Skip to main content
NCBI home page
Ecology and Evolution logoLink to Ecology and Evolution
. 2026 Sep 29;16(10):e74390. doi: 10.1002/ece3.74390

Sanicula fengjiensis (Apiaceae), a New Species From China Revealed by Integrative Morphological and Molecular Evidence

Hui‐Min Li 1, Ji‐Min Liao 1, Xu‐Dong Ma 1, Chun‐Feng Song 1,✉
PMCID: PMC13623500  PMID: 42813205

ABSTRACT

Sanicula fengjiensis (Apiaceae), a new species discovered in Fengjie County, Chongqing Municipality, southwestern China, is described and illustrated. It is morphologically most similar to S. caerulescens in having pseudo‐racemose inflorescences, but differs in having predominantly white petals (vs. blue to purple) and distinctive fruit ornamentation, with prickles absent, the ribs basally fused into a thin layer, and the valleculae occasionally bearing sparse scales or tubercles (vs. fruits sparsely to densely covered with short, straight spinous bristles). Quantitative morphological analyses further distinguished S. fengjiensis from S. caerulescens and the phylogenetically proximate S. lamelligera and S. orthacantha. In particular, the maximum height of fruit‐surface appendages in S. fengjiensis (0.033–0.101 mm) showed no overlap with the observed ranges of the other three species. The complete plastomes of four sampled accessions of S. fengjiensis were all 155,501 bp in length and exhibited the typical quadripartite structure. Plastome and nrDNA phylogenies based on complete plastome sequences and combined ITS and ETS sequences, respectively, consistently recovered the sampled accessions of S. fengjiensis as a clade, although its relationships with other Sanicula species differed between the two datasets. In addition to the extant population in Fengjie, a historical herbarium specimen collected from Yichang, Hubei Province, in 1963 is attributable to the new species. The combined morphological and phylogenetic evidence supports the recognition of S. fengjiensis as a distinct species.

Keywords: China, new species, phylogeny, plastome, Sanicula

Sanicula fengjiensis is described as a new species from Chongqing, China, based on integrative morphological and molecular evidence. Quantitative morphological analyses, together with distinctive inflorescence and fruit characters, clearly differentiate it from the morphologically similar S. caerulescens and the phylogenetically proximate S. lamelligera and S. orthacantha . Plastome and nrDNA phylogenies consistently recover S. fengjiensis as a distinct lineage, further supporting its recognition as a separate species.

graphic file with name ECE3-16-e74390-g004.webp

1. Introduction

Sanicula L. (Apiaceae, subfamily Saniculoideae) comprises ca. 42 taxa and is widely distributed from East Asia to North America (Van Wyk et al. 2013; Li et al. 2023). The genus has long been regarded as taxonomically complex due to its considerable morphological variation in rhizomes, leaves, inflorescences, and fruits, and it has been considered a relatively primitive lineage within subfamily Saniculoideae (Shan and Constance 1951; Hiroe 1979; Calviño et al. 2008; Wen et al. 2020; Xie et al. 2022). Over the past two decades, only four species and one variety have been newly described in the genus (Kamelin et al. 2002; Xie et al. 2019; Kenny et al. 2022; Song et al. 2024). Meanwhile, seven species and one variety have been reduced to synonymy (Li et al. 2022, 2024; Li and Song 2022; Li, Zhou, et al. 2025; Li, Zhu, et al. 2025). China is one of the major centers of distribution for Sanicula, harboring ca. 16 species (Li et al. 2022, 2024; Li and Song 2022; Song et al. 2024; Li, Zhou, et al. 2025; Li, Zhu, et al. 2025).

In taxonomically complex plant groups, taxa may remain overlooked or misidentified when morphological characters provide insufficient resolution (Duminil and Di Michele 2009; Bebber et al. 2010; Goodwin et al. 2015), particularly when available specimens lack the reproductive structures required for reliable identification (Sullivan and Nazaire 2022). Fruit morphology provides important diagnostic characters for species identification and delimitation in Sanicula (Shan and Constance 1951; Pryer and Phillippe 1989; Chen et al. 2019; Li et al. 2023). Recent studies have increasingly incorporated both plastome and nuclear ribosomal DNA (nrDNA) data to provide complementary phylogenetic evidence for species delimitation (Shen et al. 2025; Zhang et al. 2025). Therefore, integrating detailed morphological examination of numerous specimens, particularly of reproductive characters, with molecular phylogenetic evidence can help distinguish overlooked taxa from intraspecific variants and identify previously misidentified specimens.

During our botanical expeditions to Fengjie County, Chongqing Municipality, southwestern China, from 2022 to 2024, we encountered an unusual population of Sanicula that exhibited morphological features resembling S. caerulescens Franch., a species widely distributed in various regions of China and Vietnam (Li et al. 2024). These plants shared pseudo‐racemose inflorescences with S. caerulescens , a key characteristic of the species. However, upon further examination, we discovered that these plants differed significantly in fruit morphology, a crucial diagnostic feature in Sanicula. These morphological differences led us to hypothesize that the Fengjie population represented a previously overlooked taxon rather than an intraspecific variant of S. caerulescens . Subsequent plastome and nrDNA phylogenetic analyses further supported the distinctiveness of the Fengjie population, while the nrDNA phylogeny indicated particularly close relationships with S. lamelligera Hance and S. orthacantha S. Moore. These results prompted us to extend the morphological comparison beyond S. caerulescens to include these phylogenetically proximate species.

During our examination of herbarium material, we also identified a historical specimen collected from Yichang, Hubei Province, in 1963 that was morphologically consistent with the Fengjie plants, particularly in its diagnostic fruit characters (Figure 2B). However, no extant plants have yet been relocated at the historical Yichang locality. We therefore treat this specimen as a historical herbarium record rather than evidence of a confirmed extant population. Here, we describe this previously overlooked taxon as Sanicula fengjiensis based on morphological evidence and plastome and nrDNA (ITS and ETS) phylogenetic analyses. We further compare it with the morphologically similar S. caerulescens and the phylogenetically proximate S. lamelligera and S. orthacantha, and clarify its phylogenetic placement and currently documented distribution.

FIGURE 2.

FIGURE 2

Open in a new tab

The holotype (A) and specimen (B) of Sanicula fengjiensis sp. nov.

2. Materials and Methods

2.1. Morphological Comparison

For morphological comparison, we examined physical specimens or high‐resolution images of specimens of Sanicula caerulescens from 64 herbaria, including CDBI, NAS, PE, and WUK (Li et al. 2024). We also observed living plants from five representative populations of S. caerulescens (Li et al. 2024), four representative populations of S. orthacantha (Li et al. 2022), three representative populations of S. lamelligera (Li and Song 2022) and the type population of S. fengjiensis in Fengjie county, Chongqing Municipality. The type population of S. fengjiensis was repeatedly observed over two consecutive years to assess the stability of its diagnostic morphological characters.

We also examined a historical herbarium specimen collected in 1963 from the vicinity of Huanglingmiao in Yichang, Hubei Province. To evaluate the current occurrence of S. fengjiensis in this area, we conducted targeted field surveys in Yichang in 2021, 2023, and 2024, including searches around Huanglingmiao and nearby habitats considered potentially suitable on the basis of the locality information recorded on the specimen label.

Living individuals of S. fengjiensis collected from the type population were transplanted to and cultivated at the Institute of Botany, Jiangsu Province and Chinese Academy of Sciences for repeated morphological observations under cultivation. The morphological description of S. fengjiensis was based on observations of herbarium specimens and living plants in the wild and in cultivation.

Morphological comparisons focused on inflorescence morphology, involucral‐bract morphology, calyx teeth, and fruit morphology. Ten quantitative characters were included in the statistical analyses: inflorescence length, number of primary branches, terminal capitate umbel diameter, involucral bract length and width, calyx tooth length and width, fruit body length and width, and maximum height of fruit‐surface appendages. Fruit‐surface ornamentation was additionally recorded as a qualitative character (e.g., prickly, scaly, tuberculate, or nearly smooth) but was not included in the PCA. Quantitative characters were measured from fully developed structures. Where multiple homologous structures were available from an individual, repeated measurements were averaged and the individual mean was used as the statistical unit. The number of inflorescences examined per individual, individual‐level measurements, and summary statistics for each taxon are provided in Tables S1 and S2.

Principal component analysis (PCA) was performed using individual‐level mean values for the ten quantitative morphological characters. Pairwise correlations among characters were first assessed using Spearman's rank correlation coefficients to evaluate potential redundancy among variables. Prior to PCA, all variables were centered and scaled to unit variance to account for differences in measurement units and numerical ranges. Because no extensive collinearity was detected and the correlated characters represented biologically distinct morphological features, all ten quantitative characters were retained in the PCA. PCA was conducted using the prcomp function in R v.4.5.3. Qualitative characters, including fruit‐surface ornamentation, were excluded from the PCA and evaluated separately in the morphological comparison (Table 2).

TABLE 2.

Morphological comparison of Sanicula fengjiensis with S. caerulescens , S. lamelligera, and S. orthacantha.

Characters S. fengjiensis S. caerulescens S. lamelligera S. orthacantha
Inflorescence Pseudo‐racemose, rarely branched; capitate umbellules terminal, with the lower ones fascicled, sessile or short‐pedunculate Pseudo‐racemose, sometimes the lower umbels in fascicles, sessile or short‐pedunculate With 1 or 2 to several branches, sometimes subcorymbose 2–3 branched; umbels 3–8, sometimes with a shortened branch between forks or on lateral branches
Involucrate bracts Lanceolate to ovate, acuminate, 2–3 mm long Lanceolate to ovate, acuminate, ca. 1.6 mm long Trisect or linear‐lanceolate, 3–6, ca. 2 mm long Linear‐lanceolate or trisect, 2–6, 2–4.6 mm long
Rays of umbels Terminal umbels pedunculate, 2‐ to 10‐radiate, 4.8–6.0 mm long Terminal umbels pedunculate, 2‐ to 12‐radiate, 2.5–7.0 mm long Terminal umbels pedunculate, 1–7‐radiate, ca. 3.5 mm long Terminal umbels pedunculate, 1–9‐radiate, 1.8–7.5 mm long
Involucellate bracteoles 2–6, linear to lanceolate, 0.7–1.1 mm long 4–6(−8), linear to lanceolate, ca. 1 mm long 4–6, linear to lanceolate, ca. 0.6 mm long 4–6, linear to lanceolate, 0.4–1 mm long
Umbellules 5–7‐flowered 5–7‐flowered 4–7‐flowered 4–10‐flowered
Staminate flower 4–6 per umbellule; pedicels ca. 2 mm long; petals mainly white 4–6 per umbellule; pedicels 2.1–4.0 mm long; petals mainly blue to purple 3–6 per umbellule, pedicels ca. 1.5 mm long, petals white, pinkish or bluish purple 3–9 per umbellule, pedicels 0.8–3.9 mm long, petals white, pale blue or purplish red
Fertile flower 1 per umbellule, sessile 1 per umbellule, sessile 1 per umbellule, sessile 1 per umbellule, sessile
Mericarps Globose to ellipsoid, ca. 1.8 mm long, 1.0–1.8 mm broad, prickles absent; ribs basally fused into a thin layer; valleculae occasionally bearing sparse scales or tubercles Globose to ellipsoid, 2.0–3.0 mm long, 1.0–1.5 mm broad, sparsely to densely covered with short, straight spinous bristles; bristles usually fused at the base, forming a thin sheath Oblong‐ovoid to ovoid, ca. 2.5 mm long, ca. 2 mm broad, variably spiculate‐lamellate, comblike Oblong‐ovoid to ovoid, 0.7–3.5 mm long, 0.5–2.8 mm broad, ribs spinulose, furrows smooth, more or less spinulose
Open in a new tab

2.2. Phylogenetic Reconstruction

2.2.1. Plant Materials, DNA Extraction, Plastome Sequencing, and NRDNA Amplification

Four individuals of Sanicula fengjiensis were sampled from the type population in Fengjie County for molecular analyses, including plastome sequencing and nuclear ribosomal ITS and ETS sequencing. Fresh and healthy leaf tissues were collected in the field and dried in silica gel. Voucher specimens were deposited in the Herbarium of the Institute of Botany, Jiangsu Province and Chinese Academy of Sciences (NAS), and the voucher numbers are listed in Table 1.

TABLE 1.

Origins and voucher information for newly sequenced samples of Sanicula (four plastomes, 21 ITS, 20 ETS) and Eryngium (one ITS, one ETS), together with 15 publicly available plastome sequences of Sanicula and Eryngium retrieved from NCBI.

Order Species Localities Coordinates Altitude (m) Voucher specimen Cp genome ITS ETS
1 E. alpinum NC_084330.1
2 E. foetidum Kunming, Yunnan LHM1175 PZ195083 PZ228507
3 E. foetidum NC_068234.1
4 E. planum MT561039.1
5 S. chinensis NC_085169.1
6 S. giraldii OR865883.1
7 S. hacquetioides NC_072641.1
8 S. odorata NC_061689.1
9 S. rubriflora OQ612642.1
10 S. rugulosa Fendou Village, Huize, Qujing, Yunnan 25.94214940° N/103.51156100° E 2292 LHM3002 PZ195092 PZ228515
11 S. rugulosa NC_061561.1
12 S. brevispina Xixiangchi, Emeishan, Sichuan 29.5546723° N/103.3453723° E 2215–2400 LHM1054 NC_072645.1 PZ195084 PZ228508
13 S. caerulescens Suijiang, Zhaotong, Yunnan 28.40185491° N/104.24369980° E 1307 SCF097 PZ195090 PZ228511
14 S. caerulescens Yongshan, Zhaotong, Yunnan 28.2415796° N/103.63501° E 1538 SCF103 PZ195091 PZ228510
15 S. caerulescens Jinyunshan, Beibei, Chongqing 29.8420075° N/106.3986754° E 850 LHM1005 NC_072644.1 PZ195089 PZ228509
16 S. chinensis Baiyang Cha, Zhouzhi, Shaanxi 33.99522500° N/108.41760556° E 900–1014 LHM1181 PZ195093 PZ228521
17 S. elata Ani Qiao, Motuo, Linzhi, Xizang 29.33028057° N/95.17890279° E 1025 MQG61 https://doi.org/10.5281/zenodo.21932899 PZ228520
18 S. fengjiensis sp. nov. Lianhua Village, Fengjie, Chongqing 30.91767418° N/109.54895994° E 180.74 LHM1594_2 https://doi.org/10.5281/zenodo.19202452 PZ195095 PZ228512
19 S. fengjiensis sp. nov. Lianhua Village, Fengjie, Chongqing 30.91767418° N/109.54895994° E 180.74 LHM1594_1 https://doi.org/10.5281/zenodo.19202452 https://doi.org/10.5281/zenodo.19202452 https://doi.org/10.5281/zenodo.19202452
20 S. fengjiensis sp. nov. Lianhua Village, Fengjie, Chongqing 30.91767418° N/109.54895994° E 180.74 LHM1594_4 https://doi.org/10.5281/zenodo.19202452 https://doi.org/10.5281/zenodo.19202452 https://doi.org/10.5281/zenodo.19202452
21 S. fengjiensis sp. nov. Lianhua Village, Fengjie, Chongqing 30.91767418° N/109.54895994° E 180.74 LHM1594_9 https://doi.org/10.5281/zenodo.19202452 https://doi.org/10.5281/zenodo.19202452 https://doi.org/10.5281/zenodo.19202452
22 S. flavovirens Mingtang Shan, Yuexi, Anqing, Anhui 30.8750667° N/116.0817113° E 1046.32 LHM1307 OP703176.1 PZ195098 PZ228517
23 S. giraldii Guanyin Shan, Zhouzhi, Shaanxi 33.9827778° N/108.4328862° E 1912 LHM1180 PZ195085 PZ228518
24 S. hacquetioides Yajiageng Shan, Kangding, Sichuan 29.92547261° N/101.98205156° E 3584.83 LHM1166 PZ195086 PZ228523
25 S. lamelligera Ximaping, Xuanen, Hubei 29.9362223° N/109.5968334° E 682 LHM1098 PZ185128 https://doi.org/10.5281/zenodo.19202452
26 S. lamelligera West of Tianmu, Lin'an, Zhejiang 30.32871113° N/119.4391612° E 472 LHM1115 OP703174.1 PZ195094 PZ228513
27 S. lamelligera Yesanxia, Jianshi, Hubei 30.39263889° N/109.99547233° E 1132 LHM1081 PZ179864
28 S. orthacantha Huanglong Lu, Lushan, Jiangxi 29.54758334° N/115.9653889° E 909 LHM1109 NC_072642.1 PZ195096 PZ228522
29 S. potaninii Taibai Shan Shizhen, Meixian, Shaanxi 34.0103751° N/107.8235695° E 2484 LHM1200 PZ195087 PZ228519
30 S. rubriflora Xiaobeigou, Jiangyuan, Baishan, Jilin 42.04085554° N/126.704289° E 662.8 LHM1310 PZ195097 PZ228514
31 S. serrata Cangping Village, Huoshan, Anhui 31.17497223° N/116.18508334° E 796 LHM1110 OP703175.1 PZ195088 PZ228516
Open in a new tab

Total genomic DNA was extracted from silica‐dried leaf tissues using a modified CTAB method (Doyle and Doyle 1987). DNA integrity and purity were evaluated using 1% (w/v) agarose gel electrophoresis and a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA), respectively, and DNA concentration was quantified using a Qubit 2.0 fluorometer.

For plastome sequencing, high‐quality DNA libraries were constructed and sequenced by Wuhan Benagen Tech Solutions Company Limited (Wuhan, China). Genome‐skimming sequencing was performed on the NovaSeq PE150 platform, generating 150‐bp paired‐end reads with an insert size of approximately 350 bp. The resulting sequencing reads were used for plastome assembly.

The nuclear ribosomal ITS and ETS regions were amplified separately by polymerase chain reaction (PCR). ITS was amplified using ITS5 (5′‐GGAAGTAAAAGTCGTAACAAGG‐3′) and ITS4 (5′‐TCCTCCGCTTATTGATATGC‐3′) (White et al. 1990), whereas ETS was amplified using 18S‐ETS (5′‐ACTTACACATGCATGGCTTAATCT‐3′) and Umb‐ETS (5′‐GCGCATGAGTGGTGAWTKGTA‐3′) (Baldwin and Markos 1998; Logacheva et al. 2010). The PCR products were purified and bidirectionally sequenced using the Sanger method by Sangon Biotech (Shanghai) Co. Ltd. Forward and reverse reads were assembled and manually checked using Geneious Prime v.2020.0.5. In total, we newly generated 21 ITS and 20 ETS sequences for Sanicula, including four ITS and four ETS sequences from the four individuals of S. fengjiensis. These sequences were deposited in Zenodo and their accession numbers are provided in Table 1.

For phylogenetic analyses, the four newly generated plastomes of S. fengjiensis were combined with 15 complete plastomes retrieved from NCBI GenBank, including 16 plastomes of Sanicula and three plastomes of Eryngium (Table 1).

2.2.2. Complete Chloroplast Genomes Assembly and Annotation

Clean sequencing reads were assembled de novo using the GetOrganelle pipeline (Bankevich et al. 2012; Langmead and Salzberg 2012; Jin et al. 2020). Bandage v.5.6.0 (Wick et al. 2015) was used to visualize and manually inspect the assembly results. Chloroplast genome annotation was performed using PGA (Qu et al. 2019). Start and stop codons, as well as intron–exon boundaries, were manually corrected in Geneious Prime 2020.0.5 (Kearse et al. 2012). Circular genome maps were generated using OrganellarGenomeDRAW v.1.3.1 (Greiner et al. 2019). The annotated chloroplast genomes were deposited in Zenodo.

2.2.3. Phylogenetic Analysis

To reconstruct the phylogenetic relationships within the genus Sanicula, 19 plastomes, 22 ITS sequences, and 21 ETS sequences, including the outgroup, were analyzed. Three Eryngium species were selected as outgroups for the plastome dataset, and one Eryngium species was selected as the outgroup for the ITS and ETS datasets, based on the phylogenetic framework proposed in a previous study (Calviño and Downie 2007). The plastome, ITS, and ETS datasets were aligned separately using MAFFT v7.221 (Katoh and Standley 2013).

Maximum‐likelihood analyses of the plastome, ITS, and ETS datasets were conducted separately using IQ‐TREE (Nguyen et al. 2015; Stamatakis and Kozlov 2020) with automatic substitution model selection and 1000 bootstrap replicates to evaluate nodal support. The analyses were run on the CIPRES Science Gateway platform (Miller et al. 2010). BI analyses were conducted in MrBayes on XSEDE v3.2.7a (Huelsenbeck and Ronquist 2001), with models selected under the Bayesian model choice setting implemented in MrBayes (nst = 6, rates = gamma).

Furthermore, the ITS and ETS gene trees were summarized to infer the ASTRAL tree (Mirarab et al. 2014). The final phylogenetic trees were visualized using Interactive Tree of Life (iTOL) v6 (Letunic and Bork 2024).

3. Results and Discussion

3.1. Morphology and Ecology

Sanicula fengjiensis was morphologically most similar to S. caerulescens , particularly in having pseudo‐racemose inflorescences. It could, however, be distinguished from S. caerulescens by its usually unbranched or only sparsely branched inflorescences composed predominantly of terminal capitate umbellules, mostly white petals (vs. blue to purple), and fruits lacking spinous prickles. In S. fengjiensis, the fruit‐surface appendages were strongly reduced, with the ribs basally fused into a thin layer and the valleculae occasionally bearing sparse scales or tubercles, whereas the fruits of S. caerulescens were sparsely to densely covered with short, straight spinous bristles that were basally fused into a thin sheath (Figures 1 and 2A).

FIGURE 1.

FIGURE 1

Open in a new tab

Sanicula fengjiensis sp. nov. in the wild (China, Chongqing, Fengjie, the type locality). (A) Habitat. (B) habit. (C) leaf (left: adaxial surface; right: abaxial surface). (D) portion of inflorescence (top view). (E) portion of inflorescence (side view). (F) umbellule (side view; a. involucellate bracteoles, b. calyx teeth). (G) staminate flowers (side view). (H) fertile flower with fruit, male pedicel, styles and calyx teeth. (I) mericarps with styles and calyx teeth. Photographed by Huimin Li.

Given that the nrDNA ASTRAL tree (Figure 4B) placed S. fengjiensis in a clade with S. lamelligera and S. orthacantha, these two phylogenetically proximate species were additionally included in the morphological comparison. Both species could also be readily distinguished from S. fengjiensis by their markedly different inflorescence branching patterns, together with differences in other floral and fruit characters summarized in Table 2. Quantitative analyses of 10 morphological characters across the four species further supported the distinctiveness of S. fengjiensis. The first two principal components accounted for 49.8% of the total morphological variation (PC1 = 28.2%; PC2 = 21.6%) (Figure 5A,B; Tables S1 and S2). Among the measured characters, maximum fruit‐surface appendage height and terminal capitate umbel diameter showed the strongest diagnostic differentiation of S. fengjiensis from the other three species.

FIGURE 4.

FIGURE 4

Open in a new tab

Phylogenetic trees inferred from both complete chloroplast genomes and nrDNA markers are shown. (A) Tree based on complete chloroplast genomes of 16 Sanicula samples and three Eryngium species, inferred using Maximum Likelihood (ML) and Bayesian Inference (BI); bootstrap support and posterior probability are shown on branches as ML/BI. (B) ASTRAL tree based on ITS and ETS sequences; local posterior probabilities (LPP) are shown on the branches.

FIGURE 5.

FIGURE 5

Open in a new tab

Quantitative morphological differentiation among Sanicula fengjiensis, S. caerulescens , S. lamelligera, and S. orthacantha. (A) PCA based on ten quantitative morphological characters. (B) Loadings of T1–T10 on PC1 and PC2. (C–E) Variation in fruit‐surface appendage height (T10), terminal capitate umbel diameter (T3), and number of primary inflorescence branches (T2), respectively; different lowercase letters indicate significant pairwise differences (p < 0.05). (F) Observed ranges of T10 and T3; thin lines indicate min–max, thick bars indicate Q1–Q3, and open circles indicate medians.

Maximum fruit‐surface appendage height (T10) showed particularly pronounced differentiation among species (Kruskal–Wallis test, BH‐adjusted p < 0.001, ε 2 = 0.525; Figure 5C). In S. fengjiensis, this character ranged from 0.033 to 0.101 mm, with no overlap with the observed ranges of S. caerulescens (0.253–0.625 mm), S. lamelligera (0.152–0.447 mm), or S. orthacantha (0.265–0.800 mm) (Figure 5F and Table S2). Terminal capitate umbel diameter (T3) also differed significantly among species (one‐way ANOVA, BH‐adjusted p < 0.001, η 2 = 0.378; Figure 5D). Although the overall observed ranges showed some overlap, the interquartile range of S. fengjiensis was completely separated from those of the other three species (Figure 5F). The number of primary inflorescence branches (T2) provided additional differentiation from S. lamelligera and S. orthacantha, although it did not significantly distinguish S. fengjiensis from S. caerulescens (Figure 5E). In contrast, several other quantitative characters showed considerable interspecific overlap and therefore had lower diagnostic value when considered individually.

Taken together, the quantitative differences and qualitative characters of the inflorescences, petals, calyx teeth, and fruit surface distinguished S. fengjiensis from both the morphologically similar S. caerulescens and the phylogenetically proximate S. lamelligera and S. orthacantha. Detailed morphological comparisons among the four species were provided in Table 2.

According to available distributional records, the four species also differed geographically and ecologically. S. caerulescens was widely distributed in China (Chongqing, Guangxi, Hubei, Hunan, Sichuan, and Yunnan) and Vietnam (Hà Giang), occurring mainly at elevations of 400–1700 m (Li et al. 2024). S. lamelligera was widely distributed in central, eastern, southern, and southwestern China and southern Japan, where it occurred in forests on mountain slopes and along ravines and streams at elevations of 450–1600 m (Li and Song 2022). S. orthacantha was widely distributed in China (Anhui, Chongqing, Fujian, Gansu, Guangdong, Guangxi, Guizhou, Hubei, Hunan, Jiangxi, Shaanxi, Sichuan, Taiwan, Yunnan, and Zhejiang) and Vietnam, occurring mainly on forested mountain slopes and along ravines and streams at elevations of 600–2140 m (Li et al. 2022). At the time of this study, S. fengjiensis was documented only from Chongqing and Hubei (Figure 6), with known extant populations occurring at relatively low elevations of approximately 100–200 m on mountain slopes.

FIGURE 6.

FIGURE 6

Open in a new tab

Distribution map of Sanicula fengjiensis sp. nov. (●).

3.2. Characteristics of Plastomes and Phylogenetic Analysis

The complete plastomes of four Sanicula fengjiensis accessions were all 155,501 bp in length (https://doi.org/10.5281/zenodo.19202452; A representative plastome map is shown in Figure 3). All four plastomes exhibited the typical quadripartite structure, comprising a large single‐copy (LSC) region, a small single‐copy (SSC) region, and two inverted repeat regions (IRa and IRb) (representative plastome characteristics are shown in Table 3).

FIGURE 3.

FIGURE 3

Open in a new tab

Circular gene map of a representative complete plastome of Sanicula fengjiensis sp. nov. (LHM1594‐2). Genes shown outside the circle are transcribed clockwise, whereas those inside are transcribed counterclockwise. Genes are color‐coded according to different functional groups. The dark gray and light gray plots in the inner circle indicate GC content and AT content, respectively. IR, inverted repeat; LSC, large single‐copy region; SSC, small single‐copy region.

TABLE 3.

Plastome characteristics of a representative accession of Sanicula fengjiensis sp. nov.

Characteristic Sanicula fengjiensis sp. nov.
Total length (bp) 155,501
GC% 38.2
LSC length (bp) 85,923
SSC length (bp) 17,098
IR length (each; bp) 26,240
Total genes 132
Protein‐coding genes 87
rRNA genes 8
tRNA genes 37
Open in a new tab

Note: The four sampled accessions had identical values for the plastome characteristics listed; therefore, a single representative set of values is presented.

Phylogenetic analyses based on plastome and combined ITS and ETS datasets consistently recovered the sampled accessions of S. fengjiensis as a distinct clade, although its relationships with other Sanicula species differed between the two datasets. In the plastome phylogeny, the four sampled accessions of S. fengjiensis formed a strongly supported clade (BS = 100, PP = 1.00; Figure 4A). This clade was resolved as sister to a larger lineage containing S. rugulosa Diels, S. brevispina (H.Boissieu) B.N. Song & X.J. He, S. orthacantha, S. lamelligera, and S. caerulescens , although support for this relationship was relatively low (BS = 62, PP = 0.60).

In the ASTRAL tree inferred from ITS and ETS gene trees, the four accessions of S. fengjiensis also formed a clade (LPP = 0.87; Figure 4B). This clade was placed with S. orthacantha, although their immediate relationship received low support (LPP = 0.42), and the resulting lineage was grouped with S. lamelligera with higher support (LPP = 0.87). This broader lineage was sister to the clade comprising the three sampled populations of S. caerulescens (LPP = 0.81).

The plastome and nrDNA datasets therefore recovered different placements of S. fengjiensis, indicating topological discordance between the plastome and nrDNA phylogenies. The underlying cause of this discordance cannot be determined from the present data alone. Nevertheless, the sampled accessions of S. fengjiensis consistently formed a coherent clade in both analyses. Together with the diagnostic morphological differences from S. caerulescens , S. lamelligera, and S. orthacantha, these results supported the recognition of S. fengjiensis as a distinct species.

4. Taxonomic Treatment

Sanicula fengjiensis H.M. Li & C.F. Song, sp. nov. (Figures 1 and 2).

4.1. Type

CHINA. Chongqing municipality: Fengjie County, Lianhua village, along roadsides, in forest understories, and on stony slopes, 30.91767418° N, 109.54895994° E, 180.74 m alt., 6 June 2024, LHM1594 (fl., holotype NAS00722724!, isotype NAS00722725!).

4.2. Diagnosis

Sanicula fengjiensis is morphologically similar to S. caerulescens in having pseudo‐racemose inflorescences, but differs in having usually unbranched or sparsely branched inflorescences, predominantly white petals (vs. blue to purple), and fruits lacking spinous prickles, with the ribs basally fused into a thin layer and the valleculae occasionally bearing sparse scales or tubercles (vs. fruits sparsely to densely covered with short, straight spinous bristles that are basally fused into a thin sheath). It is also readily distinguished from the phylogenetically proximate S. lamelligera and S. orthacantha by its much less extensively branched inflorescences and distinctive fruit‐surface ornamentation (Table 2).

4.3. Description

Perennial. Rhizome, oblique rootstock, bearing fibrous roots. Stems 1–8, slender and erect, 18–28 cm tall. Basal leaves 7–24, long petiolate; petioles 1.5–13 cm long; blade glabrous adaxially and abaxially, 1–7 cm long, 1–7.5 cm wide, cordate suborbicular, ternate, segments distinctly petiolate; median segments obovate to ovate‐lanceolate, distinctly shallowly trilobed, petiolate; lateral segments obliquely ovate, bilobed to the middle or only notched or rarely entire; margins irregularly crenulate serrate with spinose teeth. Cauline leaves absent or nearly absent; degenerating into sheathing, trisect or undivided, bract‐like, ca. 2.0 mm long, subsessile or sessile. Inflorescence rarely branched, pseudo‐racemose, consisting of capitate umbellules only, terminal; lower umbels fascicled, sessile or short‐pedunculate; involucrate bracts lanceolate to ovate, acuminate, 2–3 mm long; terminal umbels pedunculate, with 2–10 rays, rays 4.8–6.0 mm long; involucellate bracteoles 2–6, linear to lanceolate, 0.7–1.1 mm long. Staminate flowers 4–6 per umbellule; pedicels ca. 2 mm long; petals mainly white. Fertile flowers 1 per umbellule, sessile; calyx teeth 4–8, linear to lanceolate, acute, 0.6–1.2 mm long; styles 2.0–3.6 mm long, recurved. Mericarps globose to ellipsoid, ca. 1.8 mm long, 1.0–1.8 mm broad, along ribs fused at base into a thin layer; valleculae occasionally bearing sparse scales or tubercles; prickles absent; mericarps dorsally flattened, orbicular in cross‐section.

4.4. Phenology

Flowering from late March to early May. Fruiting from late March to early June.

4.5. Etymology

The epithet “fengjiensis” is derived from the type locality, Fengjie County, Chongqing Municipality, China. The Chinese name given is Feng Jie Bian Dou Cai (奉节变豆菜).

4.6. Distribution and Habitat

Sanicula fengjiensis is currently known from its extant population at the type locality, that is, Lianhua Village in Fengjie County, Chongqing Municipality, China, and from a historical herbarium record collected from Yichang City, Hubei Province, China (Figure 5). It grows along roadsides, in forest understories, and on stony slopes at altitudes of 100–200 m.

4.7. Preliminary Conservation Status

Based on extensive examinations of herbarium specimens and our field surveys, Sanicula fengjiensis is rare in its type locality and adjacent areas. To date, only one extant population and one historical locality are known: one observed in the wild and one identified from specimen records. As its full distribution range, population dynamics, and potential threats remain unclear, we tentatively assess this species as Data Deficient (DD) according to the IUCN Red List Categories and Criteria (IUCN Standards and Petitions Committee 2024).

Author Contributions

Hui‐Min Li: data curation (equal), formal analysis (equal), investigation (equal), software (equal), visualization (equal), writing – original draft (equal). Ji‐Min Liao: formal analysis (equal), methodology (equal), writing – original draft (equal). Xu‐Dong Ma: formal analysis (equal), methodology (equal). Chun‐Feng Song: conceptualization (equal), formal analysis (equal), investigation (equal), methodology (equal), project administration (equal), supervision (equal), writing – original draft (equal), writing – review and editing (equal).

Funding

This work was financially supported by the National Natural Science Foundation of China (Grant 32370220) and the Natural Science Foundation of Jiangsu Province (Grant BK20200294).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Table S1: Individual‐level measurements of 10 quantitative morphological characters in four Sanicula species.

ECE3-16-e74390-s001.xlsx (18KB, xlsx)

Table S2: Summary statistics of 10 quantitative morphological characters in four Sanicula species.

ECE3-16-e74390-s002.xlsx (12.9KB, xlsx)

Acknowledgments

We thank Jun‐Wen Zhu and Wei Wang for their assistance with fieldwork.

Data Availability Statement

The plastome sequences generated in this study have been deposited in Zenodo and are publicly available at https://doi.org/10.5281/zenodo.19202452. Newly generated nuclear ribosomal DNA sequences (ITS and ETS) have been deposited in either GenBank or Zenodo, and their accession numbers are provided in Tables 1 and S1. Detailed collection information and sequence identifiers are also provided in these tables.

References

  1. Baldwin, B. G. , and Markos S.. 1998. “Phylogenetic Utility of the External Transcribed Spacer (ETS) of 18S–26S rDNA: Congruence of ETS and ITS Trees of Calycadenia (Compositae).” Molecular Phylogenetics and Evolution 10: 449–463. 10.1006/mpev.1998.0545. [DOI] [PubMed] [Google Scholar]
  2. Bankevich, A. , Nurk S., Antipov D., et al. 2012. “SPAdes: A New Genome Assembly Algorithm and Its Applications to Single‐Cell Sequencing.” Journal of Computational Biology 19: 455–477. 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bebber, D. P. , Carine M. A., Wood J. R. I., et al. 2010. “Herbaria Are a Major Frontier for Species Discovery.” Proceedings of the National Academy of Sciences of the United States of America 107: 22169–22171. 10.1073/pnas.1011841108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Calviño, C. I. , and Downie S. R.. 2007. “Circumscription and Phylogeny of Apiaceae Subfamily Saniculoideae Based on Chloroplast DNA Sequences.” Molecular Phylogenetics and Evolution 44: 175–191. 10.1016/j.ympev.2007.01.002. [DOI] [PubMed] [Google Scholar]
  5. Calviño, C. I. , Martínez S. G., and Downie S. R.. 2008. “The Evolutionary History of Eryngium (Apiaceae, Saniculoideae): Rapid Radiations, Long‐Distance Dispersals, and Hybridizations.” Molecular Phylogenetics and Evolution 46: 1129–1150. 10.1016/j.ympev.2007.10.021. [DOI] [PubMed] [Google Scholar]
  6. Chen, Z.‐X. , Yao X.‐Y., Downie S. R., and Wang Q.‐Z.. 2019. “Fruit Features of 15 Species of Sanicula (Apiaceae) and Their Taxonomic Significance.” Plant Science Journal 37: 1–9. 10.11913/PSJ.2095-0837.2019.10001. [DOI] [Google Scholar]
  7. Doyle, J. J. , and Doyle J. L.. 1987. “A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue.” Phytochemical Bulletin 19: 11–15. [Google Scholar]
  8. Duminil, J. , and Di Michele M.. 2009. “Plant Species Delimitation: A Comparison of Morphological and Molecular Markers.” Plant Biosystems 143: 528–542. 10.1080/11263500902722964. [DOI] [Google Scholar]
  9. Goodwin, Z. A. , Harris D. J., Filer D., Wood J. R. I., and Scotland R. W.. 2015. “Widespread Mistaken Identity in Tropical Plant Collections.” Current Biology 25: R1066–R1067. 10.1016/j.cub.2015.10.002. [DOI] [PubMed] [Google Scholar]
  10. Greiner, S. , Lehwark P., and Bock R.. 2019. “OrganellarGenomeDRAW (OGDRAW) Version 1.3.1: Expanded Toolkit for the Graphical Visualization of Organellar Genomes.” Nucleic Acids Research 47: W59–W64. 10.1093/nar/gkz238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hiroe, M. 1979. Umbelliferae of World. Ariake Book Company. [Google Scholar]
  12. Huelsenbeck, J. P. , and Ronquist F.. 2001. “MRBAYES: Bayesian Inference of Phylogenetic Trees.” Bioinformatics 17: 754–755. 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  13. IUCN Standards and Petitions Committee . 2024. Guidelines for Using the IUCN Red List Categories and Criteria. Version 16. Prepared by the Standards and Petitions Committee. IUCN. [Google Scholar]
  14. Jin, J. J. , Yu W. B., Yang J. B., et al. 2020. “GetOrganelle: A Fast and Versatile Toolkit for Accurate De Novo Assembly of Organelle Genomes.” Genome Biology 21: 241. 10.1186/s13059-020-02154-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kamelin, R. V. , Czubarov I. N., and Schmakov A. I.. 2002. “What Is Sanicula uralensis Kleop.?” Turczaninowia 5: 11–25. [Google Scholar]
  16. Katoh, K. , and Standley D. M.. 2013. “MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability.” Molecular Biology and Evolution 30: 772–780. 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kearse, M. , Moir R., Wilson A., et al. 2012. “Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data.” Bioinformatics 28: 1647–1649. 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kenny, R. J. , West J. A., Johnson H., Yost J. M., and Ritter M. K.. 2022. “A New Combination in Sanicula crassicaulis (Apiaceae).” Madroño 69: 102–110. 10.3120/0024-9637-69.1.102. [DOI] [Google Scholar]
  19. Langmead, B. , and Salzberg S. L.. 2012. “Fast Gapped‐Read Alignment With Bowtie 2.” Nature Methods 9: 357–359. 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Letunic, I. , and Bork P.. 2024. “Interactive Tree of Life (iTOL) v6: Recent Updates to the Phylogenetic Tree Display and Annotation Tool.” Nucleic Acids Research 52: W78–W82. 10.1093/nar/gkae268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li, H. M. , and Song C. F.. 2022. “Taxonomic Studies on the Genus Sanicula (Apiaceae) From China (I): The Identity of S. orthacantha var. pumila and S. pengshuiensis .” Phytotaxa 532: 114–138. 10.11646/phytotaxa.532.2.1. [DOI] [Google Scholar]
  22. Li, H. M. , Wu M. S., Lai Q., Zhou W., and Song C. F.. 2023. “Complete Chloroplast of Four Sanicula Taxa (Apiaceae) Endemic to China: Lights Into Genome Structure, Comparative Analysis, and Phylogenetic Relationships.” BMC Plant Biology 23: 444. 10.1186/s12870-023-04447-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li, H. M. , Zhou W., and Song C. F.. 2022. “Taxonomic Studies on the Genus Sanicula (Apiaceae) From China (II): The Clarification of Some Morphological Distinction Between S. orthacantha var. orthacantha and S. orthacantha var. brevispina, With the Reduction of S. petagnioides to the Synonymy of the Former, and S. orthacantha var. stolonifera to the Synonymy of the Latter Variety.” Phytotaxa 548: 1–25. 10.11646/phytotaxa.548.1.1. [DOI] [Google Scholar]
  24. Li, H. M. , Zhou W., Wu B. C., Ma X. D., Wen J., and Song C. F.. 2025. “Taxonomic Studies on Sanicula L. (Apiaceae) From China (V): Revision of the Sanicula serrata H. Wolff Complex: Morphological Delimitation From S. potaninii Bobrov, Synonymization of Allied Taxa, and Lectotypifications.” PhytoKeys 265: 71–104. 10.3897/phytokeys.265.169937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li, H. M. , Zhou W., Zhu J. W., and Song C. F.. 2024. “Taxonomic Studies on the Genus Sanicula (Apiaceae) From China (III): The Morphology and Distribution of S. caerulescens (Apiaceae), With S. oviformis Reduced to a New Synonym.” PhytoKeys 249: 205–222. 10.3897/phytokeys.249.136854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li, H. M. , Zhu J. W., Ma X. D., Yi S. R., and Song C. F.. 2025. “Taxonomic Studies on the Genus Sanicula (Apiaceae) From China (IV): Clarification of Morphology and Distribution of S. rugulosa and S. subgiraldii, With Reduction of S. astrantiifolia to a Synonym of the Former.” PhytoKeys 262: 223–244. 10.3897/phytokeys.262.165363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Logacheva, M. D. , Valiejo‐Roman C. M., Degtjareva G. V., et al. 2010. “A Comparison of nrDNA ITS and ETS Loci for Phylogenetic Inference in the Umbelliferae: An Example From Tribe Tordylieae.” Molecular Phylogenetics and Evolution 57: 471–476. 10.1016/j.ympev.2010.06.001. [DOI] [PubMed] [Google Scholar]
  28. Miller, M. A. , Pfeiffer W., and Schwartz T.. 2010. “Creating the CIPRES Science Gateway for Inference of Large Phylogenetic Trees.” In 2010 Gateway Computing Environments Workshop (GCE), 1–8. 10.1109/GCE.2010.5676129. [DOI] [Google Scholar]
  29. Mirarab, S. , Reaz R., Bayzid M. S., Zimmermann T., Swenson M. S., and Warnow T.. 2014. “ASTRAL: Genome‐Scale Coalescent‐Based Species Tree Estimation.” Bioinformatics 30: i541–i548. 10.1093/bioinformatics/btu462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nguyen, L.‐T. , Schmidt H. A., von Haeseler A., and Minh B. Q.. 2015. “IQ‐TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum‐Likelihood Phylogenies.” Molecular Biology and Evolution 32: 268–274. 10.1093/molbev/msu300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pryer, K. M. , and Phillippe L. R.. 1989. “A Synopsis of the Genus Sanicula (Apiaceae) in Eastern Canada.” Canadian Journal of Botany 67: 694–707. 10.1139/b89-093. [DOI] [Google Scholar]
  32. Qu, X.‐J. , Moore M. J., Li D.‐Z., and Yi T.‐S.. 2019. “PGA: A Software Package for Rapid, Accurate, and Flexible Batch Annotation of Plastomes.” Plant Methods 15: 50. 10.1186/s13007-019-0435-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Shan, R. H. , and Constance L.. 1951. “The Genus Sanicula (Umbelliferae) in the Old World and the New.” University of California Publications in Botany 25: 1–78. [Google Scholar]
  34. Shen, L. , Ma H., Meng W., et al. 2025. “ Ranunculus yuexiensis (Ranunculaceae): A New Species From Dabie Mountains, China, Based on Plastome and Morphological Data.” Ecology and Evolution 15: e72418. 10.1002/ece3.72418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Song, B. N. , Liu C. K., Ren T., et al. 2024. “Plastid Phylogenomics Contributes to the Taxonomic Revision of Taxa Within the Genus Sanicula L. and Acceptance of Two New Members of the Genus.” Frontiers in Plant Science 15: 1351023. 10.3389/fpls.2024.1351023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Stamatakis, A. , and Kozlov A. M.. 2020. “Efficient Maximum Likelihood Tree Building Methods.” In Phylogenetics in the Genomic Era, edited by Scornavacca C., Delsuc F., and Galtier N., 1.2:1–1.2:18. Open Access. [Google Scholar]
  37. Sullivan, J. R. , and Nazaire M.. 2022. “Specimen Collection and Preparation for a Changing Flora.” Rhodora 123: 50–66. 10.3119/20-32. [DOI] [Google Scholar]
  38. Van Wyk, B. E. , Tilney P. M., and Magee A. R.. 2013. African Apiaceae: A Synopsis of the Apiaceae/Umbelliferae of Sub‐Saharan Africa and Madagascar. Briza Academic Books. [Google Scholar]
  39. Wen, J. , Yu Y., Xie D. F., et al. 2020. “A Transcriptome‐Based Study on the Phylogeny and Evolution of the Taxonomically Controversial Subfamily Apioideae (Apiaceae).” Annals of Botany 125: 937–953. 10.1093/aob/mcaa011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. White, T. J. , Bruns T., Lee S., and Taylor J.. 1990. “Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics.” In PCR Protocols: A Guide to Methods and Applications, edited by Innis M. A., Gelfand D. H., Sninsky J. J., and White T. J., 315–322. Academic Press. 10.1016/B978-0-12-372180-8.50042-1. [DOI] [Google Scholar]
  41. Wick, R. R. , Schultz M. B., Zobel J., and Holt K. E.. 2015. “Bandage: Interactive Visualization of De Novo Genome Assemblies.” Bioinformatics 31: 3350–3352. 10.1093/bioinformatics/btv383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Xie, D. F. , Xie C., Ren T., Song B. N., Zhou S. D., and He X. J.. 2022. “Plastid Phylogenomic Insights Into Relationships, Divergence, and Evolution of Apiales.” Planta 256: 117. 10.1007/s00425-022-04031-w. [DOI] [PubMed] [Google Scholar]
  43. Xie, W.‐Y. , Ma D.‐D., Chen F., Wang P., Chen J.‐F., and Chen Z.‐H.. 2019. “ Sanicula flavovirens—A New Species of the Genus Sanicula (Umbelliferae) in Zhejiang.” Journal of Hangzhou Normal University (Natural Science Edition) 18: 9–12. 10.3969/j.issn.1674-232X.2019.01.003. [DOI] [Google Scholar]
  44. Zhang, Y. , Zhang R., Du X., Zhang G., and Li D.. 2025. “DNA Barcoding and Cryptic New Species Confirmation of Chimonocalamus (Poaceae: Bambusoideae).” Journal of Systematics and Evolution 64: 240–259. 10.1111/jse.70027. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1: Individual‐level measurements of 10 quantitative morphological characters in four Sanicula species.

ECE3-16-e74390-s001.xlsx (18KB, xlsx)

Table S2: Summary statistics of 10 quantitative morphological characters in four Sanicula species.

ECE3-16-e74390-s002.xlsx (12.9KB, xlsx)

Data Availability Statement

The plastome sequences generated in this study have been deposited in Zenodo and are publicly available at https://doi.org/10.5281/zenodo.19202452. Newly generated nuclear ribosomal DNA sequences (ITS and ETS) have been deposited in either GenBank or Zenodo, and their accession numbers are provided in Tables 1 and S1. Detailed collection information and sequence identifiers are also provided in these tables.

Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES