected by centrifugation at 400g (Eppendorf Centrifuge 5425; EPPENDORF, Hamburg, Germany) for 10 min and then washed with Dulbecco’s modified Eagle’s medium (DMEM; Cat. #11965092; Thermo Fisher Scientific, Waltham, MA, USA), which contained 30 g l⁻¹ bovine serum albumin (BSA; Cat. #B824162; Macklin Biochemical, Shanghai, China), before being frozen according to their group assignment. We assessed the sperm parameters, DFI, and methylation levels of imprinted genes in all three groups.

Figure 1.

Schematic diagram of the experimental workflow for investigating sperm parameters, DFI values, and methylation levels of imprinted genes following various durations of urine exposure. DFI: DNA fragmentation index.

To investigate how urine exposure affects the methylation level of imprinting genes, we analyzed three imprinting genes with varying methylation levels at their differentially methylated regions (DMRs): H19 (for which hypomethylation is correlated with low sperm quality), MEST (for which hypermethylation is correlated with poor sperm parameters), and the repetitive element Alu (whose methylation level is correlated with male infertility).19,20,21,22

Sperm cryopreservation and thawing

The sperm freezing medium (Cat. #10670010F; Origio, Ballerup, Denmark) was added dropwise to the samples of the FUE group in freezing tubes (Greiner Bio-One GmbH, Frickenhausen, Germany) at a 1:3 ratio (v/v), with gentle mixing after each addition. The samples were then placed in liquid nitrogen vapor (2 cm above the liquid) for 10 min before being fully immersed in liquid nitrogen for an additional 10 min. The samples were removed from liquid nitrogen, held at room temperature for 30 s, and then transferred to a 37°C water bath for 6 min to thaw.

Assessment of sperm parameters

All the semen samples were analyzed according to the 5^th edition of the World Health Organization (WHO) laboratory manual.30 We evaluated standard semen characteristics, including pH, volume (ml), sperm concentration (10⁶ ml⁻¹), progressive motility (%), and normal morphology (%). A computer-assisted sperm analysis system (SCA version; Microptics, S.L. Viladomat, Barcelona, Spain) was used to assess the concentration and motility of the sperm.

Sperm DNA fragmentation assay

Sperm DNA fragmentation assay was performed with a sperm chromatin structure assay (SCSA) kit (Celula Medical Technology Co., Ltd., Chengdu, China). After liquefaction, the spermatozoa were stained with acridine orange following the manufacturer’s instructions. Using flow cytometry (Sparrow; Celula Medical Technology Co., Ltd., Chengdu, China), the DFI was calculated within 30 min of staining by analyzing at least 5000 spermatozoa per sample. The DFI represents the percentage of spermatozoa with fragmented DNA from the total spermatozoa. Each sample was independently measured three times, and the mean value was reported as the final result, with a coefficient of variation (CV) of less than 5% between replicates.

Sperm DNA extraction, bisulfite conversion, polymerase chain reaction (PCR), and pyrosequencing

Owing to their highly condensed chromatin, sperm DNA is more difficult to extract than somatic DNA. Briefly, 0.5 ml of semen was centrifuged at 800g (Eppendorf Centrifuge 5425; EPPENDORF) for 5 min at room temperature, and the pellet was subsequently washed with 1 ml of buffer (150 mmol l⁻¹ NaCl and 10 mmol l⁻¹ ethylenediaminetetraacetic acid [EDTA], pH8.0). After centrifugation, the washed sperm pellet was incubated in 0.5 ml of lysis buffer (4.24 mol l⁻¹ guanidine isothiocyanate, 100 mmol l⁻¹ NaCl, 1% Sarkosyl, 150 mmol l⁻¹ 1,4-dithiothreitol [DTT], and 0.2 mg ml⁻¹ proteinase K) at 65°C for 30 min. We added 0.8× volume of isopropanol to the cooled samples, then we mixed the sample gently until the DNA was precipitated. This was transferred with pipette tips to 2 ml of DNA wash buffer (0.1 mol l⁻¹ sodium citrate in 10% ethanol) and inverted occasionally for 10 min, and the procedure was repeated twice. The buffer was carefully removed, and the DNA was washed twice with 1 ml of 70% ethanol. The DNA precipitate was air-dried for 5–10 min. Finally, the DNA was dissolved in nuclease-free water overnight at 4°C.

Before methylation sequencing, the 27 samples in each treatment group were combined into 5 pools by mixing equal amounts of DNA from 5–7 randomly grouped samples. For bisulfite conversion of 500 ng of DNA per sample, an EpiTect Fast DNA Bisulfite Kit (Cat. #59824; Qiagen GmbH, Hilden, Germany) was used according to the manufacturer’s instructions. PCR and pyrosequencing primers were designed with PyroMark Assay Design 2.0 (Qiagen GmbH; Table 1), and pyrosequencing was performed on PyroMark Q96ID (Qiagen GmbH); the data were analyzed with Pyro Q-AQ software (Qiagen GmbH).

Table 1.

List of primers

Primer	Sequence (5’ to 3’)
H19 (183 bp)
Forward	GGATGGTAAGGAATTGGTTGTAGTT
Reverse	ACTCCCATAAATATCCTATTCCC
Sequencing	AGTTAGAGTTAGTTTTAATTGGGG
MEST (77 bp)
Forward	GTGGTTGGAGGTTTTGGGATTA
Reverse	CCAAAAACAACCCCAACT
Sequencing	TGGAGGTTTTGGGATTAGG
Alu (131 bp)
Forward	TTTTTATTAAAAATATAAAAATT
Reverse	CCCAAACTAAAATACAATAA
Sequencing	AATAACTAAAATTACAAAC

All primers were designed to specifically amplify the regions of interest for subsequent methylation analysis. H19: H19-imprinted maternally expressed transcript; MEST: mesoderm-specific transcript; Alu: the transposable element Alu

Statistical analyses

All statistical analyses were performed using IBM SPSS Statistics for Windows, version 25.0 (IBM Corp., Armonk, NY, USA). The Shapiro-Wilk test was used to assess normality, and the data were presented as either the mean ± standard deviation (s.d.) or the median with interquartile range (IQR). Differences between each treatment group and its corresponding control group were evaluated using one-way analysis of variance (ANOVA). P < 0.05 indicated statistical significance.

RESULTS

Urine exposure and progressive sperm motility and DNA integrity

Progressive motility decreased significantly following urine exposure; however, there were no significant differences between the 10-min and 40-min samples (P = 0.550; Table 2 and Figure 2a). The DFI did not significantly increase after 10 min but significantly increased in the 40-min group (P = 0.038). Compared with the 10-min group, the 40-min group had a greater DFI, but the difference was not statistically significant (P = 0.754; Table 2 and Figure 2b).

Table 2.

Progressive motility and DNA fragmentation index values of spermatozoa following various durations of urine exposure and freeze–thaw cycles

Variable	Progressive motility (%)	DFI (%)
Untreated, median (IQR)	48.0 (39.0–52.5)	12.0 (9.3–19.9)
Urine 10 min, median (IQR)	4.0 (2.0–7.5)*	18.9 (11.8–33.2)
Urine 40 min, median (IQR)	1.0 (1.0–5.0)*	23.5 (13.9–33.9)*
Urine 10 min freezed, median (IQR)	1.0 (1.0–4.0)*	27.1 (16.9–43.1)*
Urine 40 min freezed, median (IQR)	0 (0–1.0)*	24.0 (15.6–37.8)*
Statistical parameter	F (4, 130)=211.137, P< 0.05	F (4, 130)=3.857, P< 0.05

^*P<0.05 compared with the untreated group. F value with df in parentheses: F (between-groups df, within-groups df). IQR: interquartile range; DFI: DNA fragmentation index; df: degrees of freedom

Figure 2.

Effects of urine exposure on sperm quality parameters and DNA methylation levels. (a) Progressive motility and (b) sperm DNA fragmentation under three experimental conditions: without urine exposure, and with urine exposure for 10 min and 40 min. Data in a and b are presented as median (IQR). ^*P < 0.05 indicates statistical significance. Changes in methylation levels of CpG sites under various experimental conditions: (c) H19 gene, (d) MEST gene, and (e) Alu repetitive element. (f) Methylation levels of H19, MEST, and Alu under different experimental conditions. Data in c–f are presented as mean ± s.d. CpG: cytosine-phosphate-guanine dinucleotide; H19: H19-imprinted maternally expressed transcript; MEST: mesoderm-specific transcript; Alu: the transposable element Alu; IQR: interquartile range; s.d.: standard deviation.

Urine exposure and methylation levels of imprinting genes – H19, MEST, and Alu

Eight cytosine-phosphate-guanine dinucleotide (CpGs) of H19, 5 CpGs of MEST, and 3 CpGs of Alu were detected in all the samples, and the mean methylation levels were calculated. In the untreated samples, the methylation levels after 10 min of urine exposure increased significantly for MEST (P = 0.003) but remained unchanged for H19 (P = 0.312) and Alu (P = 0.533), as shown in Table 3 and Figure 2c–2f. After 40 min of urine exposure, the MEST methylation level further increased (P < 0.001), but the H19 and Alu methylation levels did not significantly change (both P > 0.500), as shown in Table 3 and Figure 2c–2f. An analysis of changes in methylation level (treatment/untreated ratio) revealed that MEST methylation levels increased after 10 min and 40 min of urine exposure (Figure 3).

Table 3.

Methylation levels of CpG sites in H19, MEST, and Alu genes under different experimental conditions

Treatment group	CpG1	CpG2	CpG3	CpG4	CpG5	CpG6	CpG7	CpG8	Average
H19 (n=5)	-	-	-	-	-	-	-	-	-
Untreated	96.7±1.2	100.0±0	83.4±2.1	100.0±0	81.1±4.5	54.1±9.4	88.1±5.1	94.8±7.2	86.9±0.9
Urine 10 min	95.1±1.6	100.0±0	81.2±6.1	100.0±0	79.5±3.6	48.2±3.9	83.0±5.7	91.7±7.6	85.0±0.5
Urine 40 min	95.7±2.9	100.0±0	80.8±2.6	99.7±0.6	76.7±4.7	47.0±4.8	81.4±6.8	74.9±11.2	82.1±0.5
Urine 10 min freezed	95.5±3.7	100.0±0	80.7±5.7	100.0±0	74.9±6.8	47.0±2.5	82.3±7.1	88.7±6.4	83.8±0.7
Urine 40 min freezed	88.4±5.8	100.0±0.1	73.5±2.0	98.9±2.5	72.0±4.1	42.0±4.3	78.6±4.2	78.8±3.5	79.0±1.7
MEST (n=5)	-	-	-	-	-	-	-	-	-
Untreated	0±0	3.7±3.5	0±0	13.3±5.2	1.9±4.2	-	-	-	3.8±1.5
Urine 10 min	5.9±3.5	6.1±3.5	0±0	19.2±3.6	5.9±5.4	-	-	-	7.4±1.2*
Urine 40 min	6.5±3.8	9.0±1.1	8.2±0.8	23.7±3	10.0±5.9	-	-	-	11.5±1.2*
Urine 10 min freezed	6.0±3.7	7.5±2.0	2.3±3.2	19.2±5.6	11.1±7.9	-	-	-	9.2±0.4*
Urine 40 min freezed	11.0±4.8	10.1±3.4	10.6±2.6	28.7±8.6	14.9±9.3	-	-	-	15.1±3.1*
Alu (n=5)	-	-	-	-	-	-	-	-	-
Untreated	31.2±1.1	14.1±2.9	11.5±0.9	-	-	-	-	-	18.9±1.1
Urine 10 min	32.3±0.4	16.3±0.6	11.4±0.4	-	-	-	-	-	20.0±0.2
Urine 40 min	32.2±0.3	17.9±0.8	12.5±1.5	-	-	-	-	-	20.9±0.3
Urine 10 min freezed	32.1±0.5	16.3±0.3	13.1±0.7	-	-	-	-	-	20.5±0.1
Urine 40 min freezed	32.3±1.0	18.2±0.8	15.2±1.1	-	-	-	-	-	21.9±0.4

^*P<0.05 indicates statistical significance compared with the untreated group. Data are presented as the mean±s.d. -: not available; CpG: cytosine-phosphate-guanine dinucleotide; H19: H19-imprinted maternally expressed transcript; MEST: mesoderm-specific transcript; Alu: the transposable element Alu; s.d.: standard deviation

Figure 3.

Changes in the methylation levels of H19, MEST, and Alu under different experimental conditions. ^*P < 0.05 indicates statistical significance. H19: H19-imprinted maternally expressed transcript; MEST: mesoderm-specific transcript; Alu: the transposable element Alu.

Combined effects of cryopreservation and urine exposure on sperm motility, DNA fragmentation, and methylation levels of imprinting genes

Freezing diminished the forward motility of urine-exposed spermatozoa. Although forward motility was lower in the 40-min group than that in the 10-min group after freezing, the difference was not significant (P = 0.600). However, forward motility was significantly lower after freezing in the 40-min group and before freezing in the 10-min group (P = 0.049; Table 2 and Figure 2a). Both exposure groups had higher DFI values after freezing than before freezing. However, neither the increase in DFI nor the difference between the 10-min and 40-min groups was statistically significant after freezing (P = 0.950 and P = 0.249, respectively; Table 2 and Figure 2b).

The methylation levels of imprinting genes H19, MEST, and Alu in the spermatozoa of the 10-min and 40-min exposure groups after freezing and thawing are shown in Table 3. After freezing and thawing, only MEST methylation levels increased significantly after 10 min (P < 0.001), while H19 and Alu methylation levels remained unchanged (both P > 0.500; Table 3). After 40 min, MEST methylation increased significantly (P < 0.001); in contrast, the decrease in H19 methylation and increase in Alu methylation were not statistically significant (both P > 0.100). An analysis of changes in methylation level revealed that after freezing and thawing, MEST methylation levels increased 2.44-fold and 3.98-fold in the 10-min and 40-min exposure groups, respectively, compared with those in the control group (Figure 3). Compared with pre-freeze levels, methylation increased 1.24-fold and 1.31-fold, respectively, both less than 1.5-fold and not significant (both P > 0.500).

DISCUSSION

While ART has largely addressed fertility issues in retrograde ejaculation patients, the effects of urine exposure on sperm fertility and subsequent embryonic development, particularly epigenetic effects, remain understudied.3,9,10 A key clinical challenge is understanding how the combination of urine exposure and subsequent sperm cryopreservation and thawing affects sperm function and how to minimize any potential sperm damage. Researchers have extensively studied various aspects of the impact of urine on spermatozoa, including damaging factors in urine (metabolites, osmotic pressure, and pH), changes in sperm quality after urine exposure, and treatments to improve damaged sperm quality (urine alkalization and osmotic regulation).8,9 Recent advances in epigenetics have revealed that sperm-carried epigenetic markers (DNA methylation, noncoding RNA, and histone modifications) influence pregnancy outcomes and offspring health.31,32,33,34,35 These markers can be altered by environmental factors, drugs, and diet, affecting both sperm fertility potential and embryonic development.19,22,36 To investigate how this combination affects sperm function and epigenetics, we examined changes in sperm motility, DNA integrity, and imprinted gene methylation levels through in vitro simulation of urine exposure and subsequent freeze–thaw processes. Our findings revealed that just 10 min of urine exposure significantly decreased sperm motility, and 40 min of exposure significantly reduced DNA integrity, confirming the findings of previous research.8 We observed that while prolonged urine exposure did not further reduce pre-freezing forward motility, it significantly decreased post-thaw sperm recovery rates.

At the epigenetic level, we investigated the changes in sperm DNA methylation levels under dual exposure to urine and freeze–thaw cycles, choosing imprinted genes because global reprogramming occurs after fertilization, and zygotes erase methylation markers of genes other than imprinted genes and re-establish their own methylation markers.18,37 The retained methylation markers of imprinted genes are crucial for embryonic development. Global reprogramming occurs simultaneously with urine exposure, sperm freezing, and ART procedures. These stress factors may alter the methylation levels of imprinted genes, thereby affecting pregnancy outcomes. Owing to the large number of imprinted genes (paternal and maternal), we selected representative genes (genes related to pregnancy outcomes) for study, namely, the maternal imprinting MEST, which represents low methylation levels; the paternal imprinting gene H19, which represents high methylation levels; and the reparative element Alu, which represents moderate methylation levels.19,20,21,22 Our results indicated that the methylation levels of genes with high and moderate methylation (≥20.0%) were not significantly altered by urine or cryopreservation, but maternal imprinting genes with low methylation levels (≤4.0%) were strongly affected, and methylation levels increased significantly with prolonged urine exposure, while cryopreservation further increased methylation levels. In the context of assisted reproduction, this study emphasizes the importance of minimizing urine exposure time, especially for retrograde ejaculation patients who require sperm cryopreservation. A shorter urine exposure time may help maintain sperm motility, DNA integrity, and the stability of imprinted gene methylation, increasing the success of ART and improving pregnancy outcomes.13,19,22,36,38,39 These findings provide a new perspective for understanding the effects of urine exposure on sperm function and may provide some support for clinical practice.

Our study has certain limitations that require further investigation in future research. This study was designed as a foundational investigation. We aimed to define the immediate molecular and cellular effects of urine exposure and cryopreservation on sperm quality. These immediate effects are prerequisites for understanding downstream reproductive outcomes. Therefore, we used samples from qualified donors from the same sperm bank, aiming to exclude potential confounding factors such as infertility and establish baseline effects in sperm with normal parameters. However, patients with retrograde ejaculation may have other fertility issues that could interact with urine exposure effects, further worsening sperm parameters and methylation levels. Therefore, in future studies, sperm should be selected from retrograde ejaculation patients across multiple centers, with increased sample sizes. Different patient characteristics, such as age, region, and ethnicity, should be incorporated. Additionally, different clinical treatment methods (urine alkalinization, osmotic pressure regulation with different buffer systems, and various cryoprotectant treatments) should be integrated into the research to assess the generalizability of our findings and to identify vulnerabilities in specific populations. Although our study revealed significant effects on sperm motility, DNA integrity, and methylation patterns, prospective clinical studies are needed in the future to correlate these laboratory findings with ART outcomes, including fertilization rates, embryo quality, implantation rates, and live birth rates in retrograde ejaculation patients. In addition to DNA methylation, epigenetic modifications in spermatozoa include non-coding RNA and histone modifications.31,33,34,35,40,41 Whether these molecules are altered in urine or after cryopreservation and whether they affect pregnancy outcomes are issues for further study. Such research should also assess whether urine and cryopreservation also affect differentially methylated regions other than imprinted genes, where whole-genome methylation sequencing will provide more detailed and accurate information. We are currently conducting a large-sample whole-genome methylation sequencing analysis of urine-exposed sperm to identify more DMRs, as well as sequencing transfer RNA (tRNA)-derived small RNA (tsRNA) to study the effects of urine on sperm-borne tsRNA, and these results will be elaborated upon in our future studies. Moreover, the correlation between sperm exposure to urine and pregnancy outcomes and the molecular mechanisms underlying the effects of urine on sperm epigenetics need to be investigated. Lastly, protective measures and materials that can counteract the damage to spermatozoa caused by urine exposure are also needed.

In conclusion, our findings indicate that urine exposure has negative effects on sperm quality parameters even at 10 min, suggesting that the shortest feasible exposure time should be implemented in clinical practice. Although we did not observe statistically significant differences between 10 min and 40 min for some parameters, the trend of progressive deterioration supports the importance of minimizing exposure duration. Further studies with more time points and larger samples of patients are needed to determine specific clinical thresholds for safe urine exposure duration.

AUTHOR CONTRIBUTIONS

MJL drafted the manuscript, analyzed the data, prepared the figures, and revised the manuscript. YZ designed the overall scheme for the DNA extraction experiment, interpreted the DNA methylation results, and was responsible for the correction and revision of the entire manuscript. QYL extracted the DNA. TP established the sperm–urine exposure model and calculated the sperm DFI. HL provided guidance on retrograde ejaculation. JMZ and YYZ collected the experimental samples and conducted the sperm analysis before and after sperm processing. QLW made the data statistics work and provided financial support for this study. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declare no competing interests.