Multi-omics analysis of transcriptomics and proteomics to provide mechanistic insights into the effects of camellia oil in alleviating xerosis cutis

Abstract

Camellia oil, renowned for its high nutritional and cosmetic values, is frequently employed to ameliorate dermatological conditions, including xerosis cutis (XC). However, there remains a paucity of systematic research elucidating its efficacy and underlying mechanisms in the management of XC. This study aimed to identify the chemical constituents of Camellia oil, evaluate its therapeutic effects in an acetone-ether-water (AEW)-induced mouse model, and discover the underlying mechanisms of its action. The chemical composition was characterized analytically, and in vivo experiments were conducted using an AEW-induced mouse model to evaluate its therapeutic effects on skin lesions and pathology. Furthermore, multi-omics analyses (transcriptomics and proteomics) combined with in vitro cellular evaluations were performed to investigate the underlying molecular mechanisms. Camellia oil primarily consists of triolein and trilinolein, with bioactive dermatological constituents including squalene, α-tocopherol, and γ-tocopherol. The in vivo experiments demonstrated that Camellia oil significantly ameliorated skin lesions, inhibited abnormal epidermal thickening, and upregulated filaggrin (FLG) expression. Integrated transcriptomics and proteomics analyses suggested that the barrier-repairing effects of Camellia oil are associated with enhanced eratinocyte proliferation, migration, and differentiation. These findings were further supported by in vitro experiments. Our findings provide a theoretical foundation for application of Camellia oil in dermatological care.

Graphical abstract

Highlights

• •Camellia oil inhibited abnormal epidermal thickening and upregulated FLG in AEW-induced models.
• •Multi-omics clarified mechanisms and dose-dependent responses in HaCaT cells.
• •Camellia oil stimulated keratinocyte proliferation, migration, and differentiation.

1. Introduction

Xerosis cutis (XC) is a common dermatological condition with a prevalence of up to 51.7%, no significant sex predilection, and a higher prevalence among children and the elderly [[1], [2], [3]]. XC is clinically diagnosed based on characteristic signs and symptoms, primarily dryness, flaking, roughness, tightness, and pruritus, with erythema and fissures occurring in more severe cases and severe pruritus potentially impairing quality of life [2,4,5]. XC can be triggered by environmental factors, excessive cleansing, irritant exposure, and several dermatological or systemic diseases, including atopic dermatitis (AD), type 2 diabetes (T2D), and chronic kidney disease (CKD) [4,6]. Its pathogenesis primarily involves skin barrier dysfunction and reduced stratum corneum (SC) hydration associated with altered intercellular lipids, keratinocyte differentiation, and moisturizing factors [7]. Pruritus-induced scratching can further disrupt the barrier and promote cutaneous inflammation, perpetuating the itch-scratch cycle [8,9].

The core treatment for XC relies on the regular use of combination remoisturizing and lipid-replenishing topical agents to improve skin hydration and restore barrier function. Commonly used active ingredients include urea, glycerol, ceramides, mineral oils and natural plant oils. Nonetheless, treatments for XC with common ingredients show limited efficacy and potential adverse effects. For example, mineral-based skin creams function passively by sealing the skin against dehydration; however, clinical studies have found that they leave detectable residues on patients' skin, potentially causing textile damage [10]. Although urea is recognized as the gold standard in the treatment of XC, an unpleasant burning sensation yet may appear when concentration of ≥10% are used on open skin or inflammatory lesions [4]. Therefore, the exploration of safe, effective treatment strategies for this condition is urgently needed.

Camellia oleifera oil, renowned for its high nutritional and cosmetic values, is extensively used for culinary, cosmetic and medical purposes in China, Japan, Korea and South Asian countries [[11], [12], [13]]. Camellia oleifera Abel is widely cultivated in warm, humid hilly and mountainous regions of Southern China and Southeast Asia, making its seeds readily available for industry. The species exhibits a unique trait of simultaneous flowering and fruiting, with a fruit maturation period of approximately 166 to 198 days [14]. For commercial oil extraction, high-quality seeds with optimal maturity and low moisture content are strictly required to ensure maximum oil yield and quality, as specified in the Chinese National Standard for Camellia Seeds (GB #37917-2019). Camellia oil is mainly composed of triglyceride (Tg) and free fatty acids (FFAs), which are intrinsically linked to the composition of skin lipids [15,16]. It exhibits significant moisturizing efficacy by forming a hydrophobic film on the surface of the skin as well as by replenishing the intercellular lipid matrix (ILM). Furthermore, Camellia oil contains multiple bioactive compounds, including squalene, vitamin E, saponins, and polyphenols [12,17], which are efficacious at repairing and soothing skin.

The skin-related effects of Camellia oil were first recorded in the late 16th-century Bencao Gangmu (本草纲目, Compendium of Materia Medica, 1596), which states that it can clear heat and dampness and kill parasites and detoxify. Another Chinese text from the 17th century, the Nongzheng Quanshu (农政全书, Complete Treatise on Agriculture, 1693), describes the use of Camellia oil to treat scabies and alleviate damp heat. According to traditional Chinese medicine (TCM) theory, the etiology of pruritus is often associated with factors such as damp heat, wind pathogens, and blood deficiency. Clearing heat and eliminating dampness are among the key therapeutic approaches in TCM to treating pruritus [18]. Therefore, Camellia oil is traditionally used for treating XC in folk medicine [[19], [20], [21]].

Modern medical research has demonstrated that Camellia oil could potentially treat XC via multiple mechanisms, indicating its good prospects as anti-XC therapy. Our research group previously reported in 2022 that Camellia oil demonstrated significant therapeutic effects in chemical- and inflammation-induced three-dimensional (3D) skin model EpiKutis, including marked improvements in epidermal morphology and viability; restoration of barrier function; and suppressed release of inflammatory cytokines such as interleukin (IL)-1α, IL-8, and thymic stromal lymphopoietin (TSLP) [22]. Ouyang et al. found that Camellia oil alleviates the symptoms of 2,4-dinitrochlorobenzene (DNCB)-induced AD in mice, potentially through the suppression of inflammatory responses as well as its FFAs targeting filaggrin (FLG) to restore skin barrier function and increase skin hydration [21]. Similarly, Jiao et al. observed significant therapeutic effects of Camellia oil in DNCB-induced AD mouse models, further validating its upregulatory effect on FLG expression [23]. Regarding the underlying mechanism of camellia oil, our research group previously reported that its beneficial reparative effects on the epidermis can be attributed to its ability to significantly inhibit the phosphorylation of major proteins in the mitogen-activated protein kinase (MAPK) signalling pathway and kallikrein-related peptidase 7 (KLK7) messenger ribonucleic acid (mRNA) expression, while markedly promoting the mRNA expression of FLG and caspase-14 [24]. Chang et al. reported the anti-inflammatory effects of Camellia oil to inhibit lipopolysaccharide (LPS)-induced production of nitric oxide (NO), polyethylene glycol 2 (PEG2), tumour necrosis factor-α (TNF-α) and IL-6 in RAW264.7 cells, which might be related to downregulation of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) gene expression [25]. In addition, multiple studies have confirmed the safety of Camellia oil on human skin [26,27].

Although Camellia oil has shown multiple benefits for skin health, systematic research clarifying its therapeutic efficacy and underlying mechanisms specifically in the treatment of XC remains scant. To bridge this critical knowledge gap, the objective of the current study was to systematically evaluate the therapeutic potential of Camellia oil and explore its multi-target mechanism of action in XC. We first characterized its chemical composition and evaluated its therapeutic efficacy in an acetone-ether-water (AEW)-induced XC mouse model. Integrated transcriptomic and proteomic analyses were subsequently performed to identify potential molecular mechanisms, followed by in vitro assays to further evaluate the multi-omics findings. Together, this integrative in vivo, in vitro, and multi-omics approach provides a robust, scientific foundation for utilizing Camellia oil as a therapeutic intervention for XC.

2. Materials and methods

2.1. Materials

2.1.1. Reagents and chemicals

Camellia oil was procured from Longyou Tianrun Grease Factory, extracted from the seeds of Camellia oleifera Abel. Specimen was prepared by Professor Chen QuanCheng of Xiamen University and stored in herbarium under voucher specimen number 320825250918001LY. To prevent lipid oxidation and degradation, the Camellia oil was stored in a cool (<20°C), dry, and dark environment in accordance with the National Standard for Camellia Seed Oil (GB/T 11765-2018). The oil was analyzed within three months of procurement. Prior to the pharmacological and behavioral experiments, the major bioactive constituents, particularly oleic acid and linoleic acid, were verified by gas chromatography to confirm that the oil met the quality specifications of GB/T 11765-2018. Chromatography-grade reagents, including isooctane, methanol, ethanol, n-heptane, and n-hexane, along with analytical-grade potassium hydroxide (KOH), sodium bisulfate (NaHSO₄), ascorbic acid, diethyl ether, petroleum ether, anhydrous sodium sulphate (Na₂SO₄), and butylated hydroxytoluene (BHT), were purchased from Shanghai Macleans Biochemical Technology Co., Ltd. (Shanghai, China). Squalene standard (Chemical Abstracts Service [CAS] Registry No. 7683-64-9; ≥ 98%) was obtained from Shanghai Macleans as well. Mixed fatty acid methyl ester (FAME) standard (≥99%), α-tocopherol standard (CAS No. 10191-41-0; ≥ 98%) and γ-tocopherol standard (CAS No. 54-28-4; ≥ 98%) were purchased from AnPEL Laboratory Technologies Co., Ltd. (Shanghai, China). Acetone (CAS No. 67-64-1) and chemically pure ether absolute (CAS No. 60-29-7) were obtained from Guangzhou Chemical Reagent Factory (Guangzhou, China). Antibodies (Abs) targeting FLG (#GTX23137) were purchased from GeneTex, Inc. (Irvine, CA, USA). Dulbecco's Modified Eagle's Medium (DMEM), Roswell Park Memorial Institute 1640 (RPMI-1640) medium, foetal bovine serum (FBS) and 0.25% trypsin-ethylenediaminetetraacetic acid (EDTA; 1×) were purchased from Gibco BRL (Thermo Fisher Scientific, Waltham, MA, USA). Penicillin and streptomycin (P&S) were obtained from Absin Biotechnology Co., Ltd. (Shanghai, China). Stem cell factor (SCF) was purchased from Novoprotein Scientific, Inc. (Shanghai, China). Mouse recombinant IL-3 was purchased from PeproTech, Inc. (Rocky Hill, NJ, USA), a Cell Counting Kit-8 (CCK-8) was purchased from Boster Biological Technology Co., Ltd. (Hebei, China), a histamine assay kit was purchased from NJJC Bioengineering Co., Ltd. (Nanjing, China), Compound C48/80 was purchased from Sigma-Aldrich, Inc. (St. Louis, MO, USA) and 3,3′-diaminobenzidine (DAB) chromogen was purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China).

2.1.2. Animals

A total of 20 male 6-week-old C57BL/6J mice, with an initial body weight of 20–22 g, were obtained from Guangdong Medical Laboratory Animal Center (Foshan, China) and housed under standard conditions, including a 12 h light-dark cycle, a temperature of 22 ± 2°C, and a relative humidity of 45 ± 15%. All animal experiments were approved by the Welfare and Ethical Committee for Experimental Animal Care of Guangdong Heli Biotechnology Co., Ltd. (Guangzhou, China) and conducted under National Institutes of Health (NIH) Guidelines for the Care and Use of Laboratory Animals (Approval ID: HL-20240806).

2.1.3. Cell lines and cell culture

The keratinocyte cells used in this study were from the human keratinocyte cell line HaCaT, which was purchased from Boster BioTech. HaCaT cells were incubated with DMEM containing 10% FBS and 1% P&S in a humid atmosphere at 37°C and 5% CO₂.

The mast cells used in this study were murine bone marrow-derived mast cells (BMMCs), which were obtained from Huadai Biotechnology Co., Ltd. (Guangzhou, China). BMMCs were cultured in RPMI-1640 media supplemented with 10% FBS, 1% P&S, SCF and IL-3 in a humid atmosphere at 37°C and 5% CO₂.

2.2. Chemical analysis

2.2.1. Gas chromatography analysis of fatty acid composition

Gas chromatography (GC) analysis of fatty acid composition was conducted to chemically profile the primary lipophilic active components, such as linoleic acid, which are critical for mediating epidermal barrier repair [16,28]. An appropriate amount of mixed FAME standard was diluted with n-heptane to 10 mL. Following the guidelines established in the National Food Safety Standard for Determination of Fatty Acid in Foods (GB #5009.168-2016), the area normalization method was used to analyse the fatty acid composition of Camellia oil. First, 60.0 mg of Camellia oil was dissolved in 4 mL isooctane and subsequently mixed with 0.2 mL of a 2 mol/L KOH-methanol solution. Then, approximately 1 g NaHSO₄ was added to neutralize the KOH. After complete precipitation, the content of the supernatant was determined using a 7890A gas chromatograph (Agilent Technologies, Inc., Santa Clara, CA, USA) equipped with a flame ionization detector and an HP-88 capillary column (0.20 μm; 100 × 0.25 mm; Agilent). Operating conditions were as follows: 1.0 mL/min nitrogen was used as carrier gas; 1.0 μL sample was introduced at a split ratio of 1:100 and an injector temperature of 270°C; detector temperature was 280°C; oven temperature was programmed from 100°C (13 min) to 180°C (10 °C/min, 6 min) to 220°C (1 °C/min, 20 min) to 230°C (4 °C/min, 10.5 min). Each individual FAME was used to calculate the content of each component by comparing the percentage of the corresponding peak area with the total peak area of all components.

2.2.2. Gas chromatography analysis of squalene

GC analysis of squalene was performed to quantify this long-chain triterpene, which plays an indispensable role in maintaining cutaneous hydration and scavenging reactive oxygen species [29,30]. For the preparation of the standard solution, a squalene reserve solution (1 mg/mL) was prepared by accurately weighing 50.0 mg squalene standard in a 50 mL volumetric bottle, dissolving it with n-hexane, and filling it to the scale. Stock solutions were further diluted with n-hexane to prepare squalene working standard solutions with concentrations of 2.50, 5.0, 10.0, 20.0, 50.0, and 100.0 μg/mL. Following the guidelines established in Inspection of Grain and Oils—Determination of Squalene in Vegetable Oil by Gas Chromatography (LS/T #6120-2017), the squalene in Camellia oil was analyzed. The main steps of sample processing included weighing the oil, saponification with KOH-ethanol solution, extraction with n-hexane, washing with 10% (v/v) ethanol aqueous solution, filtration with anhydrous Na₂SO₄, and concentration by rotary evaporation. The obtained sample was diluted with n-hexane to 10.0 mL, filtered again, and analyzed via GC. GC experiments were performed on a 7890A gas chromatograph equipped with a flame ionization detector and an HP-5 capillary column (0.25 μm, 30 × 0.32 mm; Agilent). Operating conditions were as follows: 1.0 mL/min nitrogen was used as carrier gas; 1.0 μL sample was introduced at a split ratio of 1:10 at an injector temperature of 250°C; detector temperature was 300°C; oven temperature was programmed from 160°C to 220°C (15 °C/min, 2 min) to 280°C (5 °C/min, 20 min) to 300°C (5 °C/min, 2 min). The concentration of squalene was calculated by measuring the corresponding peak areas and quantifying them using the external standard method.

2.2.3. High-performance liquid chromatography analysis of α-tocopherol and γ-tocopherol

High-performance liquid chromatography (HPLC) analysis of α-tocopherol and γ-tocopherol was utilized to quantify these fat-soluble vitamins, which have antioxidant effect and anti-inflammatory potential [12,31]. For the preparation of the standard solution, a tocopherol reserve solution (1 mg/mL) was prepared by accurately weighing 50.0 mg α- and γ-tocopherol standards in a 50 mL volumetric bottle, dissolving the mixture with ethanol, and filling the bottle to the scale. The solution was then diluted with methanol, resulting in a stock concentration of 100 μg/mL. Stock solutions were further diluted with methanol to prepare α- and γ-tocopherol working standard solutions with concentrations of 2.0, 5.0, 10.0, 20.0, 40.0, and 60.0 μg/mL. Following the guidelines established in the National Food Safety Standard—Determination of Vitamins A, D and E in Foods (GB #5009.82-2016), α- and γ-tocopherol in Camellia oil were analyzed. The main steps of sample processing included weighing the oil, adding ascorbic acid and BHT, saponification with KOH-ethanol solution, extraction with petroleum ether solution, washing with water until neutral, filtering with anhydrous Na₂SO₄, and concentration by rotary evaporation. The obtained sample was diluted with methanol to 10.0 mL, filtered again, and analyzed via HPLC. An Agilent 1260 Infinity II liquid chromatograph (Agilent) equipped with a fluorescence detector and a C30 liquid chromatography column (3 μm; 250 × 4.6 mm) were used to determine tocopherol content. Liquid chromatography conditions were as follows: mobile phase A, water; mobile phase B, methanol; elution gradient, as shown in Table S1; column temperature, 20°C; flow rate, 0.8 mL/min; detection wavelength of fluorescence detector: excitation wavelength of 294 nm, emission wavelength of 328 nm; injection volume, 10 μL. The concentration of α-tocopherol and γ-tocopherol were calculated by measuring the corresponding peak areas and quantifying them using the external standard method.

2.3. Animal experiments

2.3.1. Establishment of AEW-induced mouse model

The AEW-induced mouse model, characterized by elevated transepidermal water loss (TEWL) and persistent scratching behaviour, has been widely recognized as the classic animal model for XC research [32]. To mimic the pathophysiological features of human XC, including severe SC dehydration and epidermal barrier disruption, an AEW-induced mouse model was established as described previously [33]. After a 3 × 3 cm spot on the nape was shaved of fur, mice were given 3 days to adapt to the new environment. Then their napes were painted with acetone and diethyl ether (1:1) for 15 s, followed by treatment with water for 30 s. In the control group, mouse napes were painted with water instead of acetone/diethyl ether. This treatment was administered once daily for 5 consecutive days. A schematic overview of the experimental timeline is shown in Fig. 2A. The successful establishment of the AEW model was confirmed on the 3rd day of modeling, characterized by a decrease in epidermal water content and a marked increase in scratching frequency [34].

Fig. 2.

In vivo therapeutic effect of Camellia oil against XC. (A) Schematic illustration of the details of the therapeutic study. (B) Temporal changes in skin lesion scores of AEW-induced mice throughout therapeutic intervention. Differences between groups were compared with the AEW group. (C) Representative images of nape skin on day 5. Yellow dashed circles indicate representative skin lesions. (D) Number of spontaneous scratching bouts in 30 min after AEW treatments on day 5. (E) Representative iamges of H&E-stained skin tissues collected on day 5. The dotted line indicates the border between the epidermal and dermal, and the yellow double-headed arrows indicate the epidermal thickness. (F) Relative epidermal thickness (fold change) was quantified using ImageJ v1.52p according to H&E staining results. (G) Representative images of immunostained skin tissues for FLG collected on day 5. (H) Relative FLG expression in SC (fold change) was quantified using ImageJ v1.52p according to FLG IHC results. Data are shown as mean ± SD; n = 5 per group. Scale bar = 200 μm for (E), 50 μm for (G). *P < 0.05, **P < 0.01, ***P < 0.001 by one-way ANOVA for (B), (D), (F), and (H). N.S., no significant difference; XC, xerosis cutis; AEW, acetone-ether-water; H&E, haematoxylin and eosin; FLG, filaggrin; SC, stratum corneum; IHC, immunohistochemistry; SD, standard deviation; ANOVA, analysis of variance.

2.3.2. Evaluation of skin lesions and scratching behaviour

Evaluation of skin lesions and scratching behaviour provided direct behavioral and clinical phenotypic readouts to gauge the therapeutic efficacy of Camellia oil against XC. In prior cell experiments, 1% camellia oil exhibited significant restorative effects on the epidermis [24]. Consequently, 7% Camellia oil formulation was used for the in vivo assays. All mice were randomized into four groups (n = 5): the control group, the AEW model group, the base formulation (without Camellia oil) group and the Camellia oil formulation (containing 7% Camellia oil) group. The base formulation contained all excipients used in the Camellia oil formulation but did not contain Camellia oleifera seed oil. Mice in the Camellia oil formulation group received an application of Camellia oil formulation to their shaved nape skins 0.5 h and 6 h after AEW treatment, twice daily for 5 consecutive days. Those in the base formulation group received base formulation instead. Dermatological assessments of nape skin, including evaluation of erythema and desquamation, were conducted daily on days 1-5 as previously described. Briefly, the skin lesion score was the sum of erythema and desquamation scores, with both evaluated on a severity scale of 0 (none) to 4 (worst) [32]. Experienced researchers who were not aware of the experimental groupings evaluated scratching behaviour within 30 min after AEW treatment on day 5. A scratching bout was defined as the occurrence of either (1) lifting of hind paws from the floor, accompanied by single or multiple scratching motions directed at the nape skin area; or (2) licking, gnawing, or biting behaviours targeting the hind paws. Materials and steps for preparations the Camellia oil and base formulation are presented in the Supplementary Materials.

2.3.3. Dermatological-tissue analysis

Epidermal thickening and mast cell infiltration are the signature pathological hallmarks of the AEW-induced mouse model [32]. Evaluation of FLG expression in skin tissues was utilized to indicate the skin barrier function [35]. In this study, dermatological-tissue analysis was implemented to histologically evaluate changes in epidermal thickness, SC integrity, and inflammatory cell infiltration following treatment. On day 5, mice were sacrificed by cervical dislocation [34], and then the treated nape skin (1 × 1 cm) was immediately collected, fixed in 4% paraformaldehyde (PFA) for 24 h, embedded in paraffin, and cut into 6 μm sections. Haematoxylin and eosin (H&E) staining was performed as previously described to evaluate epidermal thickness [36]. Briefly, deparaffinized sections were stained with haematoxylin for 5 min, rinsed in tap water, and counterstained with eosin for 2 min. Toluidine blue staining was performed as previously described to evaluate epidermal mast cell density [37]. In brief, sections were dewaxed, rehydrated, and stained with 0.1% toluidine blue working solution for 5 min. Immunohistochemistry (IHC) was also performed as previously described to assess FLG expression [38]. Briefly, paraffin-embedded sections were dewaxed, rehydrated, subjected to antigen retrieval, and incubated overnight with anti-FLG primary antibody (1:500), followed by incubation with an horseradish peroxidase (HRP)-conjugated anti-rabbit secondary antibody (1:200) for 1 h and subsequent visualization with DAB chromogen. Then the stained sections were examined and captured using an ESLIPSE Ts2 inverted microscope (Nikon Corporation, Tokyo, Japan). Semi-quantitative analyses of epidermal thickness, mast cell density, and FLG expression were performed using ImageJ software v1.52p (NIH, Bethesda, MD, USA).

2.4. Multi-omics analysis of transcriptomics and proteomics

2.4.1. Transcriptomics and data analysis

Transcriptomic analysis provides distinct advantages in elucidating the multi-target therapeutic mechanisms of natural products [39]. To explore the mechanism of action of Camellia oil against XC, transcriptomic analysis was performed. As a spontaneously immortalized human keratinocyte line, HaCaT cells maintain high proliferative capacity and stable genetic traits across passages [40], making them widely utilized in research on xerosis and skin barrier dysfunction [41,42]. In this study, HaCaT cells were divided into three groups: those treated with 0.35% (v/v) Camellia oil, those treated with 0.7% (v/v) Camellia oil, and those treated with vehicle (0.1% acetone) as control. After 24 h, the medium was discarded, and 1 mL TriZOL lysate was added to extract total ribonucleic acid (RNA). Total RNA isolation was performed using the standard guanidinium thiocyanate-phenol-chloroform extraction method according to the manufacturer's protocol [43]. The RNA samples were detected on a Nanodrop ND-2000 system (Thermo Fisher) based on an absorbance ratio of A₂₆₀/A₂₈₀, and the RNA integrity number (RIN) was determined using a Bioanalyzer 4150 system (Agilent). Subsequently, a total of 1 μg of high-quality RNA per sample was utilized for the transcriptome sequencing library preparation [44]. Transcriptome sequencing was conducted by Shanghai Applied Protein Technology Co., Ltd. (Shanghai, China) on an Illumina NovaSeq 6000/MGISEQ-T7 instrument (Illumina, Inc., San Diego, CA, USA). The threshold of |log2 fold change [FC]| at > 0.585 and the P value at < 0.05 for significantly different expression were set. Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway mapping were performed using Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources v6.8 (https://david.ncifcrf.gov). Protein-protein interaction (PPI) networks were constructed using Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) v12.0 (https://cn.string-db.org/) with a combined score ≥ 0.7 and proteins as the query objects. Highly connected functional modules were subsequently identified using the Molecular Complex Detection (MCODE) plugin v2.0.2 in Cytoscape v3.8.2, with a cluster score threshold > 4.

2.4.2. Proteomics and data analysis

Proteomics analyse was employed widely to investigate mechanisms for skin health [45]. In this study, proteomic profiling was utilized to uncover functional protein expressions that might be missed at the transcription level, fully decoding the anti-XC profiles of the Camellia oil. As in the transcriptomics experiment mentioned above, HaCaT cells were divided into three groups, and the treatment groups received 0.35% (v/v) and 0.7% (v/v) Camellia oil for 24 h. Then, the cells were lysed and proteins were collected via centrifugation. Proteome sequencing was conducted via data-independent acquisition (DIA) by Shanghai Applied Protein (Shanghai, China). Briefly, cells were lysed in a buffer containing 4% sodium dodecyl sulphate, 100 mM tris(hydroxymethyl)aminomethane hydrochloride, and 100 mM dithiothreitol, pH 7.6, and boiled for 15 min. The protein concentration was estimated using a Pierce bicinchoninic acid (BCA) Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. For each sample, a total amount of 100 μg of protein underwent filter-assisted sample preparation (FASP) for trypsin digestion. The resulting peptides were desalted using C18 microcolumns and quantified by measuring the absorbance at 280 nm. Mass spectrometry (MS) was subsequently performed on an Orbitrap Astral mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) coupled with an Easy-nLC 1200 ultra-high-performance liquid chromatography system. The peptides were separated on a reversed-phase analytical column and analyzed in DIA mode with a full MS scan range of 350–1800 m/z to achieve high-resolution protein identification. The threshold of |log2 FC| at > 0.263 and the P value at < 0.05 for significantly different expression were set. Integrated bioinformatics analyses were performed using the same methods and parameters as those described for the transcriptomic analysis.

2.4.3. Joint analysis of proteomics and transcriptomics

Joint analysis of proteomics and transcriptomics was performed, which can identify key regulatory factors altered at both omic levels [46]. Shanghai Applied Protein performed joint analysis. Briefly, correspondence between gene identifiers and protein identifiers was obtained using the Ensembl genome browser (release 113; https://www.ensembl.org). For transcripts without pre-existing annotations in the database, a localized protein reference library was constructed from the identified proteome sequences using the makeblastdb tool. To bridge the gap between nucleotide and amino acid sequences, blastx was critically employed to align unmapped gene transcripts against this local protein library with an E-value threshold of 10⁻⁵. This sequence-level alignment is essential for identifying orthologous relationships based on structural similarity rather than exact identifier matches. Consequently, a highly stringent correspondence file containing the Bidirectional Best Hit (BBH) pairs was obtained, successfully mapping the unannotated genes to their corresponding protein functional counterparts.

2.5. In vitro assays

2.5.1. Evaluation of HaCaT cell proliferation

To evaluate the effects of Camellia oil on keratinocyte proliferation, cell viability was determined using a CCK-8 assay, a widely used method for assessing cell proliferation [47]. HaCaT cells were seeded in 96-well plates at a density of 8 × 10³ cells per well. Then, we treated them with 0.35% (v/v) and 0.7% (v/v) concentrations of Camellia oil, with 0.1% acetone as vehicle, for 24 and 48 h. Changes in cell proliferation were evaluated by cell viability, which was determined using a CCK-8 assay according to established protocols. Briefly, 10 μL of CCK-8 solution was added to each well, and the cells were incubated at 37°C for 1 h. The absorbance at 450 nm was subsequently measured using a Multiskan SkyHigh microplate spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

2.5.2. Evaluation of HaCaT cell migration

Cell migration serves as a critical indicator to evaluate the functional impact of treatments on HaCaT cells. In this study, HaCaT cell migration assays were performed. HaCaT cells were seeded in 6-well plates at a density of 2 × 10⁶ cells per well and cultured to form a monolayer (90–100% confluence). A parallel linear was created wound using a 1000 μL pipette tip (Biosharp Life Sciences, Hefei, China). The medium was replaced with serum-free medium containing different concentrations of Camellia oil, with 0.1% acetone as vehicle. Cell migration were evaluated by the wound closure rate, which was calculated by comparing the wound area (calculated by ImageJ v1.52p) immediately after the scratch (0 h), 24 h, 48 h and 72 h post-scratch. According to established quantitative migration models [42], the wound closure rate (%) was calculated using the following formula:

$$Woundclosurerate\%=\frac{0hwoundarea-24h/48h/72hwoundarea}{0hwoundarea}$$ (1)

2.5.3. Evaluation of HaCaT cell differentiation

Keratinocyte differentiation and skin moisture balance are essential for maintaining the skin barrier. These phenomena are associated with various genes, such as FLG, involucrin (IVL), transglutaminase-1 (TGM1), claudin (CLDN), occludin (OCLN) and hyaluronan synthase-2 and 3 (HAS2 and HAS3) [48]. In this study, the mRNA expression levels of FLG, IVL, TGM1, OCLN, CLDN, HAS2 and HAS3 were evaluated. HaCaT cells were seeded in 6-well plates at a density of 3 × 10⁵ cells per well. Then, they were treated with 0.35% (v/v) and 0.7% (v/v) concentrations of Camellia oil, with 0.1% acetone as vehicle, for 24 h. Real-time quantitative polymerase chain reaction (RT-qPCR) was performed to evaluate skin barrier-related mRNA expression. Total RNA was isolated using TRI Reagent (Sigma-Aldrich) per manufacturer's instructions, and its concentration and purity were quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). A total of 1 μg RNA was used for complementary deoxyribonucleic acid (cDNA) synthesis. The RT-qPCR assays were executed on a LightCycler 96 instrument (Roche Diagnostics GmbH, Mannheim, Germany). The mRNA expression was calculated change using the ΔΔCt formula. The gene encoding glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the quantitative control. Primer sequences used in this assay are listed in Table 1.

Table 1.

Primer sequences used in real-time quantitative polymerase chain reaction.

Gene name	Forward	Reverse
GAPDH	CTTTGTCAAGCTCATTTCCTGG	TCTTCCTCTTGTGCTCTTGC
FLG	TGAAGCCTATGACACCACTGA	TCCCCTACGCTTTCTTGTCCT
IVL	GGCCACCCAAACATAAATAACC	CCTAGCGGACCCGAAATAAG
TGM1	GAAAGCATGATCCGGGACGT	GATGGCAGAGAGGAGGTTGA
CLDN	CCTCCTGGGAGTGATAGCAAT	GGCAACTAAAATAGCCAGACCT
OCLN	CCAACGCAAAGCAATACATGA	CCTTTTTCGCTTCCCTGTTTTA
HAS2	CTGGGACGAAGTGTGGATTATG	CTCCAACCATGGGATCTTCTTC
HAS3	AGGTATGGCAGTAGAGGATGA	CCTGCTCACCATTGGAGAAT

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FLG, filaggrin; IVL, involucrin; TGM1, transglutaminase-1; CLDN, claudin; OCLN, occludin; HAS, hyaluronan synthases.

2.5.4. Evaluation of histamine release in bone marrow-derived mast cells

Histamine release from BMMCs serves as a classic indicator for evaluating the anti-pruritic potential of therapeutic agents. In this study, histamine release from BMMCs was evaluated as described previously [49]. BMMCs were treated with 0.004%, 0.02%, and 0.1% (v/v) concentrations of Camellia oil, with 0.1% acetone as vehicle, for 30 min and were then stimulated with Compound C48/80 (15 μg/mL; Sigma-Aldrich) for 30 min. To calculate histamine release in BMMCs, the supernatants collected from independent cell samples (n = 5 per group) were tested using a histamine assay kit. Briefly, the supernatant samples were added to a 96-well plate, and the volume was adjusted to 50 μL per well with assay buffer. Subsequently, 50 μL of reaction mix containing 46 μL of Assay Buffer 63, 2 μL of Histamine Enzyme Mix, and 2 μL of Developer Solution III was added to each sample and standard well. The plate was incubated at 37°C for 30 min, after which the absorbance was immediately measured at 450 nm using a Multiskan SkyHigh microplate spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Histamine concentrations were determined from a standard curve generated using the Histamine Standard.

2.6. Statistical analysis

All statistical analyses were performed using GraphPad Prism v8.0.2 (GraphPad Software, Inc., San Diego, CA, USA) and a cloud-based platform (accessed February 2025; https://bio-cloud.aptbiotech.com/). Experiments were performed three or five times each, and results are described as means ± standard deviations (SDs). One-way analysis of variance (ANOVA) followed by Dunnett's multiple-comparison test was conducted to determine statistical significance between multiple active treatment groups and a single control group. This approach is specifically critical for controlling the family-wise Type I error rate during multiple parallel comparisons [46]. P < 0.05, < 0.01, and < 0.001 were respectively considered statistically significant, highly significant, and extremely significant.

3. Results

3.1. Chemical constituents in camellia oil as identified by gas chromatography and high-performance liquid chromatography

We identified seven main compounds in Camellia oil via GC and HPLC analysis (Fig. 1A–C). As shown in Table 2, the major fatty acids in Camellia oil were oleic acid (OA), linoleic acid (LA), palmitic acid (PA), and stearic acid (SA), accounting for 78.43%, 8.96%, 8.64%, and 2.04% of the total fatty acid content, respectively. The contents of the other three compounds were as follows: squalene, 146 mg/kg; α-tocopherol, 172 mg/kg; and γ-tocopherol, 16 mg/kg.

Fig. 1.

Chemical analysis of Camellia oil. (A) Gas chromatogram identifying (1) palmitic acid, (2) stearic acid, (3) oleic acid and (4) linoleic acid in Camellia oil. (B) Gas chromatogram identifying (5) squalene in Camellia oil. (C) HPLC chromatogram identifying (6) α-tocopherol and (7) γ-tocopherol in Camellia oil. HPLC, high-performance liquid chromatography.

Table 2.

Determination results of main-component content in Camellia oil.

Compound		Result
Fatty acid composition (%)	Palmitic acid (C16:0)	8.64
	Stearic acid (C18:0)	2.04
	Oleic acid (C18:1)	78.43
	Linoleic acid (C18:2)	8.96
Squalene (mg/kg)		146
α-tocopherol (mg/kg)		172
γ-tocopherol (mg/kg)		16

3.2. Camellia oil ameliorated the symptoms of xerosis cutis

AEW-treated mice exhibited typical dry-skin-induced irritation, including roughness, desquamation, and erythema (Fig. 2C). On days 3, 4, and 5, the skin lesion scores in the Camellia oil formulation group were significantly lower than those in the AEW model group; only on day 4, the base formulation group exhibited a significantly reduced score compared to the AEW model group. However, no significant differences in skin lesion scores were observed between the Camellia oil formulation group and the base formulation group across days 3, 4, and 5 (Fig. 2B). Although no statistically significant difference was reached, the Camellia oil formulation group showed a more marked trend toward improvement in both desquamation and erythema lesions compared with the base formulation group on day 5 (Fig. 2C). Spontaneous scratching behaviour in both the Camellia oil and base formulation groups significantly decreased compared with the AEW group, with no significant difference between the two formulation groups (Fig. 2D).

The Camellia oil formulation group showed notable amelioration of abnormal epidermal thickening compared with the base formulation group (Fig. 2E and F). Compared with the control group, both the AEW group and base formulation group exhibited significant reductions in FLG expression level. In contrast, the Camellia oil formulation group showed no statistically significant difference in FLG expression compared with the control group (Fig. 2G and H). Both the Camellia oil and base formulation inhibited the increase in mast cell density, and the corresponding two groups of mice showed no significant difference between them (Fig. S1A–B). These results demonstrated that the therapeutic mechanisms of Camellia oil in ameliorating XC involved in inhibition of epidermal hyperplasia and upregulation of FLG expression in the SC.

3.3. Transcriptomics identified the genes and pathways related to camellia oil's effects against xerosis cutis

Given that the formulation containing 7% (v/v) Camellia oil showed therapeutic effects in the AEW-induced mouse model, 0.7% (v/v) Camellia oil was selected as the higher concentration for subsequent in vitro mechanistic studies. Preliminary cytotoxicity assays further demonstrated that Camellia oil did not significantly reduce HaCaT cell viability over the concentration range of 0.1%–1% (v/v) (Fig. S2). Therefore, 0.35% (v/v), representing half of the higher concentration, was selected as the lower concentration to compare the biological effects of Camellia oil at two concentrations within the non-cytotoxic range.

As can be seen in the volcano plots (Fig. 3A and B) and cluster heatmap (Fig. 3C), differentially expressed genes (DEGs) demonstrated significant differences among the low-Camellia oil concentration, high-Camellia oil concentration, and control groups. Specifically, we found 1529 DEGs between the low-concentration and control groups, with 970 upregulated and 559 downregulated. Furthermore, 808 DEGs were discovered between the high-concentration and control groups, with 530 upregulated and 278 downregulated. Notably, 490 concordantly altered DEGs were shared between both treatment groups compared with the control group, with 397 upregulated and 93 downregulated as shown in the Venn diagram (Fig. 3D). In addition, 318 dose-dependent DEGs were identified; these were specifically altered in the high-concentration group versus the control group with no significant or opposite expression changes in the low-concentration group versus the control group. These results suggested that Camellia oil exerted a dose-dependent regulatory effect on the transcriptional landscape of HaCaT cells.

Fig. 3.

Dose-dependent effects of Camellia oil on HaCaT transcriptome. (A) Volcano plot showing DEGs in the low-concentration group (0.35% v/v Camellia oil) versus the control group. (B) Volcano plot showing DEGs in the high-concentration group (0.7% v/v Camellia oil) versus the control group. Thresholds: |log2 FC| > 0.585 and P < 0.05. (C) Cluster heatmap showing DEGs shared among all three groups. (D) Venn diagram showing DEGs shared among all three groups. (E) GO BP analysis of 490 concordantly altered DEGs shared among all three groups. (F) KEGG pathway analysis of 490 consistently altered DEGs shared between both treatment groups versus the control group. (G) KEGG pathway analysis of 318 dose-dependent DEGs specifically altered in the high-concentration group versus the control group, with no significant or opposite expression changes in the low-concentration group versus the control group. (H) GO BP analysis of 318 dose-dependent DEGs specifically altered in the high-concentration group versus the control group, with no significant or opposite expression changes in the low-concentration group versus the control group. (I) Core PPI network of 490 concordantly altered DEGs shared between both treatment groups versus the control group. Nodes represent proteins; edges indicate interactions (combined score ≥ 0.7; only proteins queried in STRING v12.0). Core functional modules were extracted from the PPI network using the MCODE plugin with cluster score threshold > 4. DEG, differentially expressed gene; FC, fold change; GO, Gene Ontology; BP, Biological Process; KEGG, Kyoto Encyclopedia of Genes and Genomes; PPI, protein-protein interaction; STRING, Search Tool for the Retrieval of Interacting Genes/Proteins.

To investigate the primary mechanism of Camellia oil in HaCaT transcriptional regulation, we performed integrated bioinformatics analyses based on the 490 concordantly altered DEGs. The results of GO Biological Process (BP) analysis showed that genes related to error-prone translesion synthesis, double-strand break repair, microtubule-based movement, cell division, deoxyribonucleic acid (DNA)-templated transcription, and intracellular-signal transduction were upregulated (Fig. 3E). Pathways significantly enriched in KEGG analysis included the Fanconi anaemia pathway, cell cycle, motor proteins, herpes simplex virus 1 infection, and axon guidance (Fig. 3F). Six core modules in the PPI network were revealed, which were found to be closely linked to cell division, mRNA splicing, and exocytosis processes (Fig. 3I).

Based on previous evidence that Camellia oil exhibits dose-dependent anti-inflammatory effects on LPS-stimulated RAW 264.7 macrophages [25], we reasoned that characterizing the DEGs and differentially expressed proteins (DEPs) between the high-dose and low-dose groups would reflect the molecular mechanisms underlying the dose-dependent efficacy of Camellia oil. To investigate the dose-response effect of Camellia oil in HaCaT transcriptional regulation, we likewise performed integrated bioinformatics analyses based on the 318 specifically altered DEGs. The results of GO BP analysis showed that response to mechanical stimulus, response to xenobiotic stimulus and neuropeptide signalling pathway-related genes were downregulated (Fig. 3H). Pathways significantly enriched in KEGG analysis included the malaria, complement and coagulation cascades, rheumatoid arthritis, and cell adhesion molecules (Fig. 3G). MCODE analysis identified no core modules in the PPI network.

3.4. Proteomics identified proteins and pathways related to the effect of camellia oil against xerosis cutis

Because transcriptomic alterations do not necessarily reflect protein abundance, quantitative proteomics was further performed. Volcano plots (Fig. 4A and B) and the cluster heatmap (Fig. 4C) also show significant DEPs among the low-concentration, high-concentration, and control groups. We found 211 DEPs between the low-concentration and control groups, with 118 upregulated and 93 downregulated. Additionally, 261 DEPs were found between the high-concentration and control groups, with 153 upregulated and 108 downregulated. As shown in the Venn diagram, 45 concordantly altered DEPs were shared between both treatment groups compared with the control group, with 23 upregulated and 22 downregulated (Fig. 4D). Similar to the transcriptomics results, DEPs demonstrated a concentration-dependent effect of Camellia oil. We identified 216 dose-dependent DEPs, which were specifically altered in the high-concentration group versus the control group with no significant or opposite expression changes in the low-concentration group versus the control group.

Fig. 4.

Dose-dependent effects of Camellia oil on HaCaT proteome. (A) Volcano plot showing DEPs in the low-concentration group (0.35% v/v Camellia oil) versus the control group. (B) Volcano plot showing DEPs in the high-concentration group (0.7% v/v Camellia oil) versus the control group. Thresholds: |log2 FC| > 0.263 and P < 0.05. (C) Cluster heatmap showing DEPs shared among all three groups. (D) Venn diagram showing DEPs shared among all three groups. (E) GO BP analysis of 45 concordantly altered DEPs shared between both treatment groups versus the control group. (F) KEGG pathway analysis of 45 consistently altered DEPs shared between both treatment groups versus the control group. (G) PPI network of 45 concordantly altered DEPs shared between both treatment groups versus the control group. Nodes represent proteins; edges indicate interactions (combined score ≥ 0.7; only proteins queried in STRING v12.0). Core functional modules were extracted from the PPI network using the MCODE plugin with cluster score threshold > 4. (H) GO BP analysis of 216 dose-dependent DEPs specifically altered in the high-concentration group versus the control group, with no significant or opposite expression changes in the low-concentration group versus the control group. (I) KEGG pathway analysis of 216 dose-dependent DEGs specifically altered in the high-concentration group versus the control group, with no significant or opposite expression changes in the low-concentration group versus the control group. (J) PPI network of 216 dose-dependent DEPs specifically altered in the high-concentration group versus the control group, with no significant or opposite expression changes in the low-concentration group versus the control group. Nodes represent proteins; edges indicate interactions (combined score ≥ 0.7; only proteins queried in STRING v12.0). Core functional modules were extracted from the PPI network using the MCODE plugin with cluster score threshold > 4. DEP, differentially expressed protein; FC, fold change; GO, Gene Ontology; BP, Biological Process; KEGG, Kyoto Encyclopedia of Genes and Genomes; PPI, protein-protein interaction; STRING, Search Tool for the Retrieval of Interacting Genes/Proteins.

To reveal the central mechanism of Camellia oil in HaCaT proteomic regulation, we again performed integrated bioinformatics analyses based on the 55 concordantly altered DEPs. The results of GO BP analysis showed significant enrichment in BPs related to cell proliferation, migration, differentiation, and apoptosis, including phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt) signal transduction, nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB) signal transduction, iron ion homeostasis, and response to hypoxia (Fig. 4E). Pathways significantly enriched in KEGG analysis included the transforming growth factor-β (TGF-β) signalling pathway, hypoxia-inducible factor 1 (HIF-1) signalling pathway, autophagy, and ferroptosis (Fig. 4F). MCODE analysis revealed two core hub modules. One hub module included hemojuvelin (HJV), transferrin receptor protein 1 (TFR2), transferrin receptor (TFRC), transferrin (TF), and apolipoprotein B (ApoB), which is connected with iron ion homeostasis. The other hub module included divergent protein kinase domain 2A (DIPK2A), transmembrane emp 24 protein transport domain-containing 3 (TMED3), SecY homolog 1 (SCY1)-like pseudokinase 1 (SCYL1), Coatomer subunit gamma-2 (COPG2), and COPI coat complex subunit ζ2 (COPZ2), which is associated with retrograde transport from the Golgi apparatus to the endoplasmic reticulum (ER) (Fig. 4G).

We also investigated the concentration-dependent effects of Camellia oil in HaCaT proteomics regulation via integrated bioinformatics analyses based on the 216 specifically altered DEPs. GO BP analysis demonstrated that these DEPs were enriched in distinct sets of terms related to cell proliferation, migration, apoptosis, and differentiation, including Ras protein signal transduction, extracellular signal-regulated kinases 1 and 2 (ERK1, ERK2) cascade, wound healing, the Notch signalling pathway, and the epidermal growth factor receptor (EGFR) signalling pathway. In addition, the significantly enriched GO BPs showed a distinct shift toward immune defence and autophagy (Fig. 4H). Pathways significantly enriched in KEGG analysis included virion hepatitis viruses, EGFR tyrosine kinase inhibitor (TKI) resistance, endocytosis, cell cycle, Kaposi sarcoma-associated herpesvirus infection, human papillomavirus (HPV) infection, proteoglycans in cancer, and viral carcinogenesis (Fig. 4I). MCODE analysis identified two core hub modules. One hub module included anaphase-promoting complex subunit 15 (ANAPC15), ANAPC16, cell division cycle 26 (CDC26), polycomb group ring finger 6 (PCGF6), cyclin A2 (CCNA2), ANAPC13, ANAPC10, ANAPC11, and ubiquitin-conjugating enzyme E2S (UBE2S), which is connected with cell cycle regulation, particularly the ANAPC protein family driving mitotic exit and gap 1 (G1) phase transition. The other hub module included origin recognition complex subunits 6, 3, and 5 (ORC6, ORC3, ORC5), which is connected with DNA replication (Fig. 4J). These alterations in the cell cycle machineries are closely linked to the regulation of cellular proliferation capacity, representing a potential key mechanism by which Camellia oil alleviates epidermal damage in XC.

3.5. Integrative analysis revealed interplay of transcriptional and translational regulation

To integrate the transcriptomic and proteomic findings and identify consistently regulated molecular targets underlying the therapeutic effects of Camellia oil, integrative analysis of RNA and protein expression was performed. Integrative analysis of RNA and proteins provided a multidimensional atlas and showed a differential-expressed proteogenomic state. Between the low-concentration and control group, integrated analysis of DEPs and DEGs revealed 11 concordant changes (10 consistently upregulated and 1 consistently downregulated) alongside 4 discordant changes (2 DEPs upregulated-DEGs downregulated; 2 DEPs downregulated-DEGs upregulated) (Fig. 5A). When we compared the high-concentration group with the control group, integrated analysis of DEPs and DEGs revealed 3 concordant changes (3 consistently upregulated and 0 consistently downregulated) alongside 3 discordant changes (2 DEPs upregulated-DEGs downregulated; 1 DEP downregulated-DEG upregulated) (Fig. 5B).

Fig. 5.

Integration analysis of proteome and transcriptome. (A) Four-quadrant plot showing combined analysis of DEPs and DEGs in the low-concentration group versus the control group. (B) Four-quadrant plot showing combined analysis of DEPs and DEGs in the high-concentration group versus the control group. Points with statistically significant differences are shown in different colours; non-significant data points are shown in grey. Thresholds: |log2 FC| > 0.263 for DEPs, > 0.585 for DEGs; P < 0.05. Red dots in Q1 quadrants indicate concordantly upregulated entities. Green dots in Q3 quadrants indicate concordantly downregulated entities. Blue dots in Q2 quadrants indicate entities with downregulated DEPs and upregulated DEGs. Pink dots in Q4 quadrants indicate entities with upregulated DEPs and downregulated DEGs. Data points were annotated using Ensembl database identifiers (release 113) mapped to protein names. (C) Correlation heatmap of integrated DEG/DEP analysis of the low-concentration group versus the control group. (D) Correlation heatmap of integrated DEG/DEP analysis of the high-concentration group versus the control group. DEG, differentially expressed gene; DEP, differentially expressed protein; FC, fold change; Q1, Quadrant 1; Q2, Quadrant 2; Q3, Quadrant 3; Q4, Quadrant 4.

To cross-validate expression consistency, correlation heatmaps were generated to illustrate the parallel relative abundance (Z-score) and Spearman's correlation coefficients (SCC) between the two omics layers (Fig. 5C and D). Notably, MDM2-binding protein (MTBP) in the low-concentration group exhibited a highly significant positive correlation (SCC = 1.000, p < 0.01), indicating tight transcriptional control. Conversely, target of myb1 membrane trafficking protein (TOM1) in the high-concentration group demonstrated a prominent negative correlation (SCC = −0.943, p < 0.05), highlighting prominent post-transcriptional regulatory events or decoupled protein-mRNA dynamics triggered under high-concentration intervention.

3.6. Camellia oil improved cutaneous-barrier function by promoting cell proliferation, migration, and differentiation of keratinocyte

To further investigate the molecular mechanisms suggested by the integrated transcriptomic and proteomic analyses, a series of in vitro cellular assays was performed to evaluate the effects of Camellia oil on keratinocyte. A notable increase in cell proliferation was observed at 24 h after 0.7% Camellia oil treatment, while no significant difference was seen with 0.35% Camellia oil treatment. After 48 h of treatment, we saw notable increases at concentration of both 0.7% and 0.35%, which did not significantly differ from each other (Fig. 6A). To further evaluate the effect of Camellia oil on cell migration, a wound healing assay was performed. After 24 h of treatment, only the highest concentration (1%) significantly promoted cell migration, whereas 0.1%, 0.4%, and 0.7% showed no significant effects (Fig. 6B). Representative wound images at 24 h are shown in Fig. 6D. We next investigated the effects of two selected concentrations (0.35% and 0.7%) over longer treatment periods. Treatment with 0.7% Camellia oil significantly enhanced cell migration after 48 and 72 h, whereas 0.35% Camellia oil had no significant effect compared with the untreated control. Moreover, cell migration was significantly higher in the 0.7% Camellia oil group than in the 0.35% Camellia oil group at both time points (Fig. 6C). Representative wound-healing images are presented in Fig. 6E. Camellia oil upregulated mRNA expression of FLG, IVL, TGM1, OCLN, HAS2, and HAS3 in a dose-dependent manner (Fig. 7A–D, F–G), but it did not alter CLDN expression (Fig. 7E). We also evaluated histamine release from BMMCs. Although Camellia oil treatment showed no significant inhibition of mast cell density in vivo, it exhibited a dose-dependent suppression of histamine release from mast cells in vitro (Fig. 7H).

Fig. 6.

In vitro effects of Camellia oil on HaCaT proliferation and migration. (A) Relative cell proliferation (fold change) at 24 and 48 h after Camellia oil treatment versus the vehicle group. (B) Relative cell migration (fold change) at 24 h after treatment with 0.1%, 0.4%, 0.7% or 1% Camellia oil versus the vehicle group. (C) Relative cell migration (fold change) 48 and 72 h after treatment with 0.35% and 0.7% Camellia oil versus the vehicle group. (D) Representative wound-healing images at 0 and 24 h after treatment with 1% Camellia oil compared with the vehicle group. Red dashed lines indicate the wound boundaries. (E) Representative wound-healing images at 0, 48 and 72 h after treatment with 0.35% or 0.7% Camellia oil compared with the vehicle group. Red solid lines indicate the wound boundaries. Data are shown as the mean ± SD; n = 5 per group. Scale bar = 500 μm for (D-E). **P < 0.01, ***P < 0.001 by one-way ANOVA for (A-C). N.S., no significant difference; SD, standard deviation.

Fig. 7.

In vitro effects of Camellia oil on HaCaT differentiation and histamine release from BMMCs. (A-G) Relative mRNA expression levels of FLG, IVL, TGM1, OCLN, CLDN, HAS2, and HAS3 in both treatment groups versus the vehicle group 24 h after Camellia oil treatment. (H) Relative histamine release (fold change) from BMMCs after Camellia oil treatment versus the control group. Data are shown as the mean ± SD; n = 3 per group. *P < 0.05, **P < 0.01, ***P < 0.001 by one-way ANOVA for (A-H). N.S., no significant difference; SD, standard deviation; BMMC, bone marrow-derived mast cell; FLG, filaggrin; IVL, involucrin; TGM1, transglutaminase-1; CLDN, claudin; OCLN, occludin; HAS, hyaluronan synthases.

4. Discussion

The present study provide evidence supporting the therapeutic potential of Camellia oil against XC and its beneficial effects on epidermal barrier function. These findings are supported by in vivo experiments, in vitro cellular assays, and integrated transcriptomic and proteomic analyses. Unlike previous studies, which mainly focused on the barrier-protective or anti-inflammatory effects of Camellia oil in AD or inflammatory cell models, the present study systematically investigated its therapeutic efficacy and dose-dependent pharmacological characteristics in XC by integrating an AEW-induced mouse model, cellular assays, transcriptomics, and proteomics. Importantly, integrated transcriptomic and proteomic analyses extended the understanding of Camellia oil from individual molecular targets and signalling pathways to coordinated regulatory networks at the systems level, providing mechanistic insights into its dose-dependent pharmacological effects. The overall experimental design followed a stepwise strategy in which in vivo observations generated biological hypotheses, integrated multi-omics analyses identified potential molecular mechanisms, and in vitro cellular assays were performed to further examine these hypotheses. This sequential approach provided a comprehensive understanding of the therapeutic potential of Camellia oil and the molecular processes that may underlie its effects against XC.

Impaired epidermal barrier integrity and reduced hydration of the SC are the central pathological features of XC. Moreover, most patients with XC experience pruritus, which induces repetitive scratching behaviour. Repeated scratching disrupts the epidermal barrier and promotes cutaneous inflammation, which can further exacerbate pruritus and perpetuate the itch-scratch cycle [50]. According to TCM, Camellia oil has long been used for the topical management of dry and pruritic skin because of its presumed heat-clearing and dampness-resolving properties. The present findings provide modern experimental evidence supporting this traditional use by demonstrating its potential to improve epidermal barrier function and alleviate XC-associated symptoms.

Chemical-composition analysis demonstrated that Camellia oil mainly consisted of glycerides derived from OA and LA, together with bioactive compounds including squalene and vitamin E (Fig. 1 and Table 2). OA- and LA-derived glycerides may improve epidermal barrier function by replenishing the ILM [4], whereas squalene and vitamin E possess well-documented anti-inflammatory and antioxidant activities that contribute to skin protection [12]. The unique chemical composition of Camellia oil has substantial therapeutic potential for managing XC.

The AEW-induced mouse model is widely recognized as one of the most representative experimental models of XC because it closely reproduces the major pathological features of the disease, including epidermal barrier dysfunction, reduced SC hydration, epidermal hyperplasia, spontaneous scratching behaviour, and chronic pruritus [32,51]. Therefore, it provides a reliable platform for evaluating therapeutic interventions targeting both skin barrier repair and pruritus. Using this model, we demonstrated that Camellia oil significantly alleviated XC manifestations, including reduced skin lesion scores, inhibition of abnormal epidermal thickening, and restoration of FLG expression (Fig. 2). FLG is a pivotal structural protein of the SC, mutations in which are associated with XC [52]. Notably, significant upregulation of FLG expression was observed after Camellia oil treatment, which was consistent with our earlier observations of LPS-induced HaCaT cells [24]. These findings suggested that Camellia oil may improve SC integrity by restoring FLG expression, thereby contributing to epidermal barrier repair.

Integrated multi-omics approaches have emerged as powerful tools for elucidating the complex molecular mechanisms underlying dermatological disorders by providing complementary information at both the transcriptomic and proteomic levels [53]. Compared with single-omics analyses, the integration of transcriptomics and proteomics enables a systems-level understanding of coordinated biological processes and improves the identification of key regulatory pathways involved in disease progression and therapeutic responses [46]. In the present study, integrated multi-omics analyses consistently indicated that Camellia oil regulates multiple biological processes associated with keratinocyte proliferation, migration, differentiation, and apoptosis (Fig. 3, Fig. 4, Fig. 5), providing mechanistic evidence that its therapeutic effects are mediated through coordinated regulation of molecular networks rather than a single signalling pathway.

Notably, the dose-dependent molecular response to Camellia oil was observed. Compared with the low-concentration treatment, the high-concentration of Camellia oil conferred dose-dependent differential advantages, including suppression of inflammation-associated cytokines/chemokines production, attenuation of cutaneous-stress responses, activation of immune defense and autophagy (Fig. 3, Fig. 4, Fig. 5). In our previous study, Camellia oil inhibited the release of inflammatory cytokine, including IL-1α, IL-8, and TSLP, in chemical- and inflammation-induced 3D skin models [22]. In addition, previous studies have demonstrated that Camellia oil suppresses IL-6 production in LPS-stimulated macrophages [25]. Although these cytokines were not directly measured in the present study, our transcriptomic and proteomic analyses revealed significant regulation of inflammation-related biological processes and signalling pathways, supporting the anti-inflammatory effects of Camellia oil observed in previous studies. Autophagy plays an important role in keratinocyte differentiation, skin immune defense and wound healing [54]. It has been reported that autophagy activation significantly improves the severity of pruritus in elderly patients; the underlying mechanism might be connected with maintaining skin barrier function, reducing inflammation, and modulating neuropathic pain [55]. These findings suggest that higher concentrations of Camellia oil may engage broader protective mechanisms involved in immune regulation and tissue repair.

Another notable finding was that only a limited number of DEGs and DEPs exhibited concordant expression changes, whereas several molecules displayed inconsistent transcriptional and protein expression patterns (Fig. 5). Such discrepancies are commonly observed in multi-omics studies and may reflect post-transcriptional regulation, differences in mRNA and protein stability, translational efficiency, or protein degradation [56,57]. These findings suggest that the biological effects of Camellia oil are regulated at multiple levels rather than being determined solely by transcriptional changes, further highlighting the importance of integrating transcriptomic and proteomic analyses.

The in vitro cellular assays further supported the multi-omics findings (Fig. 6). Camellia oil dose-dependently upregulated several epidermal barrier-related genes (Fig. 7A–D, F–G). As keratinocytes are the predominant cell type in the epidermis and are responsible for epidermal renewal and barrier maintenance [58], these findings support the potential barrier-repairing effects of Camellia oil. Although no significant difference in mast cell infiltration was observed in vivo (Fig. S1), Camellia oil dose-dependently inhibited histamine release from BMMCs in vitro (Fig. 7H), suggesting that its potential antipruritic effects.

Despite these promising findings, several limitations of the present study should be acknowledged. First, the in vivo experiments were conducted with a relatively small sample size (n = 5 per group), which may limit the statistical power of the analyses. Second, only male mice were included in the AEW-induced XC model; therefore, potential sex-specific differences in the therapeutic responses to Camellia oil warrant further investigation. Another limitation of this study is that a clinically established therapeutic agent was not included as a positive control in the animal experiments. Although the primary aim of this study was to elucidate the therapeutic mechanisms of Camellia oil, future studies comparing Camellia oil with standard anti-xerosis treatments will provide a more comprehensive assessment of its therapeutic efficacy and translational potential. In addition, although integrated transcriptomic and proteomic analyses provided systems-level insights into the molecular changes associated with Camellia oil treatment, these analyses were performed only in HaCaT keratinocytes, and the key molecular targets and signalling pathways identified by the multi-omics analyses were not further functionally validated using targeted molecular approaches. Further targeted molecular validation, together with studies incorporating additional skin cell types and clinical samples, will be necessary to clarify the causal roles of these molecular targets and pathways in the effects of Camellia oil against XC.

Overall, this integrated investigation provides a systematic understanding of the therapeutic effects and underlying mechanisms of Camellia oil against XC.

5. Conclusion

To our knowledge, this is the first study to comprehensively characterize the therapeutic efficacy and dose-dependent molecular mechanisms of Camellia oil against XC. Camellia oil showed therapeutic effects in mice, including ameliorating skin lesions, inhibiting abnormal epidermal thickening, and upregulating FLG expression. The barrier-repairing effects of Camellia oil are associated with enhanced keratinocyte proliferation, migration and differentiation. Camellia oil also showed potential to modulate molecular pathways associated with inflammation, immune defense, and autophagy in a dose-dependent manner. These effects might also contribute to the therapeutic mechanisms that underlie its efficacy in ameliorating XC.

Taken together, this study provides mechanistic insights into the effects of Camellia oil against XC and a theoretical basis for its potential application in cosmetics and pharmaceutical formulations.

CRediT authorship contribution statement

Ai Li: Writing – review & editing, Writing – original draft, Visualization, Validation, Methodology, Investigation, Formal analysis, Data curation. Qing Jiang: Writing – review & editing, Methodology, Investigation, Formal analysis, Conceptualization. Ting-Huan Fang: Methodology, Investigation, Formal analysis, Data curation. Yun-Jie Jiang: Methodology, Investigation, Formal analysis, Data curation. Hao-Miao Zhou: Investigation. Xiao-Xia Li: Methodology. Ting Zheng: Methodology. Yi-Lun Xie: Writing – review & editing. Xing-You Pan: Writing – review & editing. Li-Rong Tang: Conceptualization.

Ethics declaration

This study was conducted in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines. This study was approved by the Welfare and Ethical Committee for Experimental Animal Care of Guangdong Heli Biotechnology Co, Ltd. (Approval No. HL-20240806)

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Abbreviations:

XC

xerosis cutis

AEW

acetone-ether-water

FLG

filaggrin

AD

atopic dermatitis

T2D

type 2 diabetes

CKD

chronic kidney disease

SC

stratum corneum

Tg

triglyceride

FFA

free fatty acid

ILM

intercellular lipid matrix

TCM

traditional Chinese medicine

3D

three-dimensional

IL

interleukin

TSLP

thymic stromal lymphopoietin

DNCB

2,4-dinitrochlorobenzene

MAPK

mitogen-activated protein kinase

KLK7

kallikrein-related peptidase 7

mRNA

messenger ribonucleic acid

LPS

lipopolysaccharide

NO

nitric oxide

PEG2

polyethylene glycol 2

TNF-α

tumour necrosis factor-α

iNOS

inducible nitric oxide synthase

COX-2

cyclooxygenase-2

KOH

potassium hydroxide

NaHSO₄

sodium bisulfate

Na₂SO₄

anhydrous sodium sulphate

BHT

butylated hydroxytoluene

CAS

Chemical Abstracts Service

FAME

fatty acid methyl ester

Ab

antibody

DMEM

Dulbecco's Modified Eagle's Medium

RPMI-1640

Roswell Park Memorial Institute 1640

FBS

foetal bovine serum

EDTA

ethylenediaminetetraacetic acid

P&S

penicillin and streptomycin

SCF

stem cell factor

CCK-8

Cell Counting Kit-8

DAB

3,3′-diaminobenzidine

BMMC

bone marrow-derived mast cell

GC

gas chromatography

HPLC

high-performance liquid chromatography

TEWL

transepidermal water loss

PFA

paraformaldehyde

H&E

haematoxylin and eosin

IHC

immunohistochemistry

HRP

horseradish peroxidase

NIH

National Institutes of Health

RNA

ribonucleic acid

RIN

RNA integrity number

FC

fold change

GO

Gene Ontology

KEGG

Kyoto Encyclopedia of Genes and Genomes

DAVID

Database for Annotation, Visualization and Integrated Discovery

PPI

protein-protein interaction

STRING

Search Tool for the Retrieval of Interacting Genes/Proteins

MCODE

Molecular Complex Detection

DIA

data-independent acquisition

BCA

bicinchoninic acid

MS

mass spectrometry

FASP

filter-assisted sample preparation

BBH

Bidirectional Best Hit

IVL

involucrin

TGM1

transglutaminase-1

CLDN

claudin

OCLN

occludin

HAS

hyaluronan synthases

RT-qPCR

Real-time quantitative polymerase chain reaction

cDNA

complementary deoxyribonucleic acid

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

SD

standard deviation

ANOVA

analysis of variance

OA

oleic acid

LA

linoleic acid

PA

palmitic acid

SA

stearic acid

DEG

differentially expressed gene

BP

Biological Process

DNA

deoxyribonucleic acid

DEP

differentially expressed protein

PI3K

phosphatidylinositol 3-kinase

Akt

protein kinase B

NF-κB

nuclear factor κ-light-chain-enhancer of activated B cells

TGF-β

transforming growth factor-β

HIF-1

hypoxia-inducible factor 1

ER

endoplasmic reticulum

ERK

extracellular signal-regulated kinases

EGFR

epidermal growth factor receptor

TKI

tyrosine kinase inhibitor

HPV

human papillomavirus

SCC

Spearman's correlation coefficient

MTBP

MDM2-binding protein

TOM1

target of myb1 membrane trafficking protein

G1

gap 1

Appendix A. Supplementary data

The following is the Supplementary data to this article.

Data availability

Data will be made available on request.