Effect of dietary chenodeoxycholic acid on fat deposition and intestinal health in Wenchang chickens

Abstract

Chenodeoxycholic acid (CDCA), an endogenous agonist of the farnesoid X receptor, is involved in lipid homeostasis and intestinal barrier regulation. This study examined how dietary CDCA alleviates high-energy diet (HED)-induced metabolic disorders in Wenchang chickens and determined the optimal supplemental dose. A total of 525 Wenchang hens were randomly assigned to five groups: Con (basal diet), HED, and HED supplemented with 50, 100, or 200 mg/kg CDCA (≥ 98% purity). The experiment spanned 42 days. Compared with the control group, HED significantly increased abdominal fat percentage, serum LDL-C, and GLU levels (P < 0.05), reduced jejunal villus height by 35.05% and increased crypt depth by 35.44%, downregulated tight junction protein expression, activated the TLR-4/NF-κB pathway, and elevated serum LPS, DAO, and d-lactate levels (P < 0.05). The 50 and 100 mg/kg doses showed lesser effects, while 200 mg/kg was identified as the most effective dose. Compared to the HED group, 200 mg/kg CDCA supplementation significantly decreased abdominal fat by 41.7%, LDL-C by 40.53%, and GLU by 18.77% (P < 0.05). It enhanced lipolytic gene expression, suppressed adipogenic gene expression (P < 0.05), improved intestinal morphology (villus height increased by 36.60%, VH/CD by 53.79%), inhibited the TLR-4/NF-κB inflammatory pathway, and reduced harmful bacteria like Desulfovibrio, Helicobacter, and Bilophila (P < 0.05). Although the CDCA-supplemented groups had significantly less intramuscular fat content than the HED group, more than the control group (P < 0.05). In summary, dietary supplementation with 200 mg/kg CDCA effectively alleviates HED-induced lipogenesis and intestinal damage in female Wenchang chicken through regulation of lipid metabolism genes, restoration of intestinal barrier function, inhibition of the TLR-4/NF-κB inflammatory pathway, and modulation of gut microbiota composition, making it the ideal dose.

Introduction

In modern broiler production, enhancing growth rate and feed conversion efficiency is a key goal of genetic selection and nutritional management. The Wenchang chicken, a broiler breed from Hainan Province, is favored in China and Southeast Asia for its tender meat and distinct flavor, which have been attributed primarily to fat deposition and composition (Wu et al., 2025). However, like other yellow-feathered broilers, this breed suffers from poorer growth performance and lower feed conversion efficiency, resulting in higher production costs than white chickens.

High-energy diets (HED) are commonly used in broiler production to improve growth rate and feed conversion efficiency (Chen, et al., 2024; Geng, et al., 2022; Wang, et al., 2024a). These diets can also increase intramuscular fat, which improves meat flavour and juiciness (Gao, et al., 2025). However, HED negativly impaict intestinal barrier function and lead to excessive fat deposition (Li, et al., 2025a). The intestinal barrier consists of physical, biological and immunological components. Its main role is to prevents harmful substances from entering the body (Che, et al., 2022). HED disrupt this barrier by increasing the abundance of harmful bacteria, altered gut permeability and induced inflammatory responses (Xiong, et al., 2025). This allows lipopolysaccharide (LPS), which produced by these bacteria, to reach the liver causing metabolic disorders and further lipogenesis (Ou, et al., 2024). Consequently, identifying nutritional strategies to maintain intestinal health and manage lipid metabolism in broilers on HED is a major focus in poultry nutrition research.

Chenodeoxycholic acid (CDCA), a primary bile acid synthesized in the liver, plays a central role in fat emulsification, digestion, and absorption (Cai, et al., 2022). Beyond its digestive function, CDCA has been shown to protect intestinal barrier integrity and suppress inflammation through the farnesoid X receptor (FXR)/TGR5 axis in murine models (Han, et al., 2023; Song, et al., 2019). In piglets, dietary CDCA improved intestinal morphology and upregulated tight junction protein expression (Song, et al., 2021). In broilers, adding bile acid to feed lowered triglyceride (TG) levels in plasma and liver, downregulated hepatic fatty acid synthase (FASN) expression, and alleviating hepatic lipogenesis (Wang, et al., 2024a). These findings suggest that CDCA possesses dual potential to simultaneously improve intestinal barrier function and regulate lipid metabolism.

In conclusion, we hypothesize that dietary CDCA supplementation can mitigate HED-induced intestinal barrier dysfunction and excessive fat formation, while maintaining the beneficial effects of HED on growth performance and meat quality. Therefore, this study established a HED-induced metabolic model in broilers to evaluate the effects of dietary CDCA supplementation on lipogenesis, intestinal barrier function, and gut microbiota, aiming to provide a scientific basis for the rational use of CDCA in improving intestinal health and lipid metabolism in broilers fed high-energy diets.

Material and methods

Material

The experimental Wenchang Chickens were provided by Hainan (Tan Niu) Wenchang chicken Co. Ltd. (Haikou, Hainan, China). CDCA (reagent grade, purity 99.5%, C804610, Shanghai, China) was purchased from Shanghai Macklin Biochemical Technology Co., Ltd., and was derived from chicken bile through enzymatic hydrolysis and subsequent purification.

Animals and experimental design

A total of 525 healthy 8-week-old female Wenchang Chicken with similar body weight (621.31±5.04) were selected and randomly allocated into five groups, each consisting of 7 replicates of 15 birds per pen. The control (CON) group received a standard corn-soybean meal complete broiler feed, while the HED group received a HED. The other three groups were received the HED with 50, 100, or 200 mg/kg CDCA added, respectively. The ingredient and chemical composition of the diets are presented in Table 1, and all diets met the Chinese National Standard "Formula Feed for Broilers" (GB/T 5916-2020). The experiment was conducted at the Yongfa Experimental Base of the Hainan Academy of Agricultural Sciences. Birds were reared in cages under controlled environmental conditions at 28–32°C and 55–65% relative humidity. A 12-h light cycle was provided, with unlimited access to feed and water for the entire 42-day experimental period. Daily feed intake was monitored, and total body weight per cage was recorded at the start and end of the experiment. Based on these data, the average daily weight gain (ADG), average daily feed intake (ADFI), and feed-to-gain ratio (F/G) were subsequently calculated.

Table 1.

Composition and nutrient levels of diets (air-dry basis, %).

Ingredients	Con	HED	HED + 50 mg/kg CDCA	HED + 100 mg/kg CDCA	HED + 200 mg/kg CDCA
Corn	72.88	56.66	56.66	56.66	56.66
wheat bran	3.96	0.75	0.75	0.75	0.75
Soybean meal	18.40	6.28	6.28	6.28	6.28
fish meal (CP62.5%)	0	3.98	3.98	3.98	3.98
Corn gluten meal	0	14.57	14.57	14.57	14.57
Lard	1.79	14.20	14.20	14.20	14.20
CaHPO4	0.74	1.25	1.25	1.25	1.25
L-Lys▪HCl	0.13	0.285	0.285	0.285	0.285
DL-Met	0.10	0.025	0.025	0.025	0.025
Threonine	0	0.0045	0.0045	0.0045	0.0045
Premixa	2.00	2.00	2.00	2.00	2.00
Total	100.00	100.00	100.00	100.00	100.00
Nutrient levlesb
ME (MJ/ kg)	12.60	16.38	16.38	16.38	16.38
Crude protein (%)	15.05	15.03	15.04	15.05	15.03
EE (%)	4.88	15.06	15.09	15.04	15.07
Ca (%)	0.69	0.69	0.69	0.68	0.69
Total phosphorus (%)	0.47	0.46	0.47	0.46	0.46
Lys (%)	0.81	0.81	0.81	0.82	0.80
Met (%)	0.34	0.34	0.35	0.36	0.34

^aPer kilogram of diet, the premix provided the following: vitamin A, 7500 IU; vitamin D, 3000 IU; vitamin E, 50 IU; vitamin K3, 50 mg; thiamine (vitamin B1), 90 mg; riboflavin (vitamin B2), 300 mg; pyridoxine (vitamin B6), 60 mg; cyanocobalamin (vitamin B12), 0.4 mg; niacin (vitamin B3), 1000 mg; pantothenic acid (vitamin B5), 300 mg; folic acid, 20 mg; biotin, 2.0 mg; iron, 1.3 g; copper, 0.25 g; zinc, 2.0 g; manganese, 2.35 g; iodine, 20.0 mg; selenium, 4.5 mg.

^bExcept for the calculated metabolizable energy, all other nutrient levels were measured values.

Details of the diet manufacture

All diets were prepared as powdered mash to avoid CDCA degradation during pelleting. The CDCA diet was manufactured using a stepwise dilution method: CDCA powder was sequentially mixed with basal diet to obtain 1-kg, 10-kg, and finally 100-kg batches, with 20-min mixing at each step in a V-type blender (YANGSI, Huizhou, China). Diets were stored at 4°C and refreshed daily.

Sample collection

After the experiment, a chicken with an average body weight was chosen from each replicate for sampling. Blood samples were collected from the wing vein, the serum was stored at −80°C. And then the chickens were euthanized by cervical dislocation according to the method described by Ripplinger (Ripplinger, et al., 2024), scalded at 60°C for 3 min, de-feathered using a rotating drum picker for 2 min, and manually eviscerated. After slaughter, the breast muscle, thigh muscle, and abdominal fat were dissected and weighed, and the eviscerated yield and half-eviscerated yield were calculated (Khan, et al., 2023).

Blood biochemical

A 3 mL blood sample was collected from the wing vein into a centrifuge tube. After standing at room temperature, the sample was centrifuged at 3000 rpm for 5 min at 4°C. Serum levels of diamine oxidase (DAO), and d-lactate were determined according to the manufacturer’s instructions, whereas other serum parameters were measured using an automated serum biochemical analyzer (Shandong Boke Biotechnology Industry Co., Ltd, BK-280). All kits were provided by Shanghai mlbio Biotechnology Co., Ltd (Shanghai, China).

lipopolysaccharide (LPS) detection

LPS concentrations in serum and jejunal mucosa were determined using enzyme‑linked immunosorbent assay (ELISA) according to the manufacturer’s instructions. The ELISA kit was supplied by Shanghai mlbio Biotechnology Co., Ltd (Shanghai, China).

Quantitative real-time polymerase chain reaction PCR (qPCR)

After slaughter, jejunal mucosa and abdominal fat samples were rapidly dissected on ice, transferred into 2 mL sterile centrifuge tubes, immediately frozen in liquid nitrogen, and subsequently stored at −80°C until further analysis. Total RNA was extracted according to the method described by Xiong (Xiong, et al., 2024). The mRNA expression levels of tight junction genes (Occludin, ZO-1, and claudin-1) and intestinal inflammatory genes (TLR-4, TNF-α, NF-κB, IL-1β, IL-6, IL-4, and IL-10) in the jejunum, as well as lipid metabolism genes (PPARα, PPARγ, SREBP-1c, FASN, FABP4, CPT-1, ABHD, and FXR) in abdominal fat, were determined by RT-qPCR using ChamQ Universal SYBR qPCR Master Mix (Qiagen, China) according to the manufacturer’s instructions. The primer sequences for all genes used in this study are listed in Table 2. β-Actin was used as an endogenous control, and relative gene expression was calculated using the 2^−ΔΔCt method.

Table 2.

qPCR primer sequences.

Gene	primer sequences (5′−3′)	Record ID
β-actin	F: ATTGTCCACCGCAAATGCTTC R: AAATAAAAGCCATGCCAATCTCGTC	NM_205518
TLR-4	F: AGTCTGAAATTGCTGAGCTCAAAT R: GCGACGTTAAGCCATGGAAG	NM_001030693
NF-κB	F: GTGTGAAGAAAGGAGGACKGAACTG R: GGCACGGTTGTCATAGATGG	NM_205129
IL-10	F: GAAGCGCAGCATCTCTGACA R: GCTGAGGGTGAAGTTTGAGGAA	XM_025143715.1
IL-4	F: AGACAAATAACAAAACTGAGC R: TTGGTGGAAGAAGGTACG	NM_001007079
IL-1β	F: GTGAGGCTCAACATTGCGCTGTA R: TGTCCAGGCGGTAGAAGATGAAG	NM_204524
IL-6	F: CAAGGTGACGGAGGAGGAC R: TGGCGAGGAGGGATTTCT	AJ309540
TNF-α	F: GAGCGTTGACTTGGCTGTC R: AAGCAACAACCAGCTATGCAC	NM_204627
Occludin	F: ACGGCAGCACCTACCTCAA R: GGGCGAAGAAGCAGATGAG	D21837.1
ZO-1	F: TATAGAAGATCGTGCGCCTCC R: GAGGTCTGCCATCGTAGCTC	XM_413773
Caludin-1	F: CATACTCCTGGGTCTGGTTGGT R: GACAGCCATCCGCATCTTCT	AY750897
CPT-1	F: GGGTTGCCCTTATCGTCACA R: TACAACATGGGCTTCCGTCC	AY675193
PPARɑ	F: CAAACCAACCATCCTGACGAT R: GGAGGTCAGCCATTTTTTGGA	AF470455
FASN	F: TGAAGGACCTTATCGCATTGC R: GCATGGGAAGCATTTTGTTGT	NM_205155
PPARγ	F: TCCTTCCCGCTGACCAAA R: TCCTGCACTGCCTCCACA	NM_204890
SREBP-1c	F: GTCGGCGATCCTGAGGAA R: CTCTTCTGCACGGCCATCTT	AY029224
FABP4	F: TGCTACCTGGCCTGACAAAA R: TCTTCCTGGTAGCAAACCCC	NM_012183
FXR	F: GAGCGTGAGGAAGAACCACA R: TGCAGTATCGGCACTGGTTT	NM_001396910.1
ABHD5	F: GGACCCTTTGGTCTAAGCCT R: GCATTGGCCTTTTTGCCCAT	NM_205145

Oil Red O staining

Following the procedure of Mehlem (Mehlem, et al., 2013), muscle samples were collected immediately after slaughter, fixed in 4% formaldehyde, sectioned into 6 μm frozen sections, and stained with Oil Red O. Lipid droplet area was quantified using ImagePro Plus 6.0 analysis software (Media Cybernetics, Maryland, USA).

Intestinal morphology measurements

Following fixation in 4% paraformaldehyde, jejunal tissues were embedded in paraffin and cut into 5 µm-thick sections, which were then stained with hematoxylin and eosin (H&E) (Guo, et al., 2021). For each slide, eight representative fields were imaged using a panoramic slide scanner (PANNORAMIC, 3DHISTECH, Budapest, Hungary). The villus height, crypt depth, and villus height-to-crypt depth (VH/CD) ratio were subsequently quantified with ImagePro Plus 6.0 software (Media Cybernetics, Maryland, USA).

DNA extraction, sequencing and bioinformatics analysis

Total genomic DNA was extracted from colon contents using the cetyltrimethylammonium bromide (CTAB) method. DNA purity and concentration were assessed via 1.5% agarose gel electrophoresis. The V3–V4 hypervariable regions of the bacterial 16S rRNA gene were subsequently amplified by PCR using barcoded primers and a high-fidelity DNA polymerase. The resulting PCR products were resolved on a 2% agarose gel; target amplicons of the expected size were excised and purified using a gel extraction kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Purified amplicons were then submitted to Novogene Bioinformatics Technology Co., Ltd. (Beijing, China) for library preparation and paired-end sequencing on an Illumina platform according to the company’s standard amplicon sequencing pipeline (Zhang, et al., 2024b).

Statistical analysis

Production performance and serum biochemical parameters were analyzed using linear regression. Other data were analyzed using one-way Analysis of Variance (ANOVA) followed by Tukey’s honestly significant difference test in GraphPad Prism 9.3. Data are shown as means ± standard error of the mean (SEM), and P < 0.05 was considered to indicate statistical significance.

Results

Effects of dietary CDCA supplementation on production performance of Wenchang chickens

As shown in Table 3, no significant difference in average daily gain (ADG) was observed between the CON group and the three HED+CDCA groups (P > 0.05), while ADG in the three HED+CDCA groups was significantly lower than that in the HED group by 15.8%, 11.2%, and 12.0%, respectively (P < 0.05). Compared with the CON group, the three HED+CDCA groups exhibited significantly lower ADFI by 14.0%, 8.4%, and 9.7% (P < 0.05). Meanwhile, their ADFI was significantly higher than that in the HED group by 0.2%, 6.7%, and 5.2% (P < 0.05). The F/G in the HED+CDCA groups was significantly lower than that in the CON group by 18.6%, 16.5%, and 21.5%, and significantly higher than the HED group by 8.5%, 11.3%, and 4.7% (P < 0.05). No significant differences were observed among the three CDCA dosages for any growth performance parameter (P > 0.05).

Table 3.

Effects of dietary CDCA supplementation on growth performance and slaughter performance of Wenchang Chicken.

Items	CON	HED	HED+CDCA			SEM	P-value
			50 mg/kg	100 mg/kg	200 mg/kg		A	L
ADG, g	13.80b	17.83a	15.02b	15.84b	15.69b	0.31	0.001	0.248
ADFI, g	62.95a	54.04b	54.13b	57.68b	56.83b	0.80	<0.001	0.025
F/G	4.24a	3.18b	3.45b	3.54b	3.33b	0.08	<0.001	<0.001
Carcass weight, kg	1.04b	1.26a	1.14b	1.14b	1.13b	0.02	<0.001	0.338
Dressed yield, %	88.41	90.48	88.22	89.17	87.75	0.30	0.08	0.212
eviscerated weight, kg	712.80b	783.89a	751.03ab	764.88ab	771.59ab	9.14	0.043	0.146
Half-eviscerated weight, kg	784.71b	901.17a	830.71ab	849.14ab	836.00ab	11.52	0.006	0.46
Half-eviscerated yield, %	64.75	63.70	64.09	65.79	64.43	0.01	0.734	0.746
Eviscerated yield, %	59.68	57.77	57.97	59.81	58.68	0.46	0.408	0.862
Abdominal fat yield, %	4.59b	10.25a	6.36b	6.12b	5.98b	0.49	<0.001	0.020
Breast muscle yield, %	13.39	13.64	13.44	13.15	13.59	0.23	0.962	0.740
Leg muscle yield, %	19.74	19.80	20.03	19.38	19.29	0.29	0.911	0.728

In the same row, values with different superscript lowercase letters differ significantly (P < 0.05). Data are presented as means ± SEM (n = 7).

For carcass traits, the HED+CDCA groups showed intermediate values for carcass weight, half-eviscerated weight, and eviscerated weight, with no significant differences compared with either the CON or HED groups (P > 0.05). For abdominal fat yield, the HED+CDCA groups exhibited reductions of 37.9%, 40.3%, and 41.7%, respectively, compared with the HED group (P < 0.05). Although no significant differences were found across the three CDCA dosages (P > 0.05), a clear dose-dependent decreasing trend was observed, with the 200 mg/kg group showing the maximum reduction and its value being the closest to that of the CON group. In addition, no significant differences were observed among all groups in dressed yield, eviscerated yield, half-eviscerated yield, breast muscle yield, or thigh muscle yield (P > 0.05). Collectively, CDCA supplementation effectively alleviated HED-induced excessive abdominal fat without adverse effects, with 200 mg/kg being most effective.

Effects of dietary CDCA supplementation on serum biochemical indexes of Wenchang chickens

To evaluate the effects of different levels of CDCA on the physiological status of Wenchang chickens, serum biochemical indicators were measured (Fig. 1). Compared with the CON group, the HED group showed significant increases of 37.68% in LDL-C and 21.04% in GLU (P < 0.05), as well as a significant decrease of 28.55% in HDL-C (P < 0.05). However, no significant differences in LDL-C, GLU, or HDL-C were detected between the CON group and all three levels of HED+CDCA groups (P > 0.05). Compared with the HED group, the all three HED+CDCA groups showed significant reductions of 19.35%, 26.48%, and 40.53% in LDL-C (P < 0.05), and 14.40%, 16.92%, and 18.77% in GLU (P < 0.05), respectively, with both parameters showing linear dose-dependent decreases. For serum proteins, No significant differences were observed in serum protein parameters (TP, ALB, and GLB) between the CON and HED groups, nor between the HED and HED+CDCA groups (P > 0.05). These results indicate that dietary CDCA supplementation effectively reduces serum lipid concentrations, indirectly alleviates lipid deposition, and contributes to maintaining normal liver function in Wenchang chickens. Furthermore, among all tested doses, 200 mg/kg CDCA treatment yielded the most pronounced reductions in abdominal fat percentage, F/C, GLU, and LDL-C levels, with all parameters showing significant dose-dependent linear trends. Consequently, the HED + 200 mg/kg CDCA group was adopted for all subsequent experiments

Fig. 1.

Effects of dietary CDCA supplementation on serum biochemical indexes of Wenchang Chicken. Serum TG (a). Serum GLU(b). Serum ALB (c). Serum GLB (d). Serum HDL-C (e). Serum LDL-C (f). In the same row, values with different superscript lowercase letters differ significantly (P < 0.05). Data are presented as means ± SEM (n = 7).

Effect of dietary CDCA on abdominal fat metabolism of Wenchang chickens

To investigate the molecular mechanism by which CDCA regulates lipogenesis in Wenchang chickens, the mRNA expression levels of lipid metabolism-related genes in abdominal adipose tissue were measured (Fig. 2). Compared with the CON group, the HED group significantly upregulated the mRNA expression of lipogenesis-related genes PPARγ, SREBP-1c, FASN, and FABP4 (P < 0.05), while significantly downregulated the expression of lipolysis-related genes PPARα, CPT-1, and ABHD (P < 0.05). Compared with the HED group, the 200 mg/kg HED+CDCA group significantly downregulated the mRNA expression of FXR, PPARγ, SREBP-1c, FASN, and FABP4 (P < 0.05), while significantly upregulated the mRNA expression of PPARα, CPT-1 and ABHD (P < 0.05). These results indicated that the HED induced excessive lipid deposition in Wenchang chickens by upregulating the expression of lipogenic genes and downregulating lipolytic genes, whereas supplementation with 200 mg/kg CDCA in the HED alleviates HED-induced excessive fat deposition by reversing the above mentioned gene expression alterations, thereby inhibiting lipid synthesis and promoting fatty acid oxidation.

Fig. 2.

Effect of dietary CDCA on abdominal fat metabolism of Wenchang Chicken. Relative mRNA expression (a-h). In the same row, values with different superscript lowercase letters differ significantly (P < 0.05). Data are presented as means ± SEM (n = 7).

Effect of dietary CDCA supplementation on intramuscular fat (IMF) concentration of Wenchang chickens

To investigate the effect of dietary CDCA supplementation in a HED on IMF content in Wenchang chickens, Oil Red O staining and total intramuscular fat content quantification were performed on breast and thigh muscles. The results showed that both the HED group and the 200 mg/kg CDCA-supplemented HED group exhibited significantly higher IMF content in the breast and thigh muscles than the CON group (Fig. 3a-b, P < 0.05). Moreover, the IMF content in the breast and thigh muscles of the 200 mg/kg CDCA-supplemented HED group was significantly lower than that of the HED group (Fig. 3a-b, P < 0.05). These findings suggest that both HED and HED supplemented with 200 mg/kg CDCA increase IMF deposition, but the this promoting effect was significantly weakened in the HED+CDCA group compared with the HED group alone.

Fig. 3.

Effect of dietary CDCA supplementation on IMF concentration of Wenchang Chicken. Oil Red O staining and intramuscular fat content in the leg muscle (a). Oil Red O staining and IMF content in the breast muscle (b). bar=20 μm. In the same row, values with different superscript lowercase letters differ significantly (P < 0.05). Data are presented as means ± SEM (n = 7).

Effect of dietary CDCA supplementation on intestinal morphology of Wenchang chicken

Given the susceptibility of the intestinal barrier to dietary challenges, we proceeded to examine the morphological structure of the intestinal mucosa. H&E staining of the jejunum of Wenchang chickens revealed that, compared with the CON group, the villus height and the VH/CD in the HED group were significantly reduced by 35.05% and 48.54%, while crypt depth was increased by 35.44% (Fig. 4b-d, P < 0.05). Compared with the HED group, supplementation with 200 mg/kg CDCA in HED increased villus height and the VH/CD by 36.60% and 53.79%, and decreased crypt depth by 19.04% (Fig. 4b-d, P < 0.05), and markedly reversed HED-induced intestinal morphology damage, indicating that CDCA supplementation effectively improves jejunal morphology in HED-fed Wenchang chickens.

Fig. 4.

Effect of dietary CDCA supplementation on intestinal morphology of Wenchang Chicken. H&e staining of intestinal morphology (a). Statistical diagram of intestinal morphology (b). bar=200 μm. In the same row, values with different superscript lowercase letters differ significantly (P < 0.05). Data are presented as means ± SEM (n = 7).

Effect of CDCA supplementation on intestinal barrier in Wenchang chicken

To further evaluate the protective effect of dietary CDCA supplementation on HED-induced intestinal barrier damage in Wenchang chickens, we sequentially measured the LPS levels in serum and jejunal mucosa, the mRNA expression of jejunal tight junction proteins, as well as the serum DAO and d-lactate levels. The results showed that CDCA significantly alleviated the HED-induced increases in serum and jejunal mucosal LPS levels, thereby reducing the damage caused by harmful substances (Fig. 5a-b, P < 0.05). It also upregulated Occludin, Claudin-1, and ZO-1 mRNA expression levels in the jejunum (Fig. 5c-e, P < 0.05), and reversed the HED-induced rise in serum DAO and d-lactate levels (Fig. 5f-g, P < 0.05). These findings indicate that CDCA mitigates HED-induced intestinal barrier damage by reducing the intestinal content of the harmful substance LPS.

Fig. 5.

Effect of CDCA supplementation on intestinal barrier in Wenchang Chicken. Serum LPS (a). Jejunal mucosa LPS (b). Claudin-1, Occludin, ZO-1 relative mRNA expression (c-e). Serum DAO (f). Serum d-lactic acid (g). In the same row, values with different superscript lowercase letters differ significantly (P < 0.05). Data are presented as means ± SEM (n = 7).

Effect of CDCA supplementation on mRNA expression of intestinal inflammatory factors in Wenchang chickens

To investigate the effect of CDCA on intestinal immune barrier dysfunction induced by a HED, the mRNA expression levels of immune-related factors in the jejunum were examined. Compared with the CON group, the HED group exhibited significantly increased mRNA expression levels of TLR-4, NF-κB, TNF-α, IL-1β, and IL-6 (Fig. 6a-e, P < 0.05), along with significantly decreased mRNA expression levels of IL-4 and IL-10 (Fig. 6f-g, P < 0.05). However, CDCA supplementation significantly reversed these changes, downregulating the expression of TLR-4, NF-κB, TNF-α, IL-1β, and IL-6, and upregulating the expression of IL-4 and IL-10 (P < 0.05). These findings indicate that CDCA reduces intestinal inflammation by inhibiting the TLR-4/NF-κB signaling pathway.

Fig. 6.

Effect of CDCA supplementation on mRNA expression of intestinal inflammatory factors in Wenchang Chicken. Relative mRNA expression (a-j). In the same row, values with different superscript lowercase letters differ significantly (P < 0.05). Data are presented as means ± SEM (n = 7).

Effect of CDCA supplementation on cecal microorganisms in Wenchang chickens

The cecal contents of Wenchang chickens were clustered and analyzed based on operational taxonomic units (OTUs), and a total of 4620 non-singleton OTUs were finally obtained after quality control. The numbers of unique OTUs in the CON, HED, and HED+CDCA groups were 1135, 885, and 813, respectively, and a total of 1081 OTUs were across all three groups (Fig. 7a). Alpha diversity analysis revealed no significant differences in the Chao1, Shannon, or Simpson indices among the groups (Fig. 7c). Beta diversity analysis showed a clear separation between the CON and HED groups; the HED+CDCA group clustered between them and was closer to the control group, with good intra-group aggregation (Fig. 7b).

Fig. 7.

Microbial diversity. OUTs Venn (a). α diversity (b). β diversity (c).

Following, we analyzed the top ten most abundant microbial taxa at the genus and species levels. At the genus level, the relative abundance of Rikenellaceae_RC9 gut_group, Faecalibacterium and Megasphaera in the control group and the HED+CDCA group was significantly higher than that in the HED group, whereas the relative abundance of Desulfovibrio in the HED+CDCA and CON group was significantly lower than that in the HED group (Fig. 8a, P < 0.05). At the species level, the relative abundance of Bacteroides_caecicola and unclassified_Faecalibacterium in the CON group and the HED+CDCA group was significantly higher than that in the HED group. These results indicate that CDCA supplementation in a HED ameliorates HED‑induced alterations in the gut microbiota. Further differential analysis at the genus level was performed using LEfSe, with an LDA score threshold >3, and the results are shown in Fig. 8c. A total of seven genera were significantly enriched in the CON group, including Bacteroides, Agathobaculum, CHKCI001, Prevotellaceae_Ga6Al_group, Succinatimonas, Shuttleworthia, and Ruminococcus_gauvreaull_group. Nine genera were significantly enriched in the high-fat diet group, including Synergistes, Megamonas, Barnesiella, Candidatus_Vestibaculum, Bilophila, UCG_009, Anaerotruncus, Romboutsia, and Helicobacter. And three genera were significantly enriched in the HED+CDCA group, including Negativibacillus, Oribacterium, and Catellicoccus.

Fig. 8.

Effect of CDCA supplementation on cecal microorganisms in Wenchang Chicken. Relative abundance of genus level (a). Relative abundance of species level (b). LEfSe analysis (c). Correlation analysis heatmap (d). *P < 0.05, **P < 0.01. Data are presented as means ± SEM (n = 7).

To elucidate the intrinsic relationship between gut microbiota alterations and host phenotypes, correlation analyses were performed between differentially abundant microbiota identified by LEfSe analysis and genes related to intestinal inflammation, barrier function, and lipid metabolism (Fig. 8d). The results showed that the microbiota enriched in the HED group, including Desulfovibrio, Helicobacter, Bilophila, Megamonas, and Anaerotruncus, were significantly positively correlated with the expression of pro-inflammatory genes (TLR-4, NF-κB, TNF-α, IL-1β, IL-6) and lipogenic genes (PPARγ, SREBP-1c, FASN) (P < 0.05). Conversely, these microbiotas were significantly negatively correlated with the expression of tight junction protein genes (Occludin, Claudin-1, ZO-1) and lipolytic genes (PPARα, CPT-1) (P < 0.05). These findings further confirm that specific microbiota enriched by a HED may synergistically promote intestinal inflammation, impair barrier function, and exacerbate lipid deposition by modulating host gene expression. Moreover, the intervention effect of CDCA may be partially attributed to its inhibitory action on these detrimental microbiotas.

Discussion

Effects of CDCA on growth performance

This study demonstrated that dietary CDCA supplementation at 50, 100, and 200 mg/kg effectively counteracted HED-induced excessive abdominal fat deposition in Wenchang chickens, while maintaining the growth-promoting advantages of the HED, as reflected by improved feed conversion ratio without compromising slaughtering performance. Among the tested doses, 200 mg/kg CDCA showed the most pronounced efficacy. Consistent with our findings, a study in yellow catfish (Pelteobagrus_fulvidraco) demonstrated that CDCA alleviates HED-induced hepatic lipid accumulation and bile acid metabolism disorders, while also enhancing growth performance and feed conversion rate (Zheng, et al., 2025). Though methodological differences (aquatic vs. poultry model, 8 vs. 6 weeks) exist, nevertheless, the fat-reducing effect of CDCA appears conserved across vertebrates. Several potential mechanisms may account for these observations. First, as a primary component of bile acids in poultry, CDCA efficiently emulsifies dietary lipids, thereby enhancing fat digestibility and absorption, which provides adequate metabolic energy to support rapid growth (Qin, et al., 2023; Song, et al., 2021). Second, CDCA regulates glucose and lipid metabolism via activation of FXR, optimizing the allocation of energy between growth and fat deposition(Li, et al., 2025b; Zheng, et al., 2025). Third, the improvement in intestinal barrier function and gut microbiota composition following CDCA supplementation restores intestinal absorptive capacity, further increasing the efficiency of nutrient digestion and utilization, and indirectly promoting growth et al., 2021).

Effects of CDCA on fat deposition and lipid metabolism

CDCA is a primary bile acid and a natural ligand of FXR. By efficiently activating the FXR signaling pathway, CDCA suppresses the expression of lipogenic genes such as SREBP-1c and FASN (Sirvent, et al., 2004). In addition, the FXR-PPARα/CPT-1 signaling axis plays a central role in maintaining hepatic lipid homeostasis (Zhu, et al., 2025). In the present study, 200 mg/kg CDCA intervention significantly upregulated the expression of FXR, ABHD, PPARα, and CPT-1, while downregulating the mRNA expression of SREBP-1c and FASN. These results indicate that CDCA reduces peripheral adipose tissue deposition through both the FXR-SREBP-1c/FASN pathway and the FXR-PPARα/CPT-1 pathway. Moreover, 200 mg/kg CDCA markedly downregulated the expression of PPARγ and FABP4, suggesting that it may limit adipose tissue expansion by inhibiting adipocyte differentiation. A transcriptomic study by Krattinger (Krattinger, et al., 2016) in primary human hepatocytes confirmed that CDCA treatment significantly regulates the expression of FABP family members, which is consistent with our findings.

However, while reducing excessive fat deposition, it may also have an adverse effect on the content of IMF, thereby reducing meat quality (Song, et al., 2025). Intramuscular fat content is an important factor determining key attributes of meat quality, including flavor, tenderness, color, and nutritional value. It is worth noting that too low an intramuscular fat content can directly lead to a decrease in meat flavor intensity and tenderness (Zhang, et al., 2023). Therefore, increasing intramuscular fat content becomes one of the effective ways to improve meat quality (Yu, et al., 2023). In this study, HEDs significantly increased the intramuscular fat content of Wenchang chickens. Although the addition of 200 mg/kg CDCA significantly reduced the IMF level in this context, the final IMF content in the HED+CDCA group was still significantly higher than that in the CON group (P < 0.05). This result indicates that while CDCA reduces abdominal fat deposition, the improvement effect of HEDs on meat quality is retained. The reason may be that abdominal fat primarily serves as a dynamic energy buffer, and is utilized easier than intramuscular fat during metabolic breakdown. Therefore, when subjected to changes in the external environment, its reaction speed and magnitude of change are usually ahead of intramuscular fat. In summary, dietary supplementation with 200 mg/kg CDCA can selectively reduce abdominal fat deposition without excessively depleting intramuscular fat, through the regulation of lipid metabolism-related gene expression, improving carcass traits while maintaining meat quality.

Effects of CDCA on intestinal morphology and barrier function

The intestine is not only the primary site for nutrient absorption but also the first line of defense against harmful external substances. The integrity of its barrier function is essential for maintaining systemic homeostasis. A HED has been demonstrated to impair intestinal health through multiple pathways (Hussain, et al., 2019). The present study systematically evaluated the protective effects of 200 mg/kg CDCA against HED-induced intestinal injury in Wenchang chickens. The results showed that the HED group exhibited significantly decreased jejunal VH, increased CD, and a reduced VH/CD ratio (P < 0.05). Concurrently, the levels of LPS, DAO, and D-LA in serum and intestinal mucosa were markedly elevated (P < 0.05), and the mRNA expression of tight junction proteins (Occludin, Claudin-1, ZO-1) was significantly downregulated, indicating typical intestinal morphological damage and barrier dysfunction. These findings are highly consistent with the intestinal injury phenotype induced by LPS challenge in broilers as reported by Fan (Fan, et al., 2025). Following CDCA intervention, villus height was significantly restored, crypt depth normalized, and the VH/CD ratio markedly improved (P < 0.05). Moreover, CDCA treatment significantly reduced LPS levels in serum and intestinal mucosa, decreased DAO and D-LA levels, and upregulated the expression of Occludin, Claudin-1, and ZO-1. Fan (Fan,et al., 2025) also reported that bile acid supplementation effectively ameliorated intestinal injury in LPS-challenged broilers. Similarly, studies found that dietary supplementation with 200 mg/kg CDCA significantly increased the jejunal VH/CD ratio and goblet cell count in weaned piglets (Song, et al., 2021). Despite differences in model species (avian vs. mammalian), injury induction (dietary vs. chemical), and intervention duration, the protective effect of CDCA on intestinal barrier function was consistent across studies, suggesting that this effect is broadly applicable across species and injury models. These findings indicate that 200 mg/kg CDCA effectively alleviates intestinal barrier dysfunction induced by a HED. This observation suggests that CDCA holds promise as a functional feed additive for maintaining intestinal health in poultry under high-energy feeding regimens.

Effects of CDCA on intestinal inflammation

Studies have shown that CDCA, as a natural endogenous ligand of FXR, exerts anti-inflammatory effects by activating FXR (Song, et al., 2019). Activation of FXR suppresses the transcription of NF-κB-dependent genes, including TNF-α, IL-1β, and IL-6, by inhibiting NF-κB signaling transduction (Wang, et al., 2024b). In the present study, HED-induced intestinal inflammation model in Wenchang chickens exhibited significant activation of the TLR4/NF-κB signaling pathway, characterized by elevated the mRNA levels of pro-inflammatory factors (TNF-α, IL-1β, IL-6) and reduced the mRNA levels of anti-inflammatory factors (IL-4, IL-10). Notably, 200 mg/kg CDCA reversed this imbalance via FXR-mediated inhibition of NF-κB, indicating that CDCA alleviates HED-induced intestinal inflammation through activation of the intestinal FXR-NF-κB pathway.

It is worth noting that the anti-inflammatory action of CDCA may involve more complex signaling networks, as CDCA itself can be metabolized by the gut microbiota into secondary bile acids, which also possess immunomodulatory activity (Padro, et al., 2024). Compared with the study by Wang (Wang, et al., 2024b), which focused on chemical-induced colitis in rodents, our study provides evidence in a poultry model under nutritional stress, extending the understanding of CDCA’s anti-inflammatory actions to agricultural species. Therefore, CDCA may ameliorate HED-induced intestinal inflammation through activation of the intestinal FXR-NF-κB signaling pathway and modulation of the gut microbiota.

Effects of CDCA on gut microbiota composition

Gut microbiota serves as a key regulatory node in the “gut-liver-fat” axis and plays a central role in maintaining host metabolic and immune homeostasis (Castells-Nobau, et al., 2025) . In this study, the effects of a HED and CDCA intervention on the cecal microbial community structure, composition, and function of Wenchang chickens were systematically analyzed using 16S rDNA high-throughput sequencing. The results showed no significant differences in the Chao1, Shannon, and Simpson indices among groups indicating that neither the HED nor CDCA intervention significantly altered the species richness or overall alpha diversity of the cecal microbiota. Beta diversity analysis further revealed that the impact of the HED on the cecal microbial community was primarily reflected in the remodeling of community composition rather than changes in species abundance.

A HED-induced gut microbiota dysbiosis and excessive fat deposition are prominent issues in poultry production (Chen, et al., 2025). LEfSe analysis revealed that the HED group was enriched with genera such as Synergistes, Megamonas, Barnesiella, Desulfovibrio, Bilophila, and Helicobacter. These genera are often considered harmful under high-fat conditions. A high-fat diet has been shown to increase the abundance of LPS-producing bacteria, such as Desulfovibrionaceae (Zhang, et al., 2024a). Both Desulfovibrio and Bilophila are sulfate-reducing bacteria that produce hydrogen sulfide. Their overgrowth under high-fat/high-protein dietary conditions are closely associated with intestinal inflammation and metabolic endotoxemia (Pimenta, et al., 2024). In addition, Helicobacter infection can induce chronic intestinal inflammation and impair mucosal barrier function (Wang, et al., 2026). The synergistic enrichment of these pro-inflammatory genera in the HED group constitutes a microbial basis for gut ecological imbalance and metabolic disorders. Studiesreported that dietary bile acid mixture (50 mg/kg cholic acid and CDCA) reduced fat deposition in broilers, with caecal Lactobacillus and Faecalibacterium enriched and Escherichia-Shigella reduced (Wang, et al., 2024a). In contrast, our study used CDCA alone to alleviate HED-induced intestinal injury and fat deposition. Both studies support a "microbiota remodelling–host metabolism" protective mechanism, but microbial responses diverged: they observed beneficial enrichment and pathogen suppression, while we found CDCA reversed pro-inflammatory sulphate-reducing bacteria expansion. These differences likely arise from bile acid type, dosage, or experimental conditions, yet both provide complementary evidence for exogenous bile acids in poultry "diet–microbiota–host" regulation.

Correlations among microbiota, inflammation, and lipid metabolism

Correlation analyses revealed that HED-enriched genera (Desulfovibrio, Helicobacter, Bilophila, Megamonas, Anaerotruncus) positively correlated with pro‑inflammatory genes (TLR4, NF-κB, TNF-α, IL-1β, IL-6) and negatively with tight junction proteins (Occludin, Claudin-1, ZO-1). This suggests HED triggers LPS-TLR4-NF-κB activation, systemic inflammation, and barrier dysfunction. CDCA reversed these correlations, likely via FXR activation, simultaneously suppressing harmful microbes and enhancing barrier function.

Regarding lipid metabolism, HED-enriched genera (Desulfovibrio, Helicobacter, Bilophila) positively correlated with lipogenic genes (PPARγ, SREBP-1c, FASN) and negatively with lipolytic genes (PPARα, CPT-1), indicating a microbiota‑host axis that exacerbates fat deposition. HED disrupts conversion of primary to secondary bile acids, inhibiting FXR/TGR5 signaling and promoting fat accumulation. CDCA reversed this pattern. Studies show that bile acids reduce serum/hepatic triglycerides and FAS expression (Yin, et al., 2021), while CDCA also decreases feed intake and downregulates lipogenic genes (FAS, ACCα, SCD-1) (Piekarski, et al., 2016) and transcription factors (SREBP-1/2, PPARα) in the liver (Watanabe, et al., 2004).

Collectively, our work provides the first integrated evidence that dietary supplementation with 200 mg/kg CDCA ameliorates HED-induced metabolic disorders in Wenchang chickens through a dual-axis mechanism. At the intestinal level, CDCA selectively remodels the gut microbiota—suppressing pro-inflammatory genera (Desulfovibrio, Helicobacter, and Bilophila) while restoring butyrate-producing taxa—thereby attenuating LPS-TLR4-NF-κB-driven inflammation and barrier disruption. At the host level, CDCA directly modulates FXR-mediated expression of lipogenic and lipolytic genes. To our knowledge, this gut-liver crosstalk mechanism has not been previously reported in broilers. Thus, CDCA represents a promising nutritional strategy that concurrently targets both microbial and host pathways to counteract HED-induced metabolic disturbances, providing a novel mechanistic framework for future research on bile acid interventions in poultry production.

Conclusion

Among the CDCA doses tested (50, 100, and 200 mg/kg), 200 mg/kg was most effective in reducing HED-induced abdominal fat and intestinal injury while maintaining growth and meat benefits. Mechanistically, 200 mg/kg CDCA suppressed pro-inflammatory genera, reduced LPS-TLR4/NF-κB activation, restored intestinal barrier function, and modulated lipid metabolism via FXR-mediated downregulation of SREBP-1c/FASN and upregulation of PPARα/CPT-1. Collectively, 200 mg/kg CDCA is the optimal dose for improving carcass traits and intestinal health in poultry on HED without adverse effects.

Data availability

The microbial sequencing raw data can be found in the Genome Sequence Archive in National Genomics Data Center, China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (https://ngdc.cncb.ac.cn/gsa), under the accession number of CRA043428. Other data will be made available on request.

Ethics declarations

All the experimental procedures applied in this study were reviewed and approved by the Experimental Animal Ethics Committee of Animal Husbandry and Veterinary Research Institute, Hainan Academy of Agricultural Sciences (HNSYY20240203). The company manager was aware of and consented to the use of their animal samples in this study. This study was conducted in accordance with the guidelines for laboratory animals issued by South China Agricultural University. All efforts are aimed at minimizing the pain of animals and reducing the number of animals used.

Authors’ contributions

Kun Ouyang and Tingzhou Xuan performed the experiments, analyzed the data, and wrote the original draft. Ting Chen, Liping Sun, Xiuping Wang, Quanwei Liu, Jie Liu and Qianyun Xi participated in animal experiments, analyzed data, and revised the manuscript.Limin wei, and Yongliang Zhang conceived and designed the study. All authors reviewed and approved the final manuscript.

Disclosures

Authors declare no known competing financial interests or personal relationships that could influence the results reported in this study.