Skip to main content
NCBI home page
ACS Omega logoLink to ACS Omega
. 2026 Aug 18;11(34):50718–50731. doi: 10.1021/acsomega.5c12134

Des-O-Methyllasiodiplodin Isolated from Xanthostemon chrysanthus Ameliorates Inflammation by Regulating Autophagy

Jianv Wang †, Jixiang Xu †, Xun Yang †, Dengmei Xia †, Xia Xiong †, Ya Sun §, Hui Lei ‡,*, Li Liu †,*
PMCID: PMC13625165  PMID: 42819867

Abstract

Xanthostemon chrysanthus (F.Muell.) Benth. is a species from the Myrtaceae family with limited phytochemical and pharmacological studies. In this study, ten compounds (1–10) were isolated and purified from X. chrysanthus, among which compound 2, identified as des-O-methyllasiodiplodin (DML), exhibited the most potent anti-inflammatory activity. This is the first report of DML being isolated from this species. DML significantly inhibited lipopolysaccharide (LPS)-induced inflammation in RAW264.7 macrophages by reducing the expression of TNF-α, IL-1β, and IL-6, as well as nitric oxide (NO) and reactive oxygen species (ROS) production. Moreover, DML promoted autophagy by increasing LC3 II/LC3 I conversion and decreasing p62 expression, accompanied by suppression of the PI3K/AKT/mTOR signaling pathway. The autophagy inhibitor chloroquine (CQ) reversed these effects, confirming that DML exerts its anti-inflammatory action through autophagy activation. In a mouse ear edema model, DML effectively reduced inflammation, showing even greater efficacy than indomethacin. Collectively, this study provides the first evidence that DML isolated from X. chrysanthus exerts strong anti-inflammatory effects by promoting autophagy and modulation of the PI3K/AKT/mTOR pathway. These findings enrich the chemical and pharmacological understanding of X. chrysanthus and highlight DML as a promising natural candidate for the development of novel anti-inflammatory therapeutics.

graphic file with name ao5c12134_0011.webp

graphic file with name ao5c12134_0009.webp

Introduction

Inflammation is a defensive response of living tissues with vascular activity to damage factors. While a moderate inflammatory response helps to repair tissue damage, excessive inflammation can lead to various adverse effects. This may result in the degeneration and necrosis of tissues and organs, which could be life-threatening. , Inflammation is also involved in the pathogenesis of numerous chronic diseases, such as bronchitis, chronic obstructive pulmonary disease, ulcerative colitis, and arthritis. Increasing evidence shows that a pro-inflammatory microenvironment often triggers cancer development, suggesting a close relationship between cancer and inflammation. Therefore, early control of inflammation is crucial to preventing and treating various inflammation-related diseases.

Autophagy is an adaptive response of cells to metabolic stress and environmental changes. It primarily occurs through lysosome fusion and degradation of dysfunctional cell components to maintain intracellular homeostasis. The typical autophagy pathway converts the cytosolic form of microtubule-associated protein 1 light chain 3 (LC3 I) core protein to the autophagosome membrane-associated form (LC3 II) to assemble an autophagosome with engulfed intracellular material. In addition, the autophagy ligand nucleoporin 62 (p62) promotes the degradation of ubiquitin substrates through the interaction between ubiquitin-related domains and polyubiquitin proteins. Impaired autophagy is closely related to tumor pathogenesis, neurodegenerative, metabolism-related, and immune diseases. Moreover, normal autophagy protects the body from exogenous hazards, including infection or molecular aggregates of endogenous inflammatory sources, and is regulated by autophagy-related genes. It also inhibits the activation of inflammatory bodies, preventing the occurrence and development of inflammatory diseases. For example, Chen et al. found that pterostilbene reduces endoplasmic reticulum stress and promotes autophagy flux, improving colonic inflammation and barrier dysfunction. Similarly, Liu et al. reported that scoparone inhibits nonalcoholic steatohepatitis in mice by enhancing autophagy in macrophages. Recent data indicate a bidirectional regulation of autophagy and inflammation; autophagy regulates the inflammatory process, while it, in turn, regulates autophagy. Furthermore, enhanced autophagy promotes or aggravates the inflammatory response. For instance, Wu et al. reported that in the formation of atherosclerotic plaques, the increased expression of autophagy key proteins causes normal cell necrosis, plaque fiber cap thinning, and elevated expression of inflammatory factors, maintaining arteries in the inflammatory state and aggravating the atherosclerotic process. Therefore, a thorough understanding of the mechanism between autophagy and inflammation is crucial to effectively control the inflammatory response and substantially improve the therapeutic effect of inflammation-related diseases.

The clinical treatment of inflammation mainly consists of chemical drugs, including nonsteroidal anti-inflammatory drugs and glucocorticoids. However, these drugs often provoke various side effects, including cardiotoxicity, hepatotoxicity, and immune dysfunction. Many natural products and their structural analogues extracted from plants and fungi contribute to treating cancer, infectious diseases, and inflammation. However, the application of these products is limited because of the unresolved polypharmacology mechanism of action. Thus, isolating and extracting natural products with excellent anti-inflammatory activity and clarifying their mechanism of action are of great significance for developing new drugs to inhibit inflammation.

Xanthostemon chrysanthus (F.Muell.) Benth., commonly known as “Golden Penda,” is an evergreen tree belonging to the family Myrtaceae, notable for its spectacular golden-yellow flowers. In China, this species is primarily introduced and cultivated as an ornamental tree in provinces such as Fujian, Guangdong, and Taiwan. In recent years, researchers have gradually recognized its medicinal potential. For instance, Liu et al. isolated several compounds from X. chrysanthus, including cinnamoyl-phloroglucinols and xanchryones, which demonstrated promising anticancer, antibacterial, and anti-inflammatory activities through studies on their structural characteristics, biosynthetic pathways, and cytotoxic effects. Nevertheless, investigations on the chemical constituents and pharmacological properties of X. chrysanthus remain very limited. In the present study, ten compounds (1–10) were isolated and purified from X. chrysanthus. Based on in vitro activity screening and structural identification, compound 2 was identified as des-O-methyllasiodiplodin (DML), which exhibited the strongest anti-inflammatory activity among the isolated compounds. DML was first discovered from Cerbera manghas (Apocynaceae) and reported for its potential therapeutic effects against metabolic disorders such as obesity, diabetes, hyperlipidemia, and fatty liver. It was later detected in marine organisms, algae, and fungi, where it demonstrated biological activities against depression, kidney diseases, inflammation, and liver cancer. , However, the underlying anti-inflammatory mechanism of DML remains largely unexplored, particularly regarding whether its activity is associated with autophagy regulation.

To our knowledge, this study is the first to report the isolation of DML from X. chrysanthus. This finding not only expands the known chemical diversity of X. chrysanthus but also provides a new natural source of DML. Moreover, the anti-inflammatory activity of DML was systematically evaluated both in vitro and in vivo. In particular, we established a lipopolysaccharide (LPS)-induced inflammatory model in mouse macrophage RAW264.7 cells to assess its regulatory effects on pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6), reactive oxygen species (ROS), nitric oxide (NO), and autophagy-related proteins (LC3 and p62). The autophagy inhibitor chloroquine (CQ) was further employed to clarify whether DML exerts its anti-inflammatory effects through modulation of autophagy. Additionally, the anti-inflammatory efficacy of DML was verified in vivo using a mouse ear edema model. Collectively, this work not only elucidates the anti-inflammatory mechanism of DML and its potential link to autophagy regulation but also enriches the phytochemical and pharmacological understanding of X. chrysanthus. These findings provide a theoretical foundation for developing DML as a promising natural anti-inflammatory agent with well-defined pharmacological benefits and minimal side effects.

Results and Discussion

Structure of Compounds (1–10) Obtained from X. chrysanthus

Compounds 1–10 were isolated and purified from X. chrysanthus, and their chemical structures are shown in Figure . Their structures were assigned based on 1H and 13C nuclear magnetic resonance (NMR) spectroscopy, heteronuclear single quantum coherence (HSQC) experiments, and comparison with previously reported spectroscopic data. For DML, its absolute configuration was further assigned as 3R by comparison of the experimental circular dichroism (CD) spectrum with the calculated electronic circular dichroism (ECD) spectrum. The identified compounds, including DML, together with their supporting references, are summarized in Table S1, and the corresponding NMR spectra, HPLC purity profiles, and calculated/experimental ECD spectra are provided in Figures S1–S32.

1.

1

Open in a new tab

Structure of compounds (1–10) obtained from X. chrysanthus.

Screening of Anti-Inflammatory Effects of Compounds (1–10)

LPS activates multiple inflammatory signaling pathways to regulate the expression and release of inflammatory mediators and inflammation-related enzymes. The LPS-induced macrophage cell line RAW264.7 is commonly used for studying the inflammatory response of immune cells. Initially, to exclude the potential effects of LPS on cell viability, an MTT assay was performed, which determined that LPS had a negligible impact on cell viability at a concentration of 1 μg/mL (Figure A). Subsequently, the influence of compounds (1–10) on the mRNA expression of inflammatory cytokines TNF-α and IL-1β was evaluated using qRT-PCR analysis. The findings revealed that compound 2 (DML) exhibited the most potent anti-inflammatory activity (Figure B,C). Finally, the MTT assay showed that DML exhibited mild but statistically significant cytotoxicity at high concentrations (80 and 160 μM). Therefore, nontoxic concentrations of 10, 20, and 40 μM were selected for subsequent experiments (Figure D).

2.

2

Open in a new tab

Screening of anti-inflammatory effects of compounds (1–10). (A) Cell viability of LPS on RAW264.7 cells. Values represent the mean ± SD, n = 3. *p < 0.05, **p < 0.01, compared with the control group. The mRNA levels of TNF-α (B) and IL-1β (C) after being treated with 20 μM compounds (1–10) in RAW264.7 cells activated by LPS for 6 h. Values represent the mean ± SD, n = 3. *p < 0.05 and **p < 0.01, compared with the LPS group. (D) Cell viability of DML on RAW264.7 cells. Values represent the mean ± SD, n = 3. *p < 0.05, compared with the control group.

Anti-Inflammatory Effect of DML on LPS-Induced RAW264.7 Cells

Under normal circumstances, most RAW264.7 cells appear round and transparent, with minimal space separating them. However, when stimulated, they branch out, increasing the space between them and forming a large network of branching cells. We examined the effects of DML on the morphology of LPS-induced RAW264.7 cells under a microscope. Following LPS treatment, a higher number of RAW264.7 cells entered a differentiated state, displaying irregular shapes with extended protruding antennae (Figure A). Furthermore, the differentiation became more pronounced with prolonged treatment, and cell morphology did not significantly change with DML treatment alone. However, the number of differentiated cells significantly decreased with increasing DML concentrations during the combined DML and LPS treatment. These results indicated that DML could inhibit the differentiation of LPS-induced RAW264.7 cells in a concentration-dependent manner. During the inflammatory response, macrophages regulate immune functions by secreting various cytokines, such as TNF-α, IL-1β, and IL-6. To evaluate the anti-inflammatory effect of DML, we measured the mRNA expression of these cytokines under DML stimulation. The levels of all three cytokines increased significantly after inducing RAW264.7 cells with LPS but decreased in a concentration-dependent manner with DML treatment (Figure B,C). These data suggested that DML exerted an outstanding anti-inflammatory effect. Additionally, the effect observed after 6 h of DML treatment was more pronounced than after 12 h, reflecting its potential for the early control of acute inflammatory response.

3.

3

Open in a new tab

Anti-inflammatory effect of DML on LPS-induced RAW264.7 cells. (A) Photographs of RAW264.7 cells were pretreated with various concentrations of DML (10, 20, 40 μM) for 1 h and treated with LPS for an additional 6 or 12 h under optical microscopy. Scale bars, 10 μm. (B) The mRNA levels of TNF-α, IL-1β, and IL-6 after being treated with DML in RAW264.7 cells activated by LPS for 6 h. (C) The mRNA levels of TNF-α, IL-1β, and IL-6 after being treated with DML in RAW264.7 cells activated by LPS for 12 h. Values represent the mean ± SD, n = 3. *p < 0.05, ***p < 0.001, and ****p < 0.0001, compared with the LPS group.

Effect of DML on ROS and NO Production in LPS-Induced RAW264.7 Cells

NO and ROS are small active compounds with essential roles in cell breakdown, metabolism, and inflammation-related diseases and are also hallmark products of the inflammatory response. When RAW264.7 cells were stimulated with LPS, a strong fluorescence signal indicated elevated ROS production, which decreased significantly with increasing concentrations of DML (Figure A,B). A similar reduction was observed in NO production (Figure C,D), demonstrating that DML could inhibit ROS and NO production in inflammatory cells in a dose-dependent manner. To further investigate the effects of DML on ROS and NO in LPS-induced RAW264.7 cells, we quantified the protein levels of cyclooxygenase 2 (COX-2), a key regulator of ROS, and inducible nitric oxide synthase (iNOS), a core protein in NO production. We found that DML alone could reduce the expression of COX-2 and iNOS, and this trend was confirmed in the inflammatory-cell model. Under LPS treatment, COX-2 and iNOS levels were significantly upregulated compared to control cells. However, the addition of DML led to a concentration-dependent decrease in both proteins, reversing the LPS-induced upregulation (Figure E,F). In conclusion, these results indicate that DML has a strong anti-inflammatory effect in vitro, which warrants further exploration of its mechanism.

4.

4

Open in a new tab

Effect of DML on ROS and NO production in LPS-induced RAW264.7 cells. (A) Fluorescence imaging of ROS in RAW264.7 cells after LPS/DML addition. Scale bars, 100 μm. (B) Fluorescence statistics of (A). (C) Fluorescence imaging of NO in RAW264.7 cells after LPS/DML addition. Scale bars, 100 μm. (D) Fluorescence statistics of (C). The protein levels and statistical analysis of COX-2 (E) and iNOS (F) after LPS/DML addition. β-actin as an internal reference. Values represent the mean ± SD, n = 3. *p < 0.05, ***p < 0.001, and ****p < 0.0001, compared with the control group. # p < 0.05, ## p < 0.01, ### p < 0.001, and #### p < 0.001, compared with the LPS group.

Regulatory Effect of DML on Autophagy in LPS-Induced RAW264.7 Cells

Autophagy and inflammation have a close relationship; autophagy relieves the inflammatory response by removing damaged organelles and inhibiting the formation of pro-inflammatory complexes. We evaluated autophagy-related indicators with different methods to clarify whether autophagy is involved in the mechanism by which DML inhibits the inflammatory response of LPS-stimulated RAW264.7 cells. To detect autophagy, we used a monodansylcadaverine (MDC) fluorescent probe that can specifically label autophagosomes through ion capture and specific binding to membrane lipids. Treating RAW264.7 cells with DML promoted the production of autophagosomes, resulting in enhanced fluorescence, while inducing them with LPS caused decreased fluorescence. Moreover, the fluorescence intensity of autophagy in the cells gradually increased with rising DML concentrations under LPS treatment, implying that DML promotes autophagy and reverses the LPS-mediated effect on autophagy (Figure A,B). An elevated autophagosome production does not indicate an increase in autophagy flux since it also increases when autophagosome clearance is inhibited. , Autophagy inhibitor CQ is a late-stage autophagy inhibitor that represses autophagy flux by preventing the fusion of autophagosomes with lysosomes and inhibiting autolysosomal degradation. We chose CQ to explore which specific stage of autophagy is affected by DML. The fluorescence of autophagosomes in all CQ-treated cells was significantly higher than that in the CQ-untreated cells (Figure A,B). The comparison of CQ-treated cells showed the same trend as in the previous experiment: LPS inhibited autophagosome formation, while DML did the opposite and reversed the LPS-mediated autophagosome reduction. Subsequently, we explored the regulatory role of DML on autophagy by detecting the expression of key autophagy markers LC3 and p62. The LC3B mRNA was downregulated under LPS treatment, but gradually, its levels rose under increasing DML concentrations and were completely recovered at 40 μM DML (Figure C). As an autophagy aptamer, p62 is responsible for protein recruitment for degradation; the more autophagy occurs, the less p62 is expressed. Indeed, the significant increase in p62 expression under LPS induction indicated inhibited autophagy, while decreased p62 expression on DML suggested promoted autophagy (Figure D). Finally, we examined the LC3 and p62 protein expression. The autophagy core protein LC3 is mainly present in the LC3 I form, and when autophagy is activated, the protein converts to the LC3 II form. The protein levels of LC3 II/LC3 I and p62 were consistent with the mRNA levels, and DML reversed the effects of LPS on them (Figure E,F). Similarly, LC3, a key protein in autophagosome formation, was induced when autophagy was inhibited in the late stage, while p62 was normally upregulated under CQ treatment. The observed autophagosome accumulation and the corresponding increase in LC3 II due to impaired autolysosome degradation are considered autophagy abnormalities rather than autophagy activation. Thus, we believe that the CQ-induced rise in LC3 II observed in this study is a manifestation of autophagy abnormalities, whereas the DML produced increase in LC3 II represents autophagy activation. Interestingly, we found that DML could still promote LC3 expression and reduce p62 expression based on the CQ effect, indicating that DML likely affects early autophagy (i.e., autophagosome formation). Altogether, our findings reinforce the necessity for elucidating the DML-specific mechanism of action. Importantly, our results demonstrate that LPS stimulation inhibits autophagy, while DML reverses this effect and activates autophagy.

5.

5

Open in a new tab

Regulatory effect of DML on autophagy in LPS-induced RAW264.7 cells. (A) Autophagosomes were determined by MDC staining under a confocal microscope. Scale bars, 25 μm. (B) The fluorescence intensity of autophagosomes by MDC staining per image in (A). The mRNA expression of LC3 B (C) and p62 (D). (E) LC3 I, LC3 II, and p62 protein levels. Internal reference was β-actin. (F) The statistical analysis of LC3 II/LC3 I and p62. Values represent the mean ± SD, n = 3. *p < 0.05, **p < 0.01, and ***P < 0.001, compared with the control group. # p < 0.05 and ## p < 0.01, compared with the LPS group. § p < 0.05, §§§ p < 0.001, and §§§§ p < 0.0001, compared with the CQ group. @ p < 0.05 and @@@ p < 0.001, compared with the CQ + LPS group.

CQ Attenuated the Anti-Inflammatory Effect of DML in LPS-Induced RAW264.7 Cells

We showed that DML exerts a good anti-inflammatory effect on RAW264.7 cells and promotes autophagy to reverse the LPS-induced inhibitory effect on autophagy. We used the CQ inhibitor to reverse verify whether DML improves the inflammatory response by promoting autophagy. DML significantly reduced the expression of TNF-α, IL-1β, and IL-6 mRNA induced by LPS, while CQ pretreatment significantly inhibited this effect and showed an evident rebound (Figure A–C). In addition, we also examined the changes in ROS and NO levels in the cells. We uncovered that DML significantly inhibited ROS and NO production elevated by LPS stimulation, and this inhibitory effect was attenuated after CQ treatment (Figure D,E). These results suggest that CQ, as a late-stage autophagy inhibitor, does not suppress DML-induced autophagic signaling but attenuates its anti-inflammatory effect. This observation is consistent with the possibility that DML acts at or upstream of autophagosome formation, such as during the conversion of LC3-I to LC3-II, a step that is not directly targeted by CQ. Under normal conditions, the autophagosome and lysosome combine to form an autolysosome and degrade substrates recruited by p62. As an autolysosome inhibitor, CQ blocks autophagy in the late stage but does not affect the role of DML in promoting early autophagosome formation. A complete autophagy process is essential for DML to exert anti-inflammatory effects. Therefore, we observed that under CQ treatment, DML still promoted LC3 II expression, while suppressing the anti-inflammatory effect of DML. Although our study provides novel insights into the anti-inflammatory effects of DML and its regulation of autophagy, several limitations should be acknowledged. Specifically, early stage autophagy inhibitors and markers of autophagy initiation were not assessed, and thus, the precise stage of autophagy affected by DML was not fully defined. In addition, autophagic flux was evaluated indirectly. Nevertheless, the integration of molecular and functional data collectively supports the notion that DML modulates autophagy to exert its anti-inflammatory effects. Future studies incorporating these approaches would help to further elucidate the precise mechanisms underlying DML’s actions and strengthen the mechanistic conclusions. Overall, our findings suggest that DML alleviates inflammation at least through the promotion of autophagy.

6.

6

Open in a new tab

CQ attenuated the anti-inflammatory effect of DML in LPS-induced RAW264.7 cells. The mRNA levels of TNF-α (A), IL-1β (B), and IL-6 (C) after 40 μM DML treatment/20 μM CQ treatment in RAW264.7 cells activated by LPS for 6 h. Fluorescence imaging of ROS (D) and NO (E) in RAW264.7 cells after 40 μM DML treatment/20 μM CQ treatment in RAW264.7 cells activated by LPS for 6 h. Statistical analysis of the fluorescence signals. Scale bars, 100 μm. Values represent the mean ± SD, n = 3. ***p < 0.001 and ****p < 0.0001, compared with the LPS group. # p < 0.05, ## p < 0.01, ### p < 0.001, and #### p < 0.0001, compared with the LPS + DML group.

DML-Regulated PI3K/AKT/mTOR Pathway in LPS-Induced RAW264.7 Cells

The mammalian target of rapamycin (mTOR) is a central upstream negative regulator of autophagy. It prevents autophagy initiation, autophagosome formation, and autolysosome function. The phosphoinositide-3-kinase (PI3K) and protein kinase B (AKT) (PI3K/AKT) signaling pathway is the upstream regulator of mTOR that integrates signaling pathways from the cellular environment and regulates autophagy. In short, the PI3K/AKT/mTOR signaling pathway axis is involved in autophagy initiation and regulation, and inhibiting this pathway promotes autophagy. We evaluated whether DML regulates autophagy, which is associated with the PI3K/AKT/mTOR pathway, by determining the expression levels of PI3K, AKT, and mTOR proteins with Western blotting. After treating RAW264.7 cells with DML/LPS, we discovered that LPS treatment significantly enhanced the levels of all 3 phosphorylated proteins in the treated cells versus the control cells (Figure A–C). Remarkably, DML reversed this effect and downregulated the expression of the phosphorylated proteins. Although p-PI3K did not decrease in a strictly dose-dependent manner after DML treatment, its level remained lower than that in the LPS group. Given the transient and dynamic regulation of upstream PI3K phosphorylation, the more consistent decreases in downstream p-AKT and p-mTOR better reflect the suppression of the PI3K/AKT/mTOR axis, supporting its involvement in DML-associated autophagy regulation. Taken together, these results suggest that DML promotes autophagy, which may be associated with the inhibition of the PI3K/AKT/mTOR pathway, thereby contributing to its anti-inflammatory effects.

7.

7

Open in a new tab

DML-regulated PI3K/AKT/mTOR pathway in LPS-induced RAW264.7 cells. Protein levels and statistical analysis of PI3K, p-PI3K (A), AKT, p-AKT (B), and mTOR, p-mTOR (C) in RAW264.7 cell samples of each group were analyzed by Western blotting. GAPDH as an internal reference. Values represent the mean ± SD, n = 3. *p < 0.05, **p < 0.01, and ***p < 0.001, compared with the control group. # p < 0.05, ## p < 0.01, and ### p < 0.001, compared with the LPS group.

DML Ameliorated TPA-Induced Ear Inflammation in Mice

The mouse ear edema model is widely used to evaluate anti-inflammatory activity in vivo due to its cost-effectiveness, ease of operation, simplicity in measurement, and stability. TPA-induced edema is a well-established model of acute inflammation, allowing assessment of early phase inflammatory responses. In this study, DML was administered 0.5 h after TPA treatment, and edema was measured at 6 h (Figure A), corresponding to the reported peak of inflammation. This design enabled accurate evaluation of DML’s inhibitory effects on early inflammatory events and provided insight into its early therapeutic potential. Indomethacin (Indo), a cytochrome c oxidase (COX) inhibitor, served as a positive control in the experiment. We first measured the inhibitory effect of the drugs on inflammation by comparing the thickness and weight of mouse ear biopsies before and after treatment (Figure C,D). The results indicated that TPA stimulation increased ear thickness and weight in the treated group compared to the Blank group. DML treatment reduced ear thickening and weight, with a greater reduction observed than in the TPA+Indo group. We also performed H&E staining on the treated ear biopsies to evaluate the anti-inflammatory effect of DML by examining histological changes in the ear tissue. The staining revealed significant edema of the ear dermis and numerous inflammatory cells in the LPS-treated group (Figure B). In contrast, DML significantly attenuated the edema and reduced the number of inflammatory cells. Given the role of COX-2, a key enzyme in prostaglandin biosynthesis and many inflammatory processes, we quantified its expression in ear tissue using immunohistochemistry. Our results confirmed that LPS markedly elevated COX-2 levels, inducing inflammation, while DML produced the opposite effect (Figure E,F). Finally, we assessed the mRNA expression of TNF-α and IL-1β in the ear tissue. The results showed that LPS increased the mRNA levels of both inflammatory factors, whereas DML significantly reduced them, demonstrating its anti-inflammatory effect (Figure G,H). In conclusion, these findings demonstrate that DML effectively ameliorates ear edema and has a strong anti-inflammatory effect in vivo.

8.

8

Open in a new tab

DML ameliorated TPA-induced ear inflammation in mice. (A) Scheme showing the experimental design of the mouse ear edema model. (B) Representative images of hematoxylin-eosin-stained mouse ear sections from 6 cohort groups. Scale bars, 50 μm (up), 20 μm (down). Ear thickness (C) and weight (D) in mice in different cohort groups were recorded and compared. Each dot represents one mouse. Data are presented as mean ± SD. Sample sizes (n) correspond to the number of individual data points shown for each group. * p < 0.05, ** p < 0.01, *** p < 0.001. (E) Immunohistochemical staining of COX-2 protein in the sectioned ears. Scale bars, 50 μm (up) and 20 μm (down). (F) COX-2 positive staining (% of total cells) statistics. Relative levels of TNF-α (G) and IL-1β (H) mRNA in mouse ear determined by qRT-PCR. Values represent the mean ± SD, n = 3. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Conclusions

In this study, we successfully isolated and purified ten compounds (1–10) from X. chrysanthus, with DML being identified as the compound with the most potent anti-inflammatory activity through in vitro screening. This research is groundbreaking as it marks the first instance of DML being isolated from this abundant and prolific species, as well as the first detailed exploration of the mechanisms by which DML regulates autophagy and inhibits inflammation. Utilizing both in vivo and in vitro inflammation models, we demonstrated that DML effectively suppresses the expression of key inflammatory cytokines such as TNF-α, IL-1β, and IL-6, and reduces the production of ROS and NO. Additionally, DML counteracts LPS-induced inhibition of autophagy and enhances autophagy flux. Our findings also indicate that DML inhibits the phosphorylation of critical upstream proteins involved in autophagy, specifically PI3K, AKT, and mTOR. Notably, the anti-inflammatory efficacy of DML is significantly diminished when cotreated with CQ, suggesting that DML’s regulatory effects on autophagy and modulation of the PI3K/AKT/mTOR pathway play a crucial role in its ability to alleviate inflammation. In summary, this study provides compelling evidence for the therapeutic potential of DML and offers new insights into the intricate relationship between inflammation and autophagy.

Experimental Section

Chemical and Biological Materials

Dulbecco’s modified Eagle’s medium was purchased from Gibco (Grand Island, NY, United States); fetal bovine serum (FBS) was purchased from BasalMedia (Shanghai, China); and trypsin-EDTA, penicillin–streptomycin, cisplatin, PMSF, and crystal violet staining solution were supplied by Solarbio (Shanghai, China). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), Indomethacin, and Hoechst 33342 were purchased from YuanYe Bio-Technology (Shanghai, China). Chloroquine (CQ, purity >99%) was purchased from Aladdin (Shanghai, China). Lipopolysaccharide (LPS) from Escherichia coli 0111:B4 (Sigma-Aldrich, USA). 12-O-Tetradecanoyl-Phorbol-13-Acetate (TPA) was from ACMEC (Shanghai, China). The universal SP kit (mouse/rabbit streptavidin–biotin detection system) and DAB kit were purchased from Zsbio (Beijing, China). Reactive Oxygen Species Assay Kit, DAF-FM DA probe, Autophagy Staining Assay Kit with MDC, RIPA lysate buffer, BCA protein determination kit, and All-purpose Powerful Antigen Retrieval Solution were from Beyotime Institute of Biotechnology (Shanghai, China). Protein Loading Buffer, Multicolor Prestained Protein Ladder, and 10% SDS-PAGE and Rapid Blocking Solution were from EpiZyme (Shanghai, China). The PVDF membrane was from MILLIPORE (Bedford, MA, USA). RNA-Easy Isolation Reagent, HiScript III RT SuperMix for qPCR (+gDNA wiper), and Taq Pro Universal SYBR qPCR Master Mix were purchased from Invitrogen Technologies Company (Carlsbad, CA, USA).

Antibodies against COX-2, iNOS, mTOR, and Phospho-mTOR (Ser2448) were purchased from the Beyotime Institute of Biotechnology (Shanghai, China). Antibodies against LC3A/B, p62, and PI3K were purchased from Cell Signaling Technology (CST, Beverly, MA, USA). Phospho-PI3K (Y607) was purchased from Abcam (Cambridge, UK). β-actin, GAPDH, AKT, Phospho-AKT (Ser473), and secondary antibodies, goat anti-mouse Ig-HRP, goat anti-rabbit Ig-HRP, were purchased from Zen Bioscience (Chengdu, China).

Plant Material

The fresh branches of X. chrysanthus were collected in Jieyang City, Guangdong province of P.R. China, in September 2020, which were identified as X. chrysanthus from the aspects of plant characteristics and microscopic characteristics by Prof. Pixian Shui (Southwest Medical University). A voucher specimen (no.202009swmu06) was stored in the herbarium of the Chinese Pharmacy, School of Pharmacy, Southwest Medical University. The plant name X. chrysanthus (F.Muell.) Benth. has been checked with http://www.worldfloraonline.org.

Isolation and Purification of DML from X. chrysanthus

The fresh branches and leaves from X. chrysanthus were dried, crushed with a grinder, and the medicinal powder was extracted by cold soaking with 95% ethanol solution. The extraction process was performed 4 times, with each soak lasting 10 days. After being stirred once a day during the soaking period, the extract was reduced under pressure and concentrated to obtain the crude extract of X. chrysanthus. Then, the crude extract was dissolved in water and extracted with ethyl acetate to obtain the ethyl acetate extract part of X. chrysanthus. The MCI column was loaded with the extract dissolved in 20% methanol and eluted with pure water, 30% methanol, 60% methanol, and pure methanol. Each gradient flow fraction was collected and concentrated under reduced pressure. After that, a total of 6 samples (Fr.1-Fr.6) were obtained. Fr.2 was separated using silica gel (300–400 mesh) CC and eluted with a petroleum ether/EtOAc gradient (30:1 to 20:1) to yield five fractions (Fr.2–1 to Fr.2–5). Fr.2.2 was separated by preparative TLC to obtain compound 7 (15.5 mg). Compound 8 (20.0 mg) was purified by silica gel CC (CH2Cl2/MeOH gradient) (30:1 to 1:1). Fr.2.3 was subjected to preparative TLC with CH2Cl2/MeOH (10:1) to obtain compound 10 (8.0 mg). Compound 1 (24.1 mg) was obtained by preparative TLC (3:1). Purification of Fr.3 by preparative TLC with petroleum ether:acetone (3:1) yielded compounds 3 (27.0 mg) and 4 (10 mg). Fr.4 was further separated using silica gel (500–800 mesh) CC (30:1–1:1) to yield 3 subfractions. Frs.4.2 were further separated by semipreparative HPLC (MeOH/H2O) to afford compound 6 (46.1 mg). Fr.5 was obtained by repeated silica column isolation (Fr.5.1-Fr.5.2). Fr.5.2 was separated by thin-layer preparative chromatography, and the final product compound 2 (DML, 8.8 mg) was prepared by scraping the plate with petroleum ether:acetone (2:1) as the development agent. Fr.6 was separated by repeated silica gel CC and preparative TLC to yield compound 5 (5.1 mg) and compound 9 (33.9 mg).

Structural Characterization of DML

Des-O-methyllasiodiplodin (DML): Colorless crystal, C16H22O4, and purity in the study was more than 95%. 1H NMR (400 MHz, CDCl3), δH 11.99 (1H, s, 2-OH), 6.28 (1H, d, J = 2.6 Hz, H-5), 6.23 (1H, d, J = 2.6 Hz, H-3), 5.25–5.09 (1H, m, H-14), 3.27 (1H, dt, J = 12.5, 7.4 Hz, H-7α), 2.50 (1H, td, J = 11.8, 5.9 Hz, H-7β), 1.83–1.73 (2H, m, H2-13), 1.72–1.39 (2H, m, H2-9), 1.72–1.39 (2H, m, H2-10), 1.72–1.39 (2H, m, H2-11), 1.72–1.39 (2H, m, H2-12), 1.36 (3H, d, J = 6.2 Hz, H3-15). 13C NMR (100 MHz, CDCl3), δC 105.43 (C-1), 160.18 (C-2), 101.33 (C-3), 165.34 (C-4), 110.79 (C-5), 149.41 (C-6), 33.51 (C-7), 30.75 (C-8), 27.22 (C-9), 24.68 (C-10), 24.08 (C-11), 21.12 (C-12), 31.04 (C-13), 75.13 (C-14), 20.10 (C-15), 171.87 (C-16).

Cell Culture

Mouse macrophage RAW264.7 cells were obtained from ATCC (Manassas, VA, USA) and cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum and 1% penicillin/streptomycin, with an atmosphere of 5% CO2 at 37 °C. The cultures were kept in logarithmic growth phase and passaged at least 3 times within 1 week.

Cell Viability Assay

RAW264.7 cells in the logarithmic growth phase were seeded in a 96-well plate. Once the cells adhered to the plate, various concentrations of LPS (0, 0.063, 0.125, 0.25, 0.5, 1, 2, 4, 8, 16 μg/mL) or DML (0, 0.63, 1.25, 2.5, 5, 10, 20, 40, 80, 160 μM) were added for 24 h. After that, 20 μL of MTT (5 mg/mL) was added and the cells were further incubated for 2 h at 37 °C. The supernatant was then removed, and 200 μL of DMSO was added and shaken for 10 min to mix. The OD value was detected using the microplate tester (Spectra MAX 340, Molecular Devices, USA) at 490 nm. The formula for calculating cell viability is as follows: cell viability (%) = (ODtreatment /ODcontrol) × 100%.

Cell Morphological Observation

In order to better understand the changes in RAW264.7 cells, the cells were inoculated in 6-well plates and incubated overnight, and pretreated with DML for 1 h and LPS for an additional 6 or 12 h. Then, the cells were observed and photographed under an optical microscope (Leica DMi8, Germany).

Quantitative Real-Time PCR (qRT-PCR)

RAW264.7 cells (1 × 105 cells/well) were inoculated into 6-well plates in each well, and were divided into six groups (Control, DML, LPS, LPS+10 μM DML, LPS+20 μM DML, and LPS+40 μM DML) after the cells were attached to the wall. Total RNA was extracted at different times (6 h, 12 h), and qRT-PCR was used to detect the mRNA expression changes of TNF-α, IL-1β, and IL-6. For the autophagy inhibitor CQ-treated groups, RAW264.7 cells were first treated with 20 μM CQ for 2 h, then 40 μM DML was added directly for 1 h, and LPS (1 μg/mL) was finally added for 6 h. In short, according to the manufacturer’s instructions, total RNA in each group of cells was extracted using RNA extraction and separation reagents, and then RNA was further reverse-transcribed into cDNA by reverse transcription kit (HiScript III RT SuperMix for qPCR). Finally, qRT-PCR was performed using the Taq Pro Universal SYBR qPCR Master Mix on the ABI Q5 RT-PCR System (Applied Biosystems, Thermo Fisher Scientific, Inc., Waltham, MA, USA). The relative number of target genes was calculated from three duplicate samples, and data were analyzed by the 2–ΔΔCT method using ABI 7500 software version 2.03 (Applied Biosystems). The specific primers of genes were designed using the Pick primers function of NCBI, as shown in the Table .

1. Primer Sequences for the qRT-PCR Assay.

primer Name sequence (5′-3′)
β-actin-F CGGTTCCGATGCCCTGAGGCTCTT
β-actin-R CGTCACACTTCATGATGGAATTGA
GAPDH-F GCAAATTCCATGGCACCGT
GAPDH-R TCGCCCCACTTGATTTTGG
LC3B–F GCCTTCTTCCTCCTGGTGAATGG
LC3B-R ATTGCTGTCCCGAATGTCTCCTG
P62–F TTCTGGGCCAATCGTTTAAATG
P62-R ATGCTGCAGAAATACCAACATC
TNF-α-F TGCCTATGTCTCAGCCTCTTC
TNF-α-R GAGGCCATTTGGGAACTTCT
IL-1β-F ATGAAAGACGGCACACCCAC
IL-1β-R CTGCTTGTGAGGTGCTGATG
IL-6-F AGCCAGAGTCCTTCAGAGAGA
IL-6-R TGGTCTTGGTCCTTAGCCAC
Open in a new tab

ROS and NO Detection Assays

Dichloro-dihydro-fluorescein diacetate (DCFH-DA) and 4-Amino-5-methylamino-2′,7′-difluorofluorescein (DAF-FM) are fluorescent probes commonly used for detecting cellular ROS and NO. When cells produce ROS, it oxidizes nonfluorescent DCFH to fluorescent DCF. Similarly, when they release NO, it reacts with DAF-FM, enhancing its fluorescence. Appropriate amount of RAW264.7 cells were inoculated in 6-well plates and incubated overnight. The experimental groups were pretreated with different concentrations of DML (10, 20, 40 μM) for 1 h, and then treated with LPS (1 μg/mL) for 6 h. For the autophagy inhibitor CQ-treated groups, RAW264.7 cells were first treated with 20 μM CQ for 2 h, then 40 μM DML was added directly for 1 h, and LPS (1 μg/mL) was finally added for 6 h. According to the manufacturer’s instructions, 10 μM DCFH-DA or 5 μM DAF-FM DA was added to each well and incubated at 37 °C for 20 min. After washing with PBS, 10 μg/mL Hoechst 33342 was added and incubated for 10 min before being placed under an inverted fluorescence microscope for imaging (Leica DMi8, Leica, Germany).

Western Blotting

The Western blotting standard method was used to detect the expression levels of various proteins. In short, the total protein obtained by RIPA lysate buffer (containing 10% PMSF) was quantified according to the BCA protein quantification kit and then loading buffer was added for boiling denaturation. 6–12% SDS-PAGE was prepared for separating proteins, and then it was transferred to the PVDF membrane at 4 °C. After incubation with rapid blocking solution for 20 min, the PVDF membrane was incubated with the primary antibody dilution at 4 °C overnight. The next day, the secondary antibody was added for incubating at room temperature for 1.5 h. Finally, proteins were detected with ECL chemiluminescence solution at UVP ChemStudio PLUS (Analytikjena), and quantification was performed with ImageJ software.

Monodansylcadaverine (MDC) Assay

RAW264.7 cells (1 × 105 cells/well) were inoculated into 6-well plates, and the experimental group was pretreated with DML (10, 20, 40 μM) for 1 h, and then treated with LPS (1 μg/mL) for 6 h. For the autophagy inhibitor CQ-treated groups, RAW264.7 cells were first treated with 20 μM CQ for 2 h, then 40 μM DML was added directly for 1 h, and LPS (1 μg/mL) was finally added for 6 h. The MDC autophagy assay kit was used according to the manufacturer’s instructions: 1 mL of 1× MDC was added to each well and incubated at 37 °C for 30 min. After washing with PBS, 10 μg/mL Hoechst 33342 was added and incubated for 10 min for imaging under a confocal laser microscope (Leica DMi8, Leica, Germany).

TPA-Induced Mouse Ear Edema Model

The TPA-induced ear edema model was referred to previous reports. In this experiment, 6–8 week-old C57BL/6J female mice were purchased from Southwest Medical University Animal Experimental Center. And the mice were randomly divided into 6 groups (Blank, TPA+Vehicle, TPA+Indo, TAP+DML (L), TAP+DML­(M), and TAP+DML­(H)) with 4–6 mice in each group. Blank represents the untreated group (just with neat DMSO); TPA+Vehicle represents the group treated with 2.5 μg/ear TPA and neat DMSO (vehicle); TPA+Indo represents the group with TPA stimulation and 0.5 mg/ear Indo treatment (Indo was used as the positive control, indomethacin); and TAP+DML (L), TAP+DML­(M), and TAP+DML­(H) represents the group with TPA stimulation and 0.025 mg/ear, 0.05 mg/ear, 0.1 mg/ear DML treatment, respectively. Considering the irritation of mouse skin by the amount of DMSO solvent and the solubility of DML, the highest concentration of 0.1 mg/ear DML was chosen to treat mice under the existing conditions. The specific method was as follows: First, the mice were anesthetized with ether, and 20 μL of TPA (2.5 μg/ear) was applied to the inner and outer surfaces of the left ear of each group, while the blank group was given an equal amount of DMSO. After 30 min, each group was given 20 μL of Indo 0.5 mg/ear or DML 0.1 mg/ear, respectively. After an additional 3 h, each group received a second treatment. After an additional 3 h, the mice were sacrificed with cervical dislocation. Lastly, ear tissue was taken by an 8 mm perforator, and the thickness and weight of the ear biopsies were measured and recorded. The effect of drugs on inflammation could be assessed by the difference in ear thickness and weight before and after ear swelling in mice (for each mouse, normalization was carried out by subtracting the thickness and weight of the other untreated mouse ear from those of the treated ear). More than 3 ear biopsies were collected from each group and stored at −80 °C. RNA was extracted from the tissues after freezing them with liquid nitrogen and grinding them into powder for a qRT-PCR gene expression assay. All animal procedures have been approved by the Laboratory Animal Management Committee of Southwest Medical University in China, with ethical approval provided on August 28, 2023, Permit Number 20230828–001. All procedures were conducted in accordance with the Chinese National Laboratory Animal-Guideline for Ethical Review of Animal Welfare.

Hematoxylin and Eosin (H&E)

Mice ear biopsies were fixed with 10% neutral formalin. After dehydration with the different concentration gradients of ethanol, the slices were embedded with paraffin and cut using a Leica RM2125 microtome with a thickness of 4 μm. They were then stained with hematoxylin and eosin and sealed with a neutral resin. Finally, the images were captured on the Olin BX43 vertical microscope.

Immunohistochemical Examination

The obtained ear tissue section of 4 μm thickness was placed in the antigenic repair solution and heated at 95 °C for 20 min. Then, according to the manufacturer’s instructions, the universal SP kit (mouse/rabbit streptavidin–biotin detection system) and the primary antibody (COX-2) were added, respectively, to tissue slides. Finally, the DAB kit was used to expose positive protein expression. The images were captured on the Olin BX43 vertical microscope.

Statistical Analysis

At least 3 independent experiments were conducted for each experiment, and the data were expressed as mean ± SD values; p < 0.05 was considered statistically significant. Either an unpaired Student t-test or one-way analysis of variance was used for statistical analysis, and GraphPad Prism 9.0 was used to evaluate the statistical significance.

Supplementary Material

ao5c12134_si_001.pdf (1MB, pdf)

Acknowledgments

We thank Figdraw (www.Figdraw.com) for providing the software tools that assisted us in preparing the Graphical Abstract. All figures and artwork were independently created by the authors. We also thank Bullet Edits Limited for the linguistic editing and proofreading of the manuscript.

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.5c12134.

  • Lists the identified compounds isolated from X. chrysanthus and their supporting references (Table S1); 1H and 13C NMR spectra, HSQC spectra, HPLC analysis, and calculated/experimental ECD spectra of compounds 1–10 isolated and purified from X. chrysanthus (Figures S1–S32) (PDF)

∥.

J.W. and J.X. contributed equally to this work. J.W. and J.X.: Formal analysis, methodology, writingoriginal draft, and writingreview and editing. X.Y.: Methodology and data curation. D.X.: Methodology and software. X.X.: Methodology. Y.S.: Funding acquisition and methodology. H.L.: Funding acquisition, formal analysis, methodology, project administration, and supervision. L.L.: Funding acquisition, conceptualization, project administration, and writingreview and editing. All authors have read and approved the final manuscript, and therefore, have full access to all of the data in the study and take responsibility for the integrity and security of the data.

This work was supported by the Sichuan Science and Technology Program (2024NSFSC1628, 2022YFS0624), the National Innovation and Entrepreneurship Program for College Students (S202310632190), and the Scientific Research Program funded by Shaanxi Provincial Education Department (22JS039).

The authors declare no competing financial interest.

References

  1. Trivedi S., Labuz D., Anderson C. P., Araujo C. V., Blair A., Middleton E. A., Jensen O., Tran A., Mulvey M. A., Campbell R. A., Hale J. S., Rondina M. T., Leung D. T.. Mucosal-associated invariant T (MAIT) cells mediate protective host responses in sepsis. eLife. 2020;9:e55615. doi: 10.7554/eLife.55615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Zhai Z., Ouyang W., Yao Y., Zhang Y., Zhang H., Xu F., Gao C.. Dexamethasone-loaded ROS-responsive poly­(thioketal) nanoparticles suppress inflammation and oxidative stress of acute lung injury. Bioact. Mater. 2022;14:430–442. doi: 10.1016/j.bioactmat.2022.01.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Zhou B., Liu J., Wang Y., Wu F., Wang C., Wang C., Liu J., Li P.. Protective effect of ethyl rosmarinate against ulcerative colitis in mice based on untargeted metabolomics. Int. J. Mol. Sci. 2022;23(3):1256. doi: 10.3390/ijms23031256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chung C., Seo W., Silwal P., Jo E. K.. Crosstalks between inflammasome and autophagy in cancer. J. Hematol. Oncol. 2020;13(1):100. doi: 10.1186/s13045-020-00936-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao Y., Chen J., Ren G., Zhang Y., Tan X., Yang L.. Punicalagin prevents inflammation in lps-induced raw264.7 macrophages by inhibiting foxo3a/autophagy signaling pathway. Nutrients. 2019;11(11):2794. doi: 10.3390/nu11112794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Liu Z., Wang H., Sun C., He Y., Xia T., Wang J., Xiong X., Zhang Q., Yang S., Liu L.. ZWZ-3, a fluorescent probe targeting mitochondria for melanoma imaging and therapy. Front. Pharmacol. 2022;13:829684. doi: 10.3389/fphar.2022.829684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Jiang J., Tang Q., Gong J., Jiang W., Chen Y., Zhou Q., Aldeen A., Wang S., Li C., Lv W., Du T., Wang X., Long X., Feng X.. Radiosensitizer exo-mir-197–3p inhibits nasopharyngeal carcinoma progression and radioresistance by regulating the akt/mtor axis and hspa5-mediated autophagy. Int. J. Biol. Sci. 2022;18(5):1878–1895. doi: 10.7150/ijbs.69934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Deretic V.. Autophagy in inflammation, infection, and immunometabolism. Immunity. 2021;54(3):437–453. doi: 10.1016/j.immuni.2021.01.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen Y., Zhang H., Li Y., Ji S., Jia P., Wang T.. Pterostilbene attenuates intrauterine growth retardation-induced colon inflammation in piglets by modulating endoplasmic reticulum stress and autophagy. J. Anim. Sci. Biotechnol. 2022;13(1):125. doi: 10.1186/s40104-022-00780-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Liu B., Deng X., Jiang Q., Li G., Zhang J., Zhang N., Xin S., Xu K.. Scoparone improves hepatic inflammation and autophagy in mice with nonalcoholic steatohepatitis by regulating the ROS/P38/Nrf2 axis and PI3K/AKT/mTOR pathway in macrophages. Biomed. Pharmacother. 2020;125:109895. doi: 10.1016/j.biopha.2020.109895. [DOI] [PubMed] [Google Scholar]
  11. Wen J.-H., Li D., Liang S., Yang C., Tang J., Liu H.. Macrophage autophagy in macrophage polarization, chronic inflammation and organ fibrosis. Front. Immunol. 2022;13:946832. doi: 10.3389/fimmu.2022.946832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Wu H., Song A., Hu W., Dai M.. The anti-atherosclerotic effect of paeonol against vascular smooth muscle cell proliferation by up-regulation of autophagy via the ampk/mtor signaling pathway. Front. Pharmacol. 2018;8:948. doi: 10.3389/fphar.2017.00948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. El-Dershaby N. H., El-Hawash S. A., Kassab S. E., Daabees H. G., Abdel M. A., El-Miligy M.. Rational design and synthesis of new selective cox-2 inhibitors with in vivo pge2-lowering activity by tethering benzenesulfonamide and 1,2,3-triazole pharmacophores to some nsaids. Pharmaceuticals. 2022;15(10):1165. doi: 10.3390/ph15101165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Zhang T., Ouyang Z., Zhang Y., Sun H., Kong L., Xu Q., Qu J., Sun Y.. Marine natural products in inflammation-related diseases: Opportunities and challenges. Med. Res. Rev. 2025;45(5):1375–1406. doi: 10.1002/med.22109. [DOI] [PubMed] [Google Scholar]
  15. Nazarudin M. R. A., Tsan F. Y., Normaniza O., Adzmi Y.. Phenological growth stages of the golden penda tree (Xanthostemon chrysanthus) Ann. Appl. Biol. 2012;161(1):12–15. doi: 10.1111/j.1744-7348.2012.00546.x. [DOI] [Google Scholar]
  16. Zhang P., Shang X., Gao L., Zhang G., Fang L.. Research Status of Xanthostemon chrysanthus and Prospect for Development and Utilization. Eucalypt Sci. Technol. 2020;37(4):60–64. doi: 10.13987/j.cnki.askj.2020.04.09. [DOI] [Google Scholar]
  17. Liu F., Lu W. J., Li N. P., Liu J. W., He J., Ye W. C., Wang L.. Four new cinnamoyl-phloroglucinols from the leaves of Xanthostemon chrysanthus . Fitoterapia. 2018;128:93–96. doi: 10.1016/j.fitote.2018.05.017. [DOI] [PubMed] [Google Scholar]
  18. Liu F., Tian H. Y., Huang X. L., Wang W. J., Li N. P., He J., Ye W. C., Wang L.. Xanthchrysones A-C: Rearranged phenylpropanoyl-phloroglucinol dimers with unusual skeletons from Xanthostemon chrysanthus . J. Org. Chem. 2019;84(23):15355–15361. doi: 10.1021/acs.joc.9b02373. [DOI] [PubMed] [Google Scholar]
  19. He, W. ; Yue, G. ; Xiao, Z. ; Liang, L. . (3R)-des-O-methyllasiodiplodin and its derivative, and preparation method and medical application there of Chinese. C.N. Patent CN101,676,281A.
  20. Hai, Z. ; Yue, G. ; Xi, T. ; Jing, G. ; Wei, W. ; Cheng, J. . Application of (3R)-des-O-methyllasiodiplodin to prepare the medicine for preventing or treating depression. C.N. Patent CN102,716,120A.
  21. Yu, X. ; Hang, L. ; Wei, Z. ; Li, Z. . Metarhizium anisopliae O-methyltransferase and application. C.N. Patent CN104,862,326A.
  22. Casas-Arrojo V., Decara J., de Los A. A. M., Perez-Manriquez C., Abdala-Diaz R. T.. Immunomodulatory, antioxidant activity and cytotoxic effect of sulfated polysaccharides from Porphyridium cruentum. (S. F. Gray) Nägeli. Biomolecules. 2021;11(4):488. doi: 10.3390/biom11040488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Pandey A., Li Z., Gautam M., Ghosh A., Man S. M.. Molecular mechanisms of emerging inflammasome complexes and their activation and signaling in inflammation and pyroptosis. Immunol. Rev. 2025;329(1):e13406. doi: 10.1111/imr.13406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ban D., Yu P., Xiang Z., Liu Y.. TNF-like weak inducer of apoptosis/nuclear factor kappaB axis feedback loop promotes spinal cord injury by inducing astrocyte activation. Bioengineered. 2022;13(5):11503–11516. doi: 10.1080/21655979.2022.2068737. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  25. Kim K. A., Kim D., Kim J. H., Shin Y. J., Kim E. S., Akram M., Kim E. H., Majid A., Baek S. H., Bae O. N.. Autophagy-mediated occludin degradation contributes to blood-brain barrier disruption during ischemia in bEnd.3 brain endothelial cells and rat ischemic stroke models. Fluids Barriers CNS. 2020;17(1):21. doi: 10.1186/s12987-020-00182-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Wu J., Yang F., Zhang X., Chen G., Zou J., Yin L., Yang D.. Hydrogen sulfide inhibits endoplasmic reticulum stress through the GRP78/mTOR pathway in rat chondrocytes subjected to oxidative stress. Int. J. Mol. Med. 2021;47(4):34. doi: 10.3892/ijmm.2021.4867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Bhukel A., Beuschel C. B., Maglione M., Lehmann M., Juhász G., Madeo F., Sigrist S. J.. Autophagy within the mushroom body protects from synapse aging in a non-cell autonomous manner. Nat. Commun. 2019;10(1):1318. doi: 10.1038/s41467-019-09262-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jeong Y. H., Kim T. I., Oh Y. C., Ma J. Y.. Selaginella tamariscina Inhibits Glutamate-Induced Autophagic Cell Death by Activating the PI3K/AKT/mTOR Signaling Pathways. Int. J. Mol. Sci. 2022;23(19):11445. doi: 10.3390/ijms231911445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Gómez-Puerto M. C., Verhagen L. P., Braat A. K., Lam E. W., Coffer P. J., Lorenowicz M. J.. Activation of autophagy by FOXO3 regulates redox homeostasis during osteogenic differentiation. Autophagy. 2016;12(10):1804–1816. doi: 10.1080/15548627.2016.1203484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zeng X. J., Li P., Ning Y. L., Zhao Y., Peng Y., Yang N., Xu Y. W., Chen J. F., Zhou Y. G.. A2A R inhibition in alleviating spatial recognition memory impairment after TBI is associated with improvement in autophagic flux in RSC. J. Cell. Mol. Med. 2020;24(12):7000–7014. doi: 10.1111/jcmm.15361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ni S., Qu H., Liu D., Yuan L., Li M., Zhao W.. Recent advances of the mechanistic target of rapamycin (mTOR) inhibitors for drug discovery. Eur. J. Med. Chem. 2025;298:118046. doi: 10.1016/j.ejmech.2025.118046. [DOI] [PubMed] [Google Scholar]
  32. Liu C., Zhang J., Ye Z., Luo J., Peng B., Wang Z.. Research on the role and mechanism of the PI3K/Akt/mTOR signalling pathway in osteoporosis. Front. Endocrinol. 2025;16:1541714. doi: 10.3389/fendo.2025.1541714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Guo Y., Yuan Y., Wang R., Bai J., Jia Y., Qiu X., Niu H., Li L., Luo Y., Zhao B., Zhang Z.. Monocrotaline-mediated autophagy via inhibiting PI3K/AKT/mTOR pathway induces apoptosis in rat hepatocytes. Front. Pharmacol. 2024;15:1499116. doi: 10.3389/fphar.2024.1499116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Riccio B. V. F., Nascimento A., Meneguin A. B., Rodero C. F., Santos K. P., Sabio R. M., Annunzio S. R., Fontana C. R., Barud H., Ferrari P. C., Chorilli M.. solid dispersions incorporated into pvp films for the controlled release of trans-resveratrol: Development, physicochemical and in vitro characterizations and in vivo cutaneous anti-inflammatory evaluation. Pharmaceutics. 2022;14(6):1149. doi: 10.3390/pharmaceutics14061149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lee G. Y., Zeb A., Kim E. H., Suh B., Shin Y. J., Kim D., Kim K. W., Choe Y. H., Choi H. I., Lee C. H., Qureshi O. S., Han I. B., Chang S. Y., Bae O. N., Kim J. K.. CORM-2-entrapped ultradeformable liposomes ameliorate acute skin inflammation in an ear edema model via effective CO delivery. Acta Pharm. Sin. B. 2020;10(12):2362–2373. doi: 10.1016/j.apsb.2020.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Young L. M., Kheifets J. B., Ballaron S. J., Young J. M.. Edema and cell infiltration in the phorbol ester-treated mouse ear are temporally separate and can be differentially modulated by pharmacologic agents. Agents Actions. 1989;26(3–4):335–341. doi: 10.1007/BF01967298. [DOI] [PubMed] [Google Scholar]
  37. Huang R., Yu J., Zhang B., Li X., Liu H., Wang Y.. Emerging COX-2 inhibitors-based nanotherapeutics for cancer diagnosis and treatment. Biomaterials. 2025;315:122954. doi: 10.1016/j.biomaterials.2024.122954. [DOI] [PubMed] [Google Scholar]
  38. Dirkx L., Hendrickx S., Merlot M., Bulte D., Starick M., Elst J., Bafica A., Ebo D. G., Maes L., Van Weyenbergh J., Caljon G.. Long-term hematopoietic stem cells as a parasite niche during treatment failure in visceral leishmaniasis. Commun. Biol. 2022;5(1):626. doi: 10.1038/s42003-022-03591-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Chen Y., Fang L., Zhou W., Chang J., Zhang X., He C., Chen C., Yan R., Yan Y., Lu Y., Xu C., Xiang G.. Nitric oxide-releasing micelles with intelligent targeting for enhanced anti-tumor effect of cisplatin in hypoxia. J. Nanobiotechnol. 2021;19(1):246. doi: 10.1186/s12951-021-00989-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sun C., Wang J., Xia T., Sun Q., He Y., Wang H., He Q., Liu L.. Mitochondrion-Targeted NIR Therapeutic Agent Suppresses Melanoma by Inducing Apoptosis and Cell Cycle Arrest via E2F/Cyclin/CDK Pathway. Pharmaceuticals. 2022;15(12):1589. doi: 10.3390/ph15121589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Wu J. Y., Chen Y. J., Bai L., Liu Y. X., Fu X. Q., Zhu P. L., Li J. K., Chou J. Y., Yin C. L., Wang Y. P., Bai J. X., Wu Y., Wu Z. Z., Yu Z. L.. Chrysoeriol ameliorates TPA-induced acute skin inflammation in mice and inhibits NF-κB and STAT3 pathways. Phytomedicine. 2020;68:153173. doi: 10.1016/j.phymed.2020.153173. [DOI] [PubMed] [Google Scholar]
  42. Wang S., Shi X., Li J., Huang Q., Ji Q., Yao Y., Wang T., Liu L., Ye M., Deng Y., Ma P., Xu H., Yang G.. A Small Molecule Selected from a DNA-Encoded Library of Natural Products That Binds to TNF-alpha and Attenuates Inflammation In Vivo. Adv. Sci. 2022;9(21):e2201258. doi: 10.1002/advs.202201258. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ao5c12134_si_001.pdf (1MB, pdf)

Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES