Dietary Perovskia abrotanoides essential oil and vitamin E improve performance, antioxidant status, and intestinal morphology in laying Japanese quails fed oxidized oil

Abstract

This study investigated the effects of dietary oxidized oil, Perovskia abrotanoides essential oil (PAEO), and vitamin E (VE) on productive performance, egg quality, antioxidant status, intestinal morphology, and hepatic gene expression in laying Japanese quails. A total of 480 48-day-old quails were randomly assigned to 8 experimental groups (6 replicates of 10 birds each) in a factorial arrangement (2 × 2 × 2). The factors included oxidized sunflower oil (0 and 2%; peroxide value: 144 mEq O₂/kg), PAEO (0 and 200 mg/kg), and VE (0 and 200 mg/kg) during a 7-week trial. Dietary oxidized oil significantly (P < 0.05) impaired egg production and egg mass, increased feed conversion ratio (FCR), reduced eggshell quality, elevated egg yolk malondialdehyde (MDA), and disrupted intestinal morphology. It also induced oxidative stress, as evidenced by altered hematological and biochemical indices, an unfavorable serum lipid profile, and up-regulation of hepatic Nrf2, SOD, GPx, and NF-κB p65 gene expression. Dietary supplementation with PAEO or VE effectively mitigated these adverse effects, restoring production efficiency, egg oxidative stability, and intestinal integrity. Significant two-way and three-way interactions (P < 0.05) were observed for several hematological, biochemical, lipid-related, and antioxidant variables; notably, the combined inclusion of PAEO and VE improved hematological recovery and reduced serum triglycerides and LDL under oxidative challenge. Furthermore, PAEO and VE each down-regulated hepatic antioxidant- and inflammation-related gene expression, consistent with reduced oxidative burden. In conclusion, dietary PAEO, particularly when combined with VE, represents an effective nutritional strategy to protect laying quails against oxidized oil–induced oxidative damage and productivity loss.

Introduction

Dietary lipids are widely incorporated into poultry diets as concentrated sources of metabolizable energy and to facilitate the absorption of fat-soluble vitamins and essential fatty acids (Murugesan et al., 2015). However, the nutritional quality of dietary oils depends largely on their oxidative stability. During storage and feed processing, exposure of lipids to oxygen, heat, or light can initiate lipid peroxidation and generate hydroperoxides and secondary oxidation products such as aldehydes and ketones (Dibner et al., 1996; Oke et al., 2024). These oxidized compounds can reduce the nutritional value of feed and exert deleterious physiological effects when consumed by poultry. Previous studies have shown that dietary oxidized oils may impair growth performance, reduce feed efficiency, and increase oxidative damage in avian tissues (Dibner et al., 1996; Liang et al., 2015). Oxidative stress induced by oxidized lipids results from an imbalance between the production of reactive oxygen species (ROS) and the capacity of the antioxidant defense system. Excessive ROS can initiate lipid peroxidation, damage cellular proteins and nucleic acids, and disrupt membrane integrity (Mishra and Jha, 2019; Oke et al., 2024). In poultry, the gastrointestinal tract is particularly susceptible to oxidative injury because it represents the first tissue exposed to dietary oxidants. Damage to intestinal epithelial cells may disrupt villus morphology, impair nutrient absorption, and compromise barrier integrity, thereby adversely affecting bird performance and health (Nanto-Hara et al., 2020). Therefore, nutritional strategies aimed at enhancing antioxidant defenses have received considerable attention as a means of mitigating oxidative stress associated with oxidized dietary lipids. Among dietary antioxidants, vitamin E (α-tocopherol; VE) is recognized as one of the most effective lipid-soluble antioxidants in biological systems. VE protects polyunsaturated fatty acids in cellular membranes against peroxidative damage by interrupting free radical chain reactions (Panda and Cherian, 2014). In poultry, dietary VE supplementation has been shown to improve antioxidant capacity, enhance immune responses, and reduce lipid peroxidation under various stress conditions. Consequently, VE is widely used in poultry nutrition to limit oxidative tissue damage and maintain performance under dietary or environmental stress (Niu et al., 2009; Surai et al., 2019b). In addition to classical antioxidants, increasing interest has been directed toward plant-derived phytogenic feed additives as natural alternatives for improving poultry health and productivity. Essential oils from aromatic and medicinal plants contain bioactive compounds, including phenolics and terpenoids, with antioxidant, antimicrobial, and anti-inflammatory properties (Abdelli et al., 2021; Windisch et al., 2008; Zeng et al., 2015). These compounds may enhance digestive efficiency, modulate intestinal microbiota, and improve gut morphology, thereby contributing to improved nutrient utilization and overall performance in poultry (Gadde et al., 2017). Perovskia abrotanoides (PA), a medicinal plant of the Lamiaceae family traditionally valued for its pharmacological properties, produces an essential oil rich in monoterpenes such as 1,8-cineole, camphor, and α-pinene. These compounds exhibit notable antioxidant and free-radical scavenging activities and may contribute to protection against oxidative stress (Sajjadi et al., 2005). Despite the recognized antioxidant potential of phytogenic compounds and the established protective role of VE, limited information is available regarding the possible complementary effects of Perovskia abrotanoides essential oil (PAEO) and VE in poultry diets containing oxidized oils. At the molecular level, cellular antioxidant defense mechanisms are largely regulated by redox-sensitive signaling pathways. The nuclear factor erythroid 2–related factor 2 (Nrf2) pathway plays a central role in cellular redox homeostasis by inducing antioxidant enzymes such as superoxide dismutase (SOD) and glutathione peroxidase (GPx) (Surai et al., 2019a). Conversely, excessive oxidative stress may activate NF-κB–mediated inflammatory signaling, including the p65 subunit, thereby promoting the expression of inflammatory mediators (Lingappan, 2018; Liu et al., 2017). Evaluating the expression of these genes can therefore provide mechanistic insight into the antioxidant and anti-inflammatory effects of dietary interventions in poultry. The Japanese quail (Coturnix japonica) is an important avian model in poultry research because of its early sexual maturity, high laying rate, and short production cycle, which allows efficient and economical egg production (Liu et al., 2025). However, the combined protective effects of dietary PAEO and VE against lipid oxidation-induced stress in laying quails remain largely unexplored. We hypothesized that PAEO and VE, individually or in combination, would exert additive or interactive defenses against oxidized oil, thereby alleviating systemic oxidative stress and maintaining productive and physiological integrity. Therefore, this study evaluated the single and combined effects of PAEO and VE on productive performance, egg quality, redox status, intestinal histomorphology, and hepatic antioxidant/anti-inflammatory gene expression in laying Japanese quails subjected to dietary oxidized oil.

Material and methods

Preparation of PAEO

Fresh aerial parts of PA (leaves and flowers) were collected during the flowering season from their natural habitat in Taftan Mountains, Sistan and Baluchestan, Iran. The plant material was authenticated by the Herbarium of the Plant Production Department, University of Saravan, Iran. The collected parts were thoroughly washed with distilled water to remove dust and impurities, and then air-dried in a shaded, well-ventilated area at room temperature (25 ± 2°C) for 5–7 days until a constant weight was achieved. The dried materials were subsequently coarsely ground using a mechanical grinder. For essential oil extraction, 200 g of the ground material was subjected to hydrodistillation using a Clevenger-type apparatus with 2 L of distilled water for 3 h. The extracted essential oil was separated, dehydrated over anhydrous sodium sulfate, and stored at 4°C in dark glass vials until further use.

Birds, husbandry and treatments

A total of 480 38-day-old laying Japanese quails (Coturnix japonica) with an average weight of 160 ± 0.96 g were obtained from a local hatchery. After a 10-day acclimation period on a commercial diet, the 48-day-old quails were randomly distributed into 8 experimental groups, each consisting of 6 replicates with 10 birds per replicate. The birds were individually housed in separate standard wire cages (50 × 30 × 50 cm) equipped with individual nipple drinkers, feeders, and metal trays for excreta collection. A completely randomized design was employed using a 2 × 2 × 2 factorial arrangement. The experimental factors included oxidized sunflower oil (0 and 2% of diet, peroxide value 144 mEq O₂/kg), PAEO (0 and 200 mg/kg of diet), and VE (α-Toc) (0 and 200 mg/kg of diet). Diets were prepared in mash form. Oxidized sunflower oil was prepared by heating fresh sunflower oil at 70–80°C with continuous aeration until reaching a peroxide value of 144 mEq O₂/kg (AOCS, 2009). To ensure precise dosage and homogeneous distribution, a stock oil solution was prepared by diluting PAEO in fresh sunflower oil at a (1:10) v/v ratio, accounting for the specific gravity of the PAEO (0.90 g/mL). To attain the targeted dietary concentration of 200 mg/kg active PAEO, 2.44 mL of this stock solution was initially hand-mixed into 1 kg of the basal mash to prepare a primary premix, which was subsequently blended into the bulk diet using stepwise geometric dilution to guarantee uniform distribution. Supplemental vitamin E was supplied as DL-α-tocopheryl acetate powder (Razak Laboratories, Tehran, Iran) at 200 mg/kg diet (active substance basis), added on top of the background level provided by the basal vitamin premix (11 mg/kg diet). The required amount was pre-mixed with 1 kg of basal feed before being progressively incorporated into the total batch using a similar stepwise dilution protocol. Washed sand was included as an inert filler to balance the dietary inclusions across all experimental treatments. The trial duration was 7 weeks, with birds given ad libitum access to feed and water throughout the period. Birds were maintained on a 17L:7D photoperiod throughout the experiment. Corn–soybean meal–based diets were formulated to be isonitrogenous and isocaloric following the National Research Council (NRC, 1994) recommendations (Table 1). All procedures involving animals were conducted in accordance with protocols approved by the Animal Ethics Committee of the University of Saravan.

Table 1.

Chemical composition of the basal diets (g/kg on an as fed basis).

Ingredient	Non-oxidized oil diet	Oxidized oil diet
Corn	560	560
Soybean meal (440 g/kg CP)	290	290
Corn gluten meal (600 g/kg CP)	35.1	35.1
Non-oxidized sunflower oil	32.4	12.4
Oxidized sunflower oil	-	20
CaCO3	53	53
Dicalcium phosphate	16	16
Sodium chloride	2.7	2.7
Sodium bicarbonate	1.1	1.1
DL-Methionine (99%)	1.5	1.5
L-Lysine HCl (78.8%)	0.9	0.9
L-Threonine (98.5%)	0. 8	0. 8
Vitamin premixa	2.5	2.5
Mineral premixb	2.5	2.5
Washed sand	1.5	1.5
Calculated nutrients and energy
AME, (kcal/kg)	2950	2950
Crude protein	200	200
L-Lysine	10.3	10.3
DL-Methionine	4.8	4.8
TSAA	8.1	8.1
Calcium	24.8	24.8
Nonphytate P	4.5	4.5
Total P	6.4	6.4
Analyzed values
Crude protein	199.4	199.4
L-Lysine	10.1	10.1
DL-Methionine	4.5	4.5
TSAAc	7.8	7.8
Calcium	24.6	24.6
Total P	6.2	6.2

^aVitamin mixture provided per kg of diet: 11000 IU of vitamin A, 1800 IU of vitamin D₃, 11 mg of vitamin E, 2 mg of vitamin K3, 4 mg of vitamin B1, 5.7 mg of vitamin B2, 2 mg of vitamin B6, 0.5 mg of folic acid, 2500 mg of choline chloride, 0.125 mg of antioxidants, 0.03 mg of Biotin and 0.024 mg of vitamin B12.

^bMineral mixture provided per kg of diet: 500 mg of FeSO4, 65 mg of CuSO4, 100 mg of MnSO4, 0.5 mg of Iodine and 0.22 mg of Selenium.

^cTotal sulfur amino acids.

Productive performance

Egg number and weight were recorded daily throughout the experiment, and these data were used to calculate hen-day egg production (%). Weekly feed intake was measured for each cage. At the conclusion of the trial, the feed conversion ratio (FCR) was determined by dividing total feed consumed (g) by the total egg mass (g). Defective eggs, including those that were broken, cracked, shell-less, or otherwise abnormal, were recorded daily upon collection. Egg mass was calculated by multiplying hen-day egg production (%) by the average egg weight (g). Bird mortality was recorded daily, and the body weight of dead birds was measured immediately after death.

Egg quality traits

During the final 4 days of the experiment, all eggs produced in each replicate were collected daily and stored at 4°C. Subsequently, 3 eggs per replicate were randomly selected and allowed to reach room temperature before the assessment of internal and external egg quality. A Mitutoyo digital micrometer (series 500) was used to measure the width and length of each egg. The egg shape index (ESI) was then calculated according to the following formula described by Anderson et al. (2004).

$$\text{ESI}(\%)=\left(\text{Egg}\text{width}/\text{Egg}\text{length}\right)\times 100$$

Egg internal quality was evaluated by breaking the eggs onto a flat glass plate. Albumen height (mm) was measured using a digital micrometer at the midpoint between the yolk and the edge of the thick albumen. Yolks were gently separated from the albumen, blotted on a damp paper towel to remove residual albumen, and then weighed. The yolk index (YI) was calculated as the ratio of yolk height to yolk diameter (Funk, 1948). Yolk color (YC) was assessed using a DSM Yolk Color Fan, ranging from 1 (light yellow) to 15 (dark orange). Eggshells were rinsed with distilled water, air-dried at room temperature for 24 hours, and then weighed. Albumen weight was calculated by subtracting the combined weight of the yolk and dry shell from the total egg weight. Shell thickness was assessed at three separate points (equatorial, blunt, and pointed ends) using a digital micrometer (accuracy 0.01 mm). The mean of these three measurements was calculated to determine the average shell thickness. Egg albumen quality was evaluated by calculating the Haugh unit (HU) following the method of Sari et al. (2016) using the following standard equation:

$$\text{HU}=100\times \text{lo}{\mathrm{g}}_{10}\left(H-1.7W^{0.37}+7.57\right)$$

where H is the thick albumen height (mm) and W is the egg weight (g).

The weights of the eggshell, yolk, and albumen were expressed as percentages relative to the total egg weight.

Determination of egg yolk MDA concentration

To evaluate the impact of experimental treatments on the concentration of malondialdehyde (MDA) in egg yolks, a total of six eggs per replicate were sampled at the end of the experiment. This included the yolks recovered from the three eggs previously broken for quality trait assessments, along with yolks from three additional eggs per replicate collected specifically for biochemical analysis. The yolks collected from the six eggs per replicate were pooled in pairs, resulting in three composite samples per replicate for MDA quantification. MDA concentration, as an indicator of lipid peroxidation, was measured in fresh yolks and those stored at 4°C for 15 and 30 days, respectively, using the thiobarbituric acid reactive substances (TBARS) assay according to Ohkawa et al. (1979). To measure TBARS, 6 mL of a trichloroacetic acid (TCA) solution (containing 7.5% TCA, 0.1% EDTA, and 0.1% propyl gallate dissolved in 3 mL of ethanol) was added to each yolk sample. Samples were homogenized with a high-speed Polytron for 15 s and then passed through Whatman No. 1 filter paper. One mL of the filtrate was transferred to a test tube and mixed with 1 mL of 0.02 M TBA solution. The tube contents were mixed thoroughly, then incubated in a water bath at 100°C for 40 min. After heating, the tubes were immediately cooled in ice water for 5 min. Tubes were then centrifuged at 2,000 rpm for 5 min, and the absorbance of the supernatant was measured at 530 nm using a spectrophotometer. TBARS values were expressed as mg MDA per kg of yolk.

Blood sampling and biochemical analysis

At the end of the experimental period, one bird per replicate was randomly selected. The birds were deprived of feed for 8 h and then slaughtered according to standard halal procedures. Blood samples were collected from the jugular vein into sterile tubes containing EDTA for hematological analysis. Red blood cell count (RBC), white blood cell count (WBC), hemoglobin concentration (Hb), and differential leukocyte counts, including monocytes, lymphocytes, and heterophils, were determined according to standard procedures described by Schalm et al. (1975). Separate blood samples were collected into sterile tubes without anticoagulant, allowed to clot at room temperature for approximately 20 min, and then centrifuged at 3,000 × g for 15 min to obtain serum. Serum samples were stored at −20°C until analysis. Analyses of serum total protein, albumin, globulin, creatinine, uric acid, the activities of alkaline phosphatase (ALP), aspartate aminotransferase (AST), and alanine aminotransferase (ALT), and lipid-profile parameters (total cholesterol, triglycerides, HDL, LDL, and VLDL) were performed on an automatic biochemical analyzer (A15 autoanalyzer, Biosystems S.A., Barcelona, Spain). Serum globulin was calculated by subtracting albumin from total protein.

Liver and serum antioxidant capacity

Serum antioxidant parameters, including total antioxidant capacity (TAC, mmol/L), malondialdehyde (MDA, nmol/mL), glutathione peroxidase (GSH-Px, U/mL), and superoxide dismutase (SOD, U/mL), were determined using a spectrophotometer (PharmaSpec 1700, Shimadzu, Kyoto, Japan) with commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China). Liver samples were carefully excised from slaughtered quail and rinsed in ice-cold 0.9% physiological saline (NaCl). Approximately 0.5 g of liver tissue was minced and homogenized in an ice-cold 0.9% NaCl solution (1:9, w/v) using a glass homogenizer. The homogenate was centrifuged at 1,346 × g for 10 min at 4°C, and the resulting supernatant was collected and stored at −80°C until analysis. The MDA concentration and the activities of SOD and GSH-Px in the liver supernatant, were measured spectrophotometrically using the same commercial assay kits described above.

Intestinal histomorphology

At the end of the experiment, the intestines of slaughtered birds were removed, and a 1.5- cm segment was excised from the mid-jejunum. Samples were rinsed in cold physiological saline (0.9% NaCl, pH 7.2) and fixed in 10% neutral buffered formalin for histological analysis. The fixed tissue samples were progressively dehydrated through a graded alcohol series, cleared, and embedded in paraffin. The paraffin blocks were then sectioned into 5-µm-thick sections, mounted on glass slides, and stained with hematoxylin and eosin (H&E). Morphometric evaluations were performed in a blinded manner with respect to dietary treatments. For each bird, 20 intact, well-oriented villi and 20 crypts were randomly selected and measured under an optical microscope equipped with image analysis software (Olysia, Germany). Villus surface area was calculated according to Sakamoto et al. (2000) using the following formula:

$$\text{Villus}\text{surface}\text{area}\left(\mu m^2\right)=2\pi \times \left(\text{villus}\text{width}/2\right)\times \text{villus}\text{height}$$

RNA extraction and reverse transcription

Hepatic total RNA was extracted from 6 birds per treatment using the RNX-plus kit (Cat. No. EX6101, SinaClon, Iran) in accordance with the manufacturer’s instructions. RNA concentration and purity were assessed by determining the absorbance ratio at 260 and 280 nm (A260/A280) ratio via a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Following quantification, the isolated RNA was stored at −80°C. First-strand cDNA synthesis was subsequently performed using a two-step RT-PCR kit (Cat. No. RTPL12, Vivantis Technologies) according to the manufacturer’s protocol.

Quantitative real-time PCR

To quantify the relative mRNA abundance of Nrf2, SOD, GPx, and NF-κB p65 (RELA), quantitative real-time PCR (qRT-PCR) was conducted using an Applied Biosystems real-time PCR system (48-well; Thermo Fisher Scientific, Waltham, MA, USA). Each reaction mixture comprised cDNA template, SYBR Green PCR Master Mix (Applied Biosystems), and gene-specific primers. Specific primers for both target genes and the reference gene (β-actin) (Table 2) were designed using NCBI Primer-BLAST and evaluated for quality using OligoAnalyzer 3.1 (Integrated DNA Technologies). All samples were analyzed in technical triplicate. The thermocycling profile consisted of an initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 58.5–62°C (depending on the target gene) for 30 s, and extension at 72°C for 30 s, followed by a melting-curve analysis from 60 to 95°C to confirm amplification specificity. Relative gene expression levels were calculated using the 2^−ΔΔCt method (Livak and Schmittgen, 2001).

Table 2.

Primer sequences for quantitative real-time PCR (qRT-PCR) analysis.

Gene	Primer sequence (5`−3`)	Annealing temperature (°C)	product length (bp)	Accession no.
Nrf2a	Fe: GCAAAGGGGGACAGTGACAC	61°C	104	XM_015868403.2
	Rf: GCTCTCCACAGCGGGAAATC
SODb	F: GGGGGTGGCTTGGCTATAA	59.7°C	100	XM_015858046.2
	R: AGCAATGGAATGAGACCTGTT
GPxc	F: TTGGGGAATGCCATCAAGTG	58.5°C	87	XM_015886370.2
	R: ATCCTCCATTGGGCTGTATCTC
NF-κB p65d	F: GAGTTTGCTGCCCCTCTTTGTCA	62°C	110	XM_032441811
	R: CTGCTCCAGGATCTCCACGTATG
β-actin	F: AACACCCACACCCCTGTGAT	60°C	136	XM_015876619.1
	R: TGAGTCAAGCGCCAAAAGAA

^aNrf2: Nuclear factor erythroid 2-related factor 2.

^bSOD: Superoxide dismutase.

^cGPx: Glutathione peroxidase.

^dNF-B p65: Nuclear factor kappa-B (NF-κB) p65 subunit (RelA).

^dF: Forward primer primer.

^eR: Reverse primer.

Statistical analysis

Data were analyzed using the GLM procedure of SAS software (version 9.4; SAS Institute Inc., Cary, NC, USA) as a completely randomized design with a 2 × 2 × 2 factorial arrangement. The main factors included dietary oxidized oil (0 and 2% of the diet), PAEO (0 and 200 mg/kg of diet), and VE (0 and 200 mg/kg of diet). Treatment means were compared using Duncan’s multiple range test. Differences were considered statistically significant at p ≤ 0.05.

Results

Productive performance

The effects of oxidized oil, PAEO, and VE on the productive performance of laying quail are presented in Table 3. The inclusion of 2% oxidized oil in the diet significantly deteriorated all performance parameters, decreasing egg production, egg weight, feed intake, and egg mass, while increasing the FCR (P < 0.0001). In contrast, dietary supplementation with PAEO significantly improved all measured performance variables (P < 0.0001). Similarly, VE supplementation enhanced all performance parameters (P < 0.0001), except for feed intake, which remained unaffected (P = 0.187). A significant oxidized oil × PAEO interaction was observed for all performance parameters (P ≤ 0.030). The addition of PAEO to either fresh or oxidized oil diets significantly improved egg production, egg weight, egg mass, and FCR; for instance, under oxidative stress, PAEO increased egg production from 65.50% to 71.86% and reduced FCR from 3.19 to 2.81 in diets lacking VE. However, the stimulatory effect of PAEO on feed intake was primarily observed in diets containing fresh oil (26.00 vs. 24.23 g/quail/day). Furthermore, a significant oxidized oil × VE interaction was noted for egg production, egg mass, and FCR (P < 0.05), indicating that VE supplementation partially mitigated the adverse impacts of oxidized oil and improved these traits in both diet types (e.g., restoring egg production from 65.50% to 70.19% and egg mass from 7.13 to 7.87 g in oxidized oil diets without PAEO). Additionally, a significant PAEO ×VE interaction was found for egg production, egg weight, egg mass, and FCR (P < 0.0001). This interaction demonstrated a combined effect, where the co-supplementation of PAEO and VE led to the greatest improvements in these parameters, regardless of the oxidative status of the dietary oil (yielding the highest overall egg production of 87.47%, egg weight of 12.36 g, and the lowest FCR of 2.32 across treatments). No significant three-way interactions were observed for any of the performance traits (P > 0.05).

Table 3.

Productive performance of laying Japanese quails fed oxidized oil–containing diets supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			Variables
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	Egg production (hen-day %)	Egg weight (g)	Feed intake (g/quail/day)	Feed conversion ratio (FCR, g feed/g egg)	Egg mass (g)
0	0	0	76.91a	11.54a	24.23a	2.72a	8.88a
0	0	200	78.59a	11.61a	24.86a	2.72a	9.12a
0	200	0	80.05a	11.46a	26.00a	2.83a	9.18a
0	200	200	87.47a	12.36a	26.07a	2.41a	10.81a
2	0	0	65.50a	10.89a	22.78a	3.19a	7.13a
2	0	200	70.19a	11.21a	22.88a	2.91a	7.87a
2	200	0	71.86a	11.38a	22.99a	2.81a	8.17a
2	200	200	80.82a	12.33a	23.16a	2.32a	9.97a
SEM			0.787	0.073	0.258	0.042	0.101
Main effect
Oxidized oil		0	80.75a	11.74a	25.29a	2.67a	9.50a
		2	72.09a	11.45a	22.95a	2.81a	8.28a
PAEO		0	72.80a	11.31a	23.69a	2.89a	8.25a
		200	80.05a	11.88a	24.55a	2.59a	9.53a
VE		0	73.58a	11.32a	24.00	2.89a	8.34a
		200	79.27a	11.88a	24.24	2.59a	9.44a
						P
Oxidized oil			<.0001	<.0001	<.0001	<.0001	<.0001
PAEO			<.0001	<.0001	<.0001	<.0001	<.0001
VE			<.0001	<.0001	0.187	<.0001	<.0001
Oxidized oil × PAEO			0.030	<.0001	0.001	<.0001	0.0002
Oxidized oil × VE			0.047	0.135	0.563	0.005	0.027
PAEO × VE			<.0001	<.0001	0.503	<.0001	<.0001
Oxidized oil × PAEO × VE			0.515	0.341	0.398	0.081	0.255

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Egg quality traits

The effects of dietary treatments on egg quality traits are presented in Table 4. The inclusion of oxidized oil in the diet significantly reduced shell weight, shell thickness, and yolk weight, while increasing albumen weight (P < 0.0001). In contrast, dietary supplementation with PAEO and VE independently increased shell weight, shell thickness, yolk weight, and albumen weight compared with the unsupplemented groups (P < 0.01). None of the experimental treatments affected yolk index, yolk color, egg shape index, or Haugh unit (P > 0.05). A significant oxidized oil × PAEO interaction was observed for shell weight, shell thickness, and yolk weight (P < 0.05). Specifically, PAEO supplementation attenuated the negative effects of oxidized oil, improving these parameters in stressed birds; for instance, in the presence of oxidized oil, PAEO increased shell weight from 0.836 to 0.921 g and yolk weight from 3.045 to 3.223 g in diets without VE. A similar oxidized oil × VE interaction was observed for shell weight (P = 0.002) and yolk weight (P < 0.0001), wherein the addition of VE partially alleviated the adverse impacts of oxidative stress. Furthermore, a significant PAEO × VE interaction was detected for shell weight, shell thickness, and albumen weight (P < 0.05). The combined supplementation of PAEO and VE demonstrated a pronounced improvement in these traits, especially under oxidative stress (yielding the highest overall shell weight of 1.058 g, shell thickness of 0.229 mm, and albumen weight of 7.76 g among the oxidized oil groups). No significant three-way interactions were observed for any of the evaluated egg quality parameters (P > 0.05).

Table 4.

Egg quality traits of laying Japanese quails fed diets containing oxidized oil supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			Variables
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	Shell weight (g)	Shell thickness (mm)	Yolk weight (g)	Yolk index	Yolk colour	Albumen weight (g)	Egg shape index (%)	Haugh unit
0	0	0	1.083a	0.217a	3.733a	47.70	5.26	6.73a	77.46	86.40
0	0	200	1.061a	0.220a	3.761a	47.89	5.25	6.79a	77.57	86.73
0	200	0	1.093a	0.220a	3.798a	48.20	5.29	6.57a	77.15	86.32
0	200	200	1.125a	0.250a	3.808a	47.71	5.27	7.42a	77.54	86.69
2	0	0	0.836a	0.176a	3.045a	47.52	5.26	7.01a	77.61	85.94
2	0	200	0.900a	0.186a	3.208a	48.18	5.29	7.10a	77.71	86.56
2	200	0	0.921a	0.188a	3.223a	47.70	5.28	7.23a	77.57	86.68
2	200	200	1.058a	0.229a	3.513a	48.03	5.29	7.76a	77.56	86.76
SEM			0.021	0.003	0.026	0.411	0.025	0.075	0.183	0.313
Main effect
Oxidized oil		0	1.090a	0.227a	3.775a	47.87	5.26	6.88a	77.43	86.53
		2	0.929a	0.195a	3.247a	47.85	5.28	7.27a	77.61	86.49
PAEO		0	0.970a	0.200a	3.437a	47.82	5.26	6.91a	77.59	86.41
		200	1.049a	0.222a	3.585a	47.91	5.28	7.25a	77.46	86.61
VE		0	0.983a	0.200a	3.450a	47.78	5.27	6.88a	77.45	86.33
		200	1.036a	0.221a	3.572a	47.95	5.27	7.27a	77.60	86.68
							P
Oxidized oil			<.0001	<.0001	<.0001	0.945	0.376	<.0001	0.171	0.834
PAEO			<.0001	<.0001	<.0001	0.756	0.268	<.0001	0.319	0.363
VE			0.001	<.0001	<.0001	0.552	0.981	<.0001	0.260	0.121
Oxidized oil × PAEO			0.007	0.031	<.0001	0.795	0.698	0.067	0.766	0.243
Oxidized oil × VE			0.002	0.076	<.0001	0.271	0.330	0.184	0.431	0.997
PAEO × VE			0.040	<.0001	0.156	0.389	0.665	<.0001	0.732	0.576
Oxidized oil × PAEO × VE			0.739	0.601	0.060	0.763	0.981	0.094	0.453	0.526

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Egg yolk MDA concentration

As shown in Table 5, the main effects of oxidized oil, PAEO, and VE on the MDA content of fresh egg yolks, as well as yolks stored for 15 and 30 days at 4°C, were highly significant (P ≤ 0.030). The inclusion of oxidized oil in the diet increased the yolk MDA content, with the magnitude of lipid peroxidation intensifying as storage time progressed (0.057 vs. 0.028, 0.250 vs. 0.190, and 0.535 vs. 0.341 mg/kg for fresh, 15-day, and 30-day stored eggs, respectively; P < 0.001). In contrast, dietary supplementation with either PAEO or VE significantly decreased the MDA content in both fresh and stored eggs (P ≤ 0.030). Significant oxidized oil × PAEO and oxidized oil × VE interactions were observed exclusively for the MDA content of yolks after 30 days of storage (P < 0.0001). These interactions indicated that the addition of PAEO to diets containing oxidized oil markedly suppressed MDA accumulation; for instance, under oxidative stress, PAEO reduced 30-day MDA from 0.700 to 0.500 mg/kg in diets without VE. Similarly, VE supplementation significantly lowered the MDA content in eggs from the oxidized oil groups (reducing MDA from 0.700 to 0.544 mg/kg in oxidized diets without PAEO). Furthermore, the combined inclusion of PAEO and VE in oxidized diets further minimized the 30-day MDA content to 0.400 mg/kg, demonstrating a notable protective effect against lipid peroxidation during prolonged storage. No significant PAEO × VE or oxidized oil × PAEO × VE interactions were observed for any of the storage periods (P > 0.05).

Table 5.

Egg yolk MDA concentration of laying Japanese quails fed diets containing oxidized oil supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			MDA of egg yolk (mg/kg)
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	Fresh egg	After 15 days at 4°C	After 30 days at 4°C
0	0	0	0.044	0.221	0.360a
0	0	200	0.035	0.195	0.343a
0	200	0	0.025	0.191	0.351a
0	200	200	0.010	0.151	0.310a
2	0	0	0.081	0.300	0.700a
2	0	200	0.063	0.251	0.544a
2	200	0	0.056	0.242	0.500a
2	200	200	0.030	0.211	0.400a
SEM			0.010	0.009	0.015
Main effect
Oxidized oil		0	0.028a	0.190a	0.341a
		2	0.057a	0.250a	0.535a
PAEO		0	0.056a	0.239a	0.484a
		200	0.030a	0.195a	0.390b
VE		0	0.052a	0.235a	0.477a
		200	0.034a	0.202a	0.393a
					P
Oxidized oil			0.0005	<.0001	<.0001
PAEO			0.001	<.0001	<.0001
VE			0.030	<.0001	<.0001
Oxidized oil × PAEO			0.647	0.409	<.0001
Oxidized oil × VE			0.502	0.668	<.0001
PAEO × VE			0.671	0.886	0.497
Oxidized oil × PAEO × VE			0.910	0.294	0.081

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Hematological parameters

As shown in Table 6, dietary inclusion of oxidized oil exerted significant main effects on hematological traits, causing reductions in RBC count, Hb, and lymphocytes (P < 0.0001), while increasing WBC count, heterophils, monocytes, and the heterophil-to-lymphocyte (H:L) ratio (P < 0.01). Conversely, PAEO supplementation produced significant main effects in the opposite direction for all these parameters (P < 0.05). Similarly, VE supplementation significantly increased RBC, Hb, and lymphocytes, while decreasing heterophils and the H:L ratio (P ≤ 0.05), but had no significant main effect on WBC and monocytes (P > 0.05). A significant oxidized oil × PAEO interaction was observed for all hematological parameters except monocytes (P ≤ 0.05). Specifically, the addition of PAEO to diets containing oxidized oil mitigated the oxidative damage, leading to a marked recovery in RBC count (2.11 vs. 1.80 × 10⁶/μL) and Hb (9.30 vs. 8.45 $\mathrm{g}/\text{dL}$). Furthermore, PAEO supplementation effectively attenuated the elevation in WBC count (22.50 vs. 24.60 × 10³/μL), heterophils (55.40 vs. 58.10%), and H:L ratio (1.41 vs. 1.64) induced by oxidized oil. Likewise, a significant oxidized oil × VE interaction was observed for the same parameters (P ≤ 0.05). VE inclusion partially counteracted the negative impacts of dietary oxidation by improving RBC count (2.00 vs. 1.80 × 10⁶/μL) and Hb, while reducing WBC, heterophils, and the H:L ratio. Additionally, a significant PAEO × VE interaction (P = 0.001), and a three-way oxidized oil × PAEO × VE interaction (P = 0.013), were observed specifically for RBC count. These interactions revealed a potent restorative effect, wherein the concurrent supplementation of PAEO and VE in diets containing oxidized oil yielded the most substantial improvement in RBC count compared to the unsupplemented oxidized oil group (2.60 vs. 1.80 × 10⁶/μL), restoring it to levels statistically comparable to the fresh oil control group.

Table 6.

Hematological parameters of laying Japanese quails fed diets containing oxidized oil supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			Variables
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	RBC (×106/μL)	WBC (×103/μL)	Hb (g/dL)	Lymphocytes (%)	Heterophils (%)	Heterophils/ Lymphocytes (H:L) ratio	Monocytes (%)
0	0	0	2.70a	19.66a	10.60a	43.60a	51.40a	1.18a	5.05
0	0	200	2.75a	20.50a	10.55a	43.72a	51.10a	1.16a	5.10
0	200	0	2.72a	20.33a	10.58a	43.90a	50.20a	1.14a	5.30
0	200	200	2.80a	20.00a	10.65a	44.65a	49.60a	1.11a	5.20
2	0	0	1.80f	24.60a	8.45a	35.35a	58.10a	1.64a	6.00
2	0	200	2.00a	22.60a	9.20a	38.35a	56.10a	1.46a	5.80
2	200	0	2.11a	22.50a	9.30a	39.40a	55.40a	1.41a	5.70
2	200	200	2.60a	19.83a	10.30a	41.41a	52.20a	1.26a	5.50
SEM			0.034	0.792	0.242	0.516	0.643	0.021	0.253
Main effect
Oxidized oil		0	2.74a	20.12a	10.59a	43.96a	50.57a	1.15a	5.16a
		2	2.12a	22.38a	9.31a	38.63a	55.45a	1.44a	5.75a
PAEO		0	2.31a	21.84a	9.70a	40.25a	54.17a	1.36a	5.48
		200	2.56a	20.66a	10.20a	42.34a	51.85a	1.23a	5.42
VE		0	2.33a	21.77	9.73a	40.56a	53.77a	1.34a	5.51
		200	2.54a	20.73	10.17a	42.03a	52.25a	1.25a	5.40
							P
Oxidized oil			<.0001	0.0002	<.0001	<.0001	<.0001	<.0001	0.002
PAEO			<.0001	0.042	0.005	<.0001	<.0001	<.0001	0.729
VE			<.0001	0.069	0.013	0.0002	0.001	<.0001	0.534
Oxidized oil × PAEO			<.0001	0.030	0.009	0.0002	0.038	<.0001	0.192
Oxidized oil × VE			<.0001	0.026	0.015	0.007	0.022	<.0001	0.628
PAEO × VE			0.001	0.420	0.599	0.810	0.410	0.789	0.835
Oxidized oil × PAEO × VE			0.013	0.821	0.858	0.278	0.619	0.455	0.835

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Blood biochemical parameters

As demonstrated in Table 7, the inclusion of oxidized oil negatively impacted blood biochemical profiles, demonstrating significant main effects by decreasing total protein, albumin, globulin, and the albumin to globulin (A/G) ratio, while elevating the levels of creatinine, uric acid, ALP, ALT, and AST (P ≤ 0.030). In contrast, dietary supplementation with either PAEO or VE exerted beneficial main effects, significantly increasing total protein, and albumin, while reducing creatinine, uric acid, ALP, ALT, and AST (P ≤ 0.001). Neither PAEO nor VE had a significant main effect on globulin concentration (P > 0.05). A significant oxidized oil × PAEO interaction was observed for all evaluated parameters except ALP (P ≤ 0.020). Specifically, PAEO supplementation in oxidized diets partially restored total protein (4.04 vs. 2.63 g/dL), and albumin (2.86 vs. 1.16 g/dL). Moreover, it significantly suppressed the oxidative-induced elevation of creatinine (0.590 vs. 0.670 mg/dL), uric acid (6.30 vs. 7.50 mg/dL), ALT (88.16 vs. 105.16 U/L), and AST (130.16 vs. 150.16 U/L). Similarly, the oxidized oil × VE interaction significantly influenced most parameters (P ≤ 0.0004), except for globulin and ALP. VE inclusion in stressed birds improved total protein (3.85 vs. 2.63 g/dL), and albumin (2.36 vs. 1.16 g/dL), while effectively reducing creatinine (0.625 vs. 0.670 mg/dL), uric acid (6.40 vs. 7.50 mg/dL), ALT (89.66 vs. 105.16 U/L), and AST (135.66 vs. 150.16 U/L). Furthermore, a significant PAEO × VE interaction was detected for total protein, albumin, and creatinine (P ≤ 0.029). The combined supplementation of PA and VE resulted in the highest total protein (5.32 g/dL), and albumin (3.50 g/dL) values, as well as the lowest creatinine concentration (0.425 mg/dL) among all experimental groups. Finally, the three-way oxidized oil × PAEO × VE interaction was significant for total protein, albumin, and A/G ratio (P ≤ 0.019), demonstrating that the simultaneous inclusion of PAEO and VE provided the most effective recovery in these parameters (4.30, 3.09 g/dL, and 2.61, respectively) compared with the unsupplemented oxidized oil group.

Table 7.

Blood biochemical parameters of laying Japanese quails fed diets containing oxidized oil supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			Variables
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	Total protein (g/dL)	Albumin (g/dL)	Globulin (g/dL)	Albumin/ Globulin ratio	Creatinine (mg/dL)	Uric acid (mg/dL)	ALP (U/L)	ALT (U/L)	AST (U/L)
0	0	0	4.47a	3.41a	1.05a	3.62a	0.435a	4.80a	201.33	73.66a	111.16a
0	0	200	4.87a	3.42a	1.44a	2.44a	0.461a	4.60a	198.00	71.33a	108.33a
0	200	0	5.15a	3.45a	1.70a	2.03a	0.441a	4.70a	188.50	70.66ca	110.50a
0	200	200	5.32a	3.50a	1.82a	1.94a	0.425a	4.60a	176.66	65.33a	107.50a
2	0	0	2.63a	1.16a	1.47a	0.79a	0.670a	7.50a	229.16	105.16a	150.16a
2	0	200	3.85a	2.36a	1.48a	1.77a	0.625a	6.40a	215.16	89.66a	135.66a
2	200	0	4.04a	2.86a	1.18a	2.48a	0.590a	6.30a	213.50	88.16a	130.16a
2	200	200	4.30a	3.09a	1.20a	2.61a	0.480a	5.10a	204.33	70.16a	120.83a
SEM			0.107	0.065	0.107	0.279	0.015	0.158	2.448	1.804	1.618
Main effect
Oxidized oil		0	4.95a	3.44a	1.50a	2.51a	0.440a	4.67a	191.12a	70.25a	109.37a
		2	3.70a	2.37a	1.33a	1.91a	0.591a	6.32a	215.54a	88.29a	134.20a
PAEO		0	3.95a	2.59a	1.36	2.15	0.547a	5.82a	210.91a	84.95a	126.33a
		200	4.70a	3.22a	1.47	2.26	0.484a	5.17a	195.75a	73.58a	117.25a
VE		0	4.07a	2.72a	1.35	2.23	0.534a	5.82a	208.12a	84.41a	125.50a
		200	4.58a	3.09a	1.48	2.19	0.497a	5.17a	198.54a	74.12a	118.08a
								P
Oxidized oil			<.0001	<.0001	0.030	0.004	<.0001	<.0001	<.0001	<.0001	<.0001
PAEO			<.0001	<.0001	0.144	0.587	<.0001	<.0001	<.0001	<.0001	<.0001
VE			<.0001	<.0001	0.083	0.852	0.001	<.0001	<.0001	<.0001	<.0001
Oxidized oil × PAEO			0.020	<.0001	<.0001	<.0001	<.0001	<.0001	0.274	<.0001	<.0001
Oxidized oil × VE			0.005	<.0001	0.127	0.004	0.0004	<.0001	0.254	<.0001	0.0003
PAEO × VE			0.0003	<.0001	0.411	0.755	0.015	0.991	0.599	0.287	0.281
Oxidized oil × PAEO × VE			0.019	<.0001	0.375	0.018	0.615	0.665	0.061	0.922	0.251

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Serum lipid profile

As presented in Table 8, dietary treatments had significant main effects on all measured serum lipid profile parameters (P < 0.001). The inclusion of 2% oxidized oil in the diet adversely affected the lipid profile, significantly increasing serum total cholesterol, triglycerides, LDL, and VLDL, while markedly decreasing HDL levels (P < 0.0001). In contrast, both PAEO and VE supplementation significantly improved the lipid profile by increasing HDL and reducing all other lipid parameters (P < 0.001). A significant oxidized oil × PAEO interaction (P ≤ 0.015) was observed for all lipid parameters, indicating that PAEO supplementation mitigated the detrimental effects of oxidized oil on all lipid parameters. For example, in birds fed oxidized oil diets, PA supplementation reduced total cholesterol (209.16 vs. 240.83 mg/dL) and increased HDL (31.83 vs. 24.83 mg/dL). Similarly, a significant oxidized oil × VE interaction was detected for total cholesterol, triglycerides, LDL, and VLDL (P ≤ 0.015), whereas no interaction was observed for HDL (P = 0.206). In oxidized oil–fed birds, VE supplementation reduced total cholesterol (214.66 vs. 240.83 mg/dL), triglycerides (165.33 vs. 176.16 mg/dL), LDL (95.33 vs. 119.16 mg/dL), and VLDL (45.66 vs. 50.66 mg/dL). Furthermore, a significant PAEO × VE interaction was observed exclusively for triglycerides (P < 0.0001), indicating that the combined supplementation of PAEO and VE resulted in a greater reduction in triglyceride levels than either additive alone. Finally, a significant three-way oxidized oil × PAEO × VE interaction was detected for triglycerides (P = 0.0002) and LDL (P = 0.008). Under oxidative stress conditions, the simultaneous supplementation of PAEO and VE produced the lowest triglyceride (139.83 mg/dL) and LDL (79.33 mg/dL) concentrations, which were markedly lower than those observed with PAEO (163.83 and 97.83 mg/dL) or VE (165.33 and 95.33 mg/dL) supplementation alone.

Table 8.

Serum lipid profile parameters of laying Japanese quails fed diets containing oxidized oil supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			Variables
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	Total cholesterol (mg/dL)	Triglycerides (mg/dL)	HDL (mg/dL)	LDL (mg/dL)	VLDL (mg/dL)
0	0	0	180.66a	131.83a	48.33a	44.50a	33.33a
0	0	200	169.83e	130.16a	51.16a	46.33a	32.83a
0	200	0	162.66f	131.00a	49.66a	44.66a	31.66a
0	200	200	150.33g	128.83a	54.66a	39.50e	30.33a
2	0	0	240.83a	176.16a	24.83e	119.16a	50.66a
2	0	200	214.66a	165.33a	29.66a	95.33a	45.66a
2	200	0	209.16a	163.83a	31.83a	97.83a	44.50a
2	200	200	190.33a	139.83a	39.83a	79.33a	39.16a
SEM			2.220	1.088	1.376	1.586	1.189
Main effect
Oxidized oil		0	165.87a	130.45a	50.95a	43.750a	32.04a
		2	213.75a	161.29a	31.54a	97.917a	45.00a
PAEO		0	201.50a	150.87a	38.50a	76.333a	40.62a
		200	178.12a	140.87a	44.00a	65.333a	36.41a
VE		0	198.33a	150.70a	38.66a	76.542a	40.04a
		200	181.29a	141.04a	43.83a	65.125a	37.00a
						P
Oxidized oil			<.0001	<.0001	<.0001	<.0001	<.0001
PAEO			<.0001	<.0001	<.0001	<.0001	<.0001
VE			<.0001	<.0001	<.0001	<.0001	0.0008
Oxidized oil × PAEO			0.005	<.0001	0.002	<.0001	0.015
Oxidized oil × VE			0.001	<.0001	0.206	<.0001	0.015
PAEO × VE			0.358	<.0001	0.178	0.712	0.730
Oxidized oil × PAEO × VE			0.167	0.0002	0.798	0.008	0.882

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Liver and serum antioxidant status

The effects of dietary treatments on liver and serum oxidative stress markers and antioxidant enzymes are presented in Table 9. Dietary oxidized oil significantly increased MDA concentrations and elevated the activities of SOD and GSH-Px in both liver and serum (P < 0.05), which may represent a compensatory response to the increased peroxidative load. Additionally, oxidized oil significantly decreased serum TAC levels (P < 0.0001). In contrast, dietary supplementation with PAEO independently mitigated these oxidative disturbances across all measured parameters (P < 0.05). VE supplementation also demonstrated protective effects on most markers, although its main effect on liver SOD activity was not statistically significant (P > 0.05). Significant oxidized oil × PAEO and oxidized oil × VE interactions were observed for almost all liver and serum indices (P < 0.05), except for TAC. Specifically, in birds challenged with oxidized oil, individual supplementation with PAEO or VE effectively reduced MDA levels in the liver (6.66 and 6.16 vs. 9.50 nmol/mL, respectively) and serum (3.50 vs. 5.50 nmol/mL for both). Furthermore, both additives successfully downregulated the compensatory elevation of liver GSH-Px (3.16 vs. 4.83 U/mL) and serum SOD (9.16 and 9.00 vs. 13.00 U/mL) in the oxidized oil-fed groups (P < 0.05). Furthermore, a significant three-way interaction (oxidized oil × PAEO × VE) was detected exclusively for serum GSH-Px activity (P = 0.021). The concurrent inclusion of PAEO and VE in oxidized diets markedly reduced serum GSH-Px activity from 42.50 to 24.50 U/mL, demonstrating a potent restorative effect in alleviating oxidative stress and potentially reducing the need for compensatory enzyme elevation.

Table 9.

Liver and serum antioxidant status of laying Japanese quails fed diets containing oxidized oil supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			Liver			Serum
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	MDA (nmol/mL)	SOD (U/mL)	GSH-Px (U/mL)	MDA (nmol/mL)	SOD (U/mL)	GSH-Px (U/mL)	TAC (mmol/L)
0	0	0	3.66a	2.16	3.16a	1.50a	5.33a	17.00a	2.83
0	0	200	3.00a	2.00	3.00a	0.91a	5.16a	16.16a	3.16
0	200	0	3.16a	2.00	3.00a	0.85a	5.00a	15.00a	3.16
0	200	200	2.83a	1.66	2.8a	0.58a	4.16a	11.50a	3.33
2	0	0	9.50a	3.66	4.83a	5.50a	13.00a	42.50a	0.70
2	0	200	6.16a	2.33	3.16a	3.50a	9.00a	32.33a	1.11
2	200	0	6.66a	1.83	3.16a	3.50a	9.16a	31.16a	1.20
2	200	200	5.16a	2.00	2.66a	2.00a	6.00a	24.50a	2.33
SEM			0.530	0.377	0.366	0.277	0.554	0.907	0.250
Main effect
Oxidized oil		0	3.16a	1.95a	3.00a	0.96a	4.91a	14.91a	3.12a
		2	6.87a	2.45a	3.45a	3.62a	9.29a	32.62a	1.33a
PAEO		0	5.58a	2.54a	3.54a	2.85a	8.12a	27.00a	1.95a
		200	4.45a	1.87a	2.91a	1.73a	6.08a	20.54a	2.50a
VE		0	5.75a	2.41	3.54a	2.83a	8.12a	26.41a	1.97a
		200	4.29a	2.00	2.91a	1.75a	6.08a	21.12a	2.48a
							P
Oxidized oil			<.0001	0.036	0.044	<.0001	<.0001	<.0001	<.0001
PAEO			0.004	0.006	0.007	<.0001	<.0001	<.0001	0.003
VE			0.0004	0.079	0.007	<.0001	<.0001	<.0001	0.006
Oxidized oil × PAEO			0.041	0.079	0.044	0.002	0.001	<.0001	0.094
Oxidized oil × VE			0.014	0.475	0.044	0.001	0.0003	<.0001	0.146
PAEO × VE			0.156	0.157	0.194	0.303	0.915	0.747	0.442
Oxidized oil × PAEO × VE			0.323	0.079	0.194	0.816	0.344	0.021	0.220

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Jejunal histomorphology

The main effects of oxidized oil on jejunal morphometry were significant across all measured parameters (Table 10). Dietary inclusion of oxidized oil led to an increase in crypt depth, alongside significant reductions in villus height, villus width, villus surface area, and the villus height-to-crypt depth (VH:CD) ratio (P < 0.0001). In contrast, both PAEO and VE exerted significant main effects that mitigated the deleterious impacts of oxidized oil. Supplementation with either additive improved jejunal morphology by significantly increasing villus width (P < 0.001), as well as villus height, villus surface area, and the VH:CD ratio (P < 0.0001), while significantly reducing crypt depth (P < 0.005 for PA and P < 0.05 for VE). Furthermore, significant two-way interactions were observed between oxidized oil and the supplements. For the oxidized oil × PAEO interaction, which was significant for all parameters except crypt depth, PAEO supplementation in diets containing oxidized oil significantly increased villus height (445.50 vs. 391.00 µm), villus width (108.83 vs. 100.50 µm), villus surface area (152,244 vs. 123,239 µm²), and the VH:CD ratio (4.05 vs. 3.24) (P ≤ 0.003). Similarly, a significant oxidized oil × VE interaction was recorded for villus height, surface area, and the VH:CD ratio (P ≤ 0.007). The results demonstrated that the inclusion of VE in oxidized oil-containing diets led to notable increases in villus height (440.33 vs. 391.00 µm), villus surface area (146,318 vs. 123,239 µm²), and the VH:CD ratio (3.92 vs. 3.24). No significant interactions were detected between PAEO and VE, nor among oxidized oil × PAEO × VE (P > 0.05).

Table 10.

Jejunal histomorphology of laying Japanese quails fed diets containing oxidized oil supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			Variables
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	Villus height (µm)	Villus width (µm)	Crypt depth (µm)	Villus height: Crypt depth	Villus surface area (µm2)
0	0	0	569.16a	127.83a	106.33	5.35a	228356a
0	0	200	575.66a	129.66a	105.16	5.48a	234403a
0	200	0	580.50a	128.33a	104.50	5.56a	233813a
0	200	200	598.33a	130.50a	103.16	5.81a	245197a
2	0	0	391.00a	100.50a	120.66	3.24a	123239a
2	0	200	440.33a	105.83a	112.50	3.92a	146318a
2	200	0	445.50a	108.83a	110.16	4.05a	152244a
2	200	200	490.33a	114.16a	108.00	4.56a	175738a
SEM			5.958	1.336	2.232	0.102	2481.074
Main effect
Oxidized oil		0	580.91a	129.08a	104.79a	5.55a	235443a
		2	441.79a	107.33a	112.83a	3.94a	149385a
PAEO		0	494.04a	115.95a	111.16a	4.50a	183080a
		200	528.66a	120.45a	106.45a	4.99a	201748a
VE		0	496.54a	116.37a	110.41a	4.55a	184413a
		200	526.16a	120.04a	107.20a	4.94a	200414a
						P
Oxidized oil			<.0001	<.0001	<.0001	<.0001	<.0001
PAEO			<.0001	<.0001	0.004	<.0001	<.0001
VE			<.0001	0.0004	0.048	<.0001	<.0001
Oxidized oil × PAEO			0.0002	0.0002	0.084	0.003	<.0001
Oxidized oil × VE			0.0002	0.085	0.222	0.007	0.0002
PAEO × VE			0.687	0.930	0.361	0.868	0.417
Oxidized oil × PAEO × VE			0.353	0.930	0.334	0.314	0.487

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Hepatic gene expression

As illustrated in Table 11, oxidized oil, PAEO, and VE exerted significant main effects on the hepatic expression of all evaluated genes (P < 0.05). Dietary inclusion of oxidized oil significantly upregulated the mRNA expression of Nrf2, SOD, GPx, and NF-κB p65 (P ≤ 0.0001). In contrast, independent supplementation with either PAEO or VE significantly downregulated the expression of these genes (P < 0.05). Significant two-way interactions between oxidized oil and the antioxidant supplements (oxidized oil × PAEO and oxidized oil × VE) were observed for all evaluated genes (P ≤ 0.033). Birds fed diets containing 2% oxidized oil without additives exhibited the highest expression levels of Nrf2, SOD, GPx, and NF-κB p65 (2.62, 1.75, 1.60, and 2.07, respectively). However, PAEO supplementation in oxidized oil-challenged birds significantly attenuated these upregulations, reducing gene expression to 2.12, 1.27, 1.30, and 1.50, respectively. Similarly, dietary VE supplementation mitigated the overexpression of these genes, decreasing the values to 2.22, 1.30, 1.35, and 1.75, respectively. The lowest expression levels among the oxidized oil groups were observed in birds receiving the combination of both PAEO and VE (1.90, 1.21, 1.19, and 1.20, respectively). No significant PAEO × VE or three-way interactions were detected for any of the evaluated genes (P > 0.05).

Table 11.

Hepatic expression of Nrf2, SOD, GPx, and NF-κB p65 in laying Japanese quails fed diets containing oxidized oil supplemented with Perovskia abrotanoides essential oil (PAEO) and vitamin E (VE).

Treatment			Gene
Oxidized oil (%)	PAEO (mg/kg)	VE (mg/kg)	Nrf2	SOD	GPx	NF-κB p65
0	0	0	1.11a	1.16a	1.07a	1.07a
0	0	200	1.08a	1.14a	1.06a	1.04a
0	200	0	1.06a	1.12a	1.08a	1.05a
0	200	200	1.05a	1.14a	1.05a	1.01a
2	0	0	2.62a	1.75a	1.60a	2.07a
2	0	200	2.22a	1.30a	1.35a	1.75a
2	200	0	2.12a	1.27a	1.30a	1.50a
2	200	200	1.90a	1.21a	1.19a	1.20a
SEM			0.091	0.081	0.036	0.042
Main effect
Oxidized oil		0	1.07a	1.14a	1.06a	1.04a
		2	2.21a	1.38a	1.36a	1.63a
PAEO		0	1.76a	1.34a	1.27a	1.48a
		200	1.53a	1.19a	1.15a	1.19a
VE		0	1.73a	1.33a	1.26a	1.42a
		200	1.56a	1.20a	1.16a	1.25a
					P
Oxidized oil			<.0001	0.0001	<.0001	<.0001
PAEO			0.001	0.013	<.0001	<.0001
VE			0.012	0.033	0.0004	<.0001
Oxidized oil × PAEO			0.007	0.028	<.0001	<.0001
Oxidized oil × VE			0.030	0.033	0.0031	<.0001
PAEO × VE			0.445	0.062	0.249	0.978
Oxidized oil × PAEO × VE			0.549	0.154	0.087	0.783

^aMeans within the same column with different superscripts differ significantly (P < 0.05).

Discussion

The present study demonstrated that dietary oxidized oil imposed a considerable physiological burden on laying quails, as evidenced by reduced productive performance, increased lipid peroxidation, and modulation of hepatic genes associated with oxidative and inflammatory responses. Oxidized lipids are recognized as potent inducers of metabolic stress in poultry, activating redox-sensitive transcription factors such as Nrf2, which regulates antioxidant defense systems, and NF-κB, which mediates inflammatory signaling pathways (Surai et al., 2021). In the present study, supplementation with PAEO and VE alleviated many of these adverse responses, indicating an improved capacity of birds to cope with oxidized oil–induced stress. The reductions in egg production, egg weight, egg mass, feed intake, and feed efficiency observed in quails fed oxidized oil are consistent with previous reports showing that oxidized dietary lipids impair nutrient utilization and antioxidant status in poultry (Engberg et al., 1996; Liu et al., 2022). Lipid peroxidation products, including hydroperoxides and reactive aldehydes, can reduce fat digestibility and promote oxidative stress, thereby increasing the metabolic cost of maintaining cellular redox homeostasis (Surai et al., 2021). Consequently, energy and nutrients may be diverted from productive processes toward maintenance functions, leading to impaired performance (Scanes, 2016). This limitation is particularly critical in laying birds, as egg formation requires a continuous supply of energy and efficient hepatic synthesis and transport of yolk precursors (Surai, 2002). The beneficial effects of PAEO on performance may be associated with the antioxidant and other biological properties previously reported for constituents commonly found in essential oils, which can improve digestive efficiency and reduce oxidative burden (Abo Ghanima et al., 2020). Consistently, recent meta-analyses indicate that essential oils can enhance productive responses in laying hens, although the magnitude of the response depends on additive type and physiological conditions (Darmawan et al., 2024; Orzuna-Orzuna and Lara-Bueno, 2023). VE likely contributed through complementary mechanisms by protecting membrane lipids from peroxidative damage. Moreover, the interaction pattern suggests that the beneficial effects of PAEO and VE were more pronounced under oxidized-oil challenge, with the combined supplementation producing the best response for several productive traits.

The reductions in shell weight, shell thickness, and yolk weight indicate that oxidized oil disrupted key physiological processes involved in egg formation. Lipid peroxidation products can induce systemic oxidative stress and impair hepatic and reproductive functions essential for vitellogenesis and shell formation (Yue et al., 2011). Oxidative damage to reproductive tissues may compromise uterine epithelial activity and calcium transport during shell deposition, while disturbances in hepatic lipid metabolism can limit yolk precursor supply to developing follicles (Liu et al., 2022). Consistent with this mechanism, oxidized oil increased circulating triglycerides and VLDL (Table 8), suggesting impaired utilization or ovarian uptake of lipoproteins under oxidative challenge (Yue et al., 2011). Interestingly, oxidized oil increased albumen weight. Because albumen is synthesized in the magnum and consists largely of water and structural proteins such as ovalbumin (Réhault-Godbert et al., 2019), this response likely reflects altered nutrient partitioning rather than improved albumen quality, potentially associated with oxidative stress–induced changes in oviductal function (Liu et al., 2022). When yolk precursor deposition is limited, a greater relative proportion of nutrients may be directed toward albumen. The unchanged Haugh unit supports this interpretation, indicating that the increase in albumen weight was not accompanied by improved internal egg quality. The improvements observed with PAEO and VE are consistent with their antioxidant properties. VE acts as a lipid-soluble, chain-breaking antioxidant that protects cellular membranes and circulating lipids from peroxidation, thereby supporting normal reproductive function (Surai et al., 2016, 2021). Similarly, the response to PAEO may be related to the antioxidant and physiological benefits previously reported for bioactive constituents commonly identified in aromatic essential oils (Çabuk et al., 2014). Through these mechanisms, PAEO and VE likely mitigated oxidative damage and partially restored metabolic and reproductive processes related to yolk deposition and shell formation. Their protective effects were more evident under oxidized-oil challenge, as indicated by significant interaction effects, and the combined supplementation tended to yield the greatest improvements in shell traits. However, the absence of changes in several other egg quality indices suggests that not all egg components were equally responsive to oxidative challenge or antioxidant intervention.

A notable finding was the increase in yolk MDA, particularly after storage, indicating reduced oxidative stability of eggs from birds fed oxidized oil. This observation reflects not only oxidative pressure in the bird but also the susceptibility of yolk lipoproteins to lipid peroxidation, which accelerates egg quality deterioration during storage and shortens shelf life (Yue et al., 2011). Similar responses have been reported in laying birds exposed to dietary oxidative stress, where elevated yolk MDA indicates enhanced propagation of lipid peroxidation during storage (Loetscher et al., 2014). Conversely, antioxidant supplementation can improve yolk oxidative stability by limiting peroxidative damage to polyunsaturated fatty acids and yolk lipoproteins. Lipophilic antioxidants such as VE and phytogenic bioactive compounds are incorporated into hepatic VLDL and subsequently transported to developing oocytes during follicular growth (Surai, 2016). Once deposited within the yolk lipid fraction, these molecules are positioned in the lipoprotein–phospholipid matrix, where they scavenge peroxyl radicals and interrupt lipid peroxidation chain reactions, particularly in the presence of pre-existing hydroperoxides derived from oxidized oil (Surai et al., 2019a). Although oxidized oil quantitatively impaired yolk formation, as indicated by reduced yolk weight and altered lipid metabolism, antioxidant supplementation improved the qualitative oxidative stability of the yolk lipid fraction. Importantly, the significant interaction effects indicate that these protective responses became more pronounced with increasing storage time, particularly after 30 days under oxidized-oil challenge. This pattern suggests that PAEO and VE contributed to attenuating the propagation phase of lipid peroxidation during prolonged storage, when endogenous yolk antioxidant reserves are progressively depleted.

Dietary oxidized oil induced systemic stress in birds, as evidenced by reduced RBC counts, hemoglobin, and lymphocytes, alongside elevated WBC, heterophils, monocytes, and H:L ratios. These alterations indicate physiological stress and inflammatory responses, which are established markers of oxidative and immunological challenges in poultry (Oke et al., 2024). Erythrocytes are highly vulnerable to oxidative damage due to continuous oxygen exposure and the susceptibility of their membrane lipids and hemoglobin; consequently, oxidative stress compromises membrane integrity and accelerates cell turnover, reducing circulating RBCs and hemoglobin (Mohanty et al., 2014). The elevated H:L ratio likely reflects glucocorticoid-mediated leukocyte redistribution during stress axis activation (Davis et al., 2008; Scanes, 2016), whereas the higher WBC count suggests inflammatory leukocytosis triggered by oxidized lipid intake rather than simple redistribution (Oke et al., 2024). Supplementation with PAEO and VE partially mitigated these changes, improving hematological stability and reducing systemic stress, consistent with prior reports on phytogenic antioxidants maintaining immune balance in laying birds (Abo Ghanima et al., 2020). The protective effects of these additives are biologically plausible. VE, as a lipid-soluble chain-breaking antioxidant, stabilizes cellular membranes and interrupts lipid peroxidation reactions, thereby preserving erythrocyte membrane integrity and limiting oxidative hemolysis. In addition, bioactive constituents frequently reported in essential oils have been described to exert radical-scavenging and anti-inflammatory properties, potentially moderating redox-sensitive pathways such as Nrf2 and NF-κB; such mechanisms could help alleviate oxidative stress in circulating cells and stabilize leukocyte proportions (Surai, 2021). Notably, the interaction between oxidized oil and the supplements for RBC and hemoglobin shows that the benefits of PAEO and VE were enhanced under oxidative challenge. However, the interaction between PAEO and VE was significant only for RBC count, indicating that their combined supplementation did not exert a broad synergistic effect across all hematological parameters.

The blood biochemical profile confirmed that dietary oxidized oil disrupted hepatic, renal, and overall metabolic homeostasis in laying quails. Birds receiving oxidized oil showed marked reductions in total protein, albumin, globulin, and the albumin-to-globulin ratio, indicating impaired protein metabolism and reduced hepatic synthetic capacity. In laying birds, the liver plays a central role in nutrient metabolism and yolk precursor synthesis (Yue et al., 2011), and similar declines in circulating protein fractions have been documented under nutritional or oxidative stress (Akbarian et al., 2013). Elevated creatinine and uric acid levels further suggested altered renal function or increased protein catabolism, as uric acid is the main nitrogenous waste product in birds and commonly rises with impaired renal clearance or enhanced tissue breakdown (Scope and Schwendenwein, 2020). Increased activities of ALT, AST, and ALP also reflected hepatocellular stress and leakage of intracellular enzymes following oxidative membrane damage (Xing et al., 2021). Dietary supplementation with PAEO and VE alleviated many of these abnormalities, improving circulating protein fractions and reducing creatinine, uric acid, and hepatic enzyme activities. These findings suggest that antioxidant supplementation may have supported hepatic and renal function and helped maintain metabolic stability. Phytogenic bioactive compounds in essential oils have been reported to exert antioxidant and hepatoprotective effects in poultry, thereby enhancing metabolic responses under oxidative challenge (Abd El-Hack et al., 2022). Furthermore, significant interaction effects between oxidized oil and the antioxidant supplements were observed for protein-related traits, creatinine, uric acid, and key hepatic enzymes, demonstrating that the protective actions of PAEO and VE were most pronounced under oxidative stress. Such responses suggest that dietary antioxidants help counteract the detrimental metabolic consequences of oxidized lipids by strengthening the antioxidant defense system and preserving cellular integrity in metabolically active tissues.

Dietary oxidized oil markedly disrupted lipid homeostasis, increasing serum total cholesterol, triglycerides, LDL, and VLDL while reducing HDL. Oxidized lipids contain hydroperoxides and reactive aldehydes that induce hepatic oxidative stress and compromise membrane integrity. Because the liver is the primary site of de novo lipogenesis and lipoprotein assembly in birds, oxidative injury to hepatocytes may impair β-oxidation and disrupt lipid metabolic regulation, promoting the secretion of triglyceride-rich lipoproteins and elevating circulating VLDL and triglycerides (Engberg et al., 1996; Surai, 2016). The increase in LDL may reflect altered lipoprotein remodeling and reduced clearance, whereas the decline in HDL suggests oxidative modification of HDL particles and impaired reverse cholesterol transport (Surai, 2016). Together, these changes indicate a shift toward an atherogenic-like lipid profile associated with hepatic redox imbalance. Such disturbances may also involve key lipid regulatory pathways, including SREBP-1c–mediated lipogenesis and PPARα-dependent fatty acid oxidation, which control hepatic triglyceride synthesis and lipid utilization under oxidative stress (Jump et al., 2005; Kersten, 2014). Supplementation with PAEO and VE mitigated these disturbances, lowering total cholesterol, triglycerides, LDL, and VLDL while increasing HDL. VE, a lipid-soluble chain-breaking antioxidant, interrupts lipid peroxidation in cellular and lipoprotein membranes, preserving hepatocellular integrity and stabilizing apolipoprotein structure and VLDL assembly (Surai, 2016). By limiting oxidative injury, VE likely reduces excessive hepatic secretion of triglyceride-rich lipoproteins and prevents secondary LDL oxidation. Phytogenic compounds in essential oils, particularly phenolic terpenoids, may exert complementary effects by scavenging ROS and enhancing endogenous antioxidant defenses (Brenes and Roura, 2010; Windisch et al., 2008). They may also modulate hepatic lipid metabolism through lipogenic and cholesterogenic pathways, thereby reducing triglyceride and cholesterol synthesis while improving lipid transport efficiency (Brenes and Roura, 2010). Through these potential antioxidant and metabolic interactions, PAEO may have contributed to improving lipoprotein balance in birds subjected to dietary oxidized oil. The combined supplementation produced a pronounced restorative effect on triglycerides and LDL levels, suggesting an additive benefit resulting from VE-mediated membrane stabilization and phytogenic modulation of lipid metabolism. The significant interaction between PAEO and VE for triglycerides, together with the three-way interaction affecting triglycerides and LDL, supports complementary antioxidant and metabolic mechanisms. Overall, the simultaneous reinforcement of antioxidant protection and hepatic lipid regulation appears more effective than either strategy alone in alleviating oxidized oil–induced dyslipidemia.

The redox status profile provides mechanistic insight into the systemic responses observed. Birds fed oxidized oil exhibited higher MDA concentrations in liver and serum, accompanied by increased SOD and GSH-Px activities and reduced serum TAC. The elevation of antioxidant enzyme activities likely reflects a compensatory response to excessive ROS, rather than enhanced antioxidant capacity per se (Sies, 2017). This pattern is consistent with previous reports indicating that dietary oxidized lipids promote lipid peroxidation and disrupt antioxidant balance in poultry (Engberg et al., 1996; Surai, 2002). Persistently elevated MDA nevertheless suggests that endogenous defenses were insufficient to prevent lipid peroxidation, indicating that the oxidative challenge exceeded the birds’ intrinsic buffering capacity. Supplementation with PAEO and VE alleviated these alterations, as reflected by reduced MDA, normalization of antioxidant enzyme activities, and improved serum TAC. VE acts as a membrane-associated chain-breaking antioxidant that terminates lipid peroxidation by donating hydrogen atoms to lipid peroxyl radicals (Surai, 2002). Phytogenic compounds typically reported in essential oils can further support redox homeostasis through ROS scavenging and condition-dependent modulation of redox-sensitive pathways, thereby attenuating oxidized oil–induced upregulation of Nrf2 and NF-κB p65 (Kasote et al., 2015). The consistency between these biochemical responses and antioxidant-related gene expression suggests coordinated metabolic and transcriptional regulation. Furthermore, the significant interactions between dietary oxidized oil and each supplement indicate that the protective effects were primarily manifested under oxidative challenge. Both additives more effectively attenuated lipid peroxidation and supported enzymatic defenses in birds receiving oxidized oil, underscoring a condition-dependent modulation of redox homeostasis. Overall, reinforcing complementary antioxidant defenses appears to be an effective strategy for maintaining systemic redox homeostasis under dietary pro-oxidant stress (Sies et al., 2017).

Jejunal histomorphology provides important mechanistic insight into the performance decline associated with oxidized oil feeding. In the present study, dietary oxidized oil markedly reduced villus height, width, surface area, and the villus height: crypt depth (VH:CD) ratio, while increasing crypt depth. Similar intestinal morphological alterations have also been reported in broilers fed oxidized dietary oil, including reduced jejunal villus height and VH:CD ratio along with increased crypt depth (Zhang et al., 2022). These structural changes are consistent with oxidative injury to the intestinal mucosa induced by lipid peroxidation products and ROS, which can impair epithelial barrier integrity, promote epithelial cell loss, and shift epithelial turnover toward enhanced crypt proliferation and villus atrophy, which may potentially compromise the mucosal surface area available for nutrient utilization (Chelakkot et al., 2018; Sies et al., 2017). In contrast, supplementation with PAEO or VE improved intestinal morphology, as reflected by greater villus height, width, surface area, and VH:CD ratio, together with reduced crypt depth. Comparable improvements in intestinal architecture following dietary essential oils or antioxidant supplementation have been documented in poultry (Amevor et al., 2022; Bao et al., 2023). The favorable gut histological responses observed with PAEO may be associated with the antioxidant, antimicrobial, and anti-inflammatory properties widely documented for essential oil constituents. These compounds can scavenge ROS, attenuate lipid peroxidation, and support redox homeostasis within intestinal tissues. Moreover, essential oil constituents may modulate gut microbiota and dampen inflammatory responses, thereby creating a microenvironment conducive to epithelial renewal and mucosal integrity (Brenes and Roura, 2010; Zeng et al., 2015). VE may provide complementary protection by functioning as a membrane-associated chain-breaking antioxidant that limits the propagation of lipid peroxidation within cellular membranes, thus preserving epithelial cell integrity (Surai, 2002). The significant interactions between oxidized oil and both supplements for several morphometric indices indicate that these protective effects were more pronounced under oxidative challenge. Collectively, the preservation of intestinal architecture appears to be a key mechanism through which PAEO and VE alleviate oxidized oil–induced intestinal impairment, thereby helping to maintain gut mucosal integrity and potentially supporting productive performance in laying quails, although direct determinations of nutrient digestibility warrant future investigation.

The hepatic transcriptional responses observed in the present study indicate that dietary oxidized oil imposed a substantial oxidative challenge on laying Japanese quails. The upregulation of Nrf2, along with the antioxidant enzyme-related genes SOD and GPx, is consistent with a compensatory transcriptional response to increased ROS generation and lipid peroxidation products derived from oxidized lipids. Concurrently, the elevated expression of NF-κB p65 reflects an inflammatory-related transcriptional response. Oxidized lipids can disturb cellular redox balance and generate reactive aldehydes and electrophilic compounds capable of inducing stress-responsive gene expression, including Nrf2-dependent antioxidant transcripts and NF-κB–mediated inflammatory responses (Loboda et al., 2016; Surai et al., 2019a). Thus, the concurrent induction of Nrf2, SOD, GPx, and NF-κB p65 likely represents a compensatory hepatic transcriptional response aimed at restoring redox homeostasis under oxidized-oil challenge. In agreement with this interpretation, dietary oxidized lipids have been reported to enhance hepatic Nrf2-related antioxidant gene expression across species (Varady et al., 2012). In contrast, supplementation with PAEO or VE attenuated the expression of these genes, indicating lower induction of oxidative-stress and inflammatory-related transcripts. This response may be related to the protective actions reported for essential oil constituents alongside the chain-breaking function of VE within cellular membranes, which collectively mitigate oxidative challenges and reduce the need for compensatory upregulation of endogenous defense genes (Brenes and Roura, 2010; Zeng et al., 2015). By reducing oxidative stimuli, these additives may attenuate redox-sensitive mRNA expression, thereby decreasing compensatory antioxidant and inflammatory gene induction (Surai et al., 2019a). The parallel improvements observed in hepatic and serum antioxidant indices further support the role of PAEO and VE in stabilizing systemic redox status. Importantly, the observed interaction effects suggest that these transcriptional modulations were more evident under oxidized-oil challenge, highlighting their protective role in mitigating diet-induced oxidative stress rather than merely enhancing basal antioxidant capacity.

Given that the specific chemical profile of the PAEO batch used in this study was not characterized by GC-MS, the potential roles of individual constituents in the observed responses are presented as putative mechanisms based on their previously reported bioactivities in the literature.

Conclusion

In conclusion, dietary oxidized oil significantly impaired productive performance, egg quality, and intestinal morphology in laying Japanese quails, while inducing systemic oxidative stress. Supplementation with PAEO and VE effectively alleviated these adverse effects, primarily by reducing lipid peroxidation and attenuating the transcriptional upregulation of antioxidant- and inflammatory-related genes. Their combined supplementation offered enhanced protection, supporting the use of PAEO and VE as effective nutritional strategies to improve the physiological resilience and performance of laying quails under dietary oxidative challenge.

Author Contributions

Nematullah Kordi Koosheh contributed to the conception of the study, conducted the investigation, curated the data, and prepared the original draft of the manuscript. Mohammad Taher Mirakzehi supervised the study, contributed to the methodology and statistical analysis, and assisted in preparing and critically revising the manuscript. Hassan Saleh contributed to the methodology, validation of the study procedures, provision of resources, and critical revision of the manuscript. Tayebeh Baranzehi contributed to the methodology, validation of the study procedures, provision of resources, and critical revision of the manuscript. All authors reviewed and approved the final version of the manuscript.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.