Effects of Hiroshimana old pickle containing lactic acid bacteria as a potential probiotic source for broiler chicks

Abstract

Fermented vegetable waste is rich in lactic acid bacteria; however, no studies have investigated the probiotic effects of fermented vegetable waste on the gastrointestinal tract of poultry. This study aimed to evaluate effects of the fermented vegetable waste, Hiroshimana old pickle (HOP), on the growth performance, intestinal morphology, immune-related gene expression, and gut microbiota composition of broiler chicks. The group supplemented with 1% HOP (H1 group) showed no significant change in body weight (BW) and had a numerically lower feed conversion ratio (FCR) compared with the control group. This response was accompanied by an increase in jejunal villus height, resulting in a higher villus height-to-crypt depth ratio and suggesting enhanced absorptive capacity. In contrast, although the group supplemented with 3% HOP (H3 group) showed the lowest FCR among the dietary groups, this was accompanied by reduced feed intake and a slight decrease in BW, without improvements in jejunal morphology. Therefore, the lower FCR in the H3 group was interpreted as reflecting a feed intake–restricted condition rather than improved feed utilization. In the cecum, the H1 group showed a slight but insignificant reduction in IL-1β and TGF-β4 expressions, whereas the H3 group had significantly reduced IL-1β and TGF-β4 expressions. Together with the reduced IL-10 expression observed in the HOP-supplemented groups, these changes indicate altered expression of both pro-inflammatory and regulatory cytokine genes, potentially reflecting reduced mucosal immune stimulation. Microbiota analysis revealed that the HOP-supplemented groups had increased abundances of bacterial families associated with short-chain fatty acid production, including Lachnospiraceae and Butyricicoccaceae. These changes may be attributed to the combined effects of lactic acid bacteria and fermented plant-derived substrates. Overall, the findings indicate that 1% HOP supplementation promoted favorable intestinal adaptation and showed potential in improving feed utilization, whereas the inclusion of HOP at a higher concentration (3%) may impair performance owing to reduced feed intake. HOP therefore shows potential as a sustainable functional eco-feed ingredient, with its efficacy dependent on the appropriate concentration.

Introduction

In 2022, approximately 1.05 million tons of food were wasted worldwide, which is problematic both as a loss of usable resources and as a driver of environmental harm through high greenhouse gas emissions, land use, and freshwater consumption (UNEP, 2024). Furthermore, the global warming potential caused by the landfill disposal of 1 ton of food waste is more than 5 times higher than that resulting from recycling food into animal feed (Kim and Kim, 2010).

Food waste can be recycled into livestock feed referred to as eco-feed, which is recognized as a sustainable approach to mitigating environmental impacts associated with food waste. For example, in the poultry sector, tomato pomace is fed to Japanese quail breeders to increase the carotenoid content in the egg yolk (Reda et al., 2022). In addition, the addition of dried tomato waste to the diet of laying hens is reported to enhance egg yolk color and carotenoid content (Panaite et al., 2019). Furthermore, external key components responsible for the function of eco-feed might also be usable. For example, the mixture of fermented food waste, Hiroshimana old pickle (HOP), and rice vinegar residue (RVR) used to cultivate Aurantiochytrium sp. L3W producing docosahexaenoic acid and eicosapentaenoic acid results in a biomass mixture that enriches the docosahexaenoic acid and eicosapentaenoic acid in eggs (Asao et al., 2023). Subsequent microbial composition analysis showed that the biomass mixture contained the HOP and RVR-originated lactic acid bacteria (LAB) after cultivation of the L3W strain (Suenaga et al., 2025). Because the probiotic effects of LAB on poultry have been reported (Peng et al., 2022; Nii et al., 2023; Katu et al., 2025), we focused on the effects of the fermented food waste HOP.

Probiotics are live microorganisms that, when administered in adequate amounts, promote host health by balancing gut microbiota, inhibiting the proliferation of pathogenic bacteria, and supporting both immune modulation and intestinal barrier integrity (Wang et al., 2018; Nii et al., 2020a; Katu et al., 2025). Among these probiotics, LAB are particularly valued owing to their resilience in the gastrointestinal environment, competitive exclusion of pathogens from adhesion sites, production of antimicrobial compounds such as organic acids and bacteriocins, and capacity to influence host immune function (Kizerwetter-Świda and Binek, 2016; Sirisopapong et al., 2023; Katu et al., 2025). Such properties may make LAB a promising functional ingredient of fermented food waste administered as an eco-feed.

The gastrointestinal tract of poultry is a complex and highly dynamic organ system that carries out vital functions related to nutrient digestion, immune regulation, and microbial interactions. This system serves as the main point of contact between external factors such as feed, water, and microorganisms and the internal physiological environment and plays a key role in maintaining overall poultry health and performance (Wang et al., 2018; Nii et al., 2020b; Katu et al., 2025). Any disruption to the integrity of the intestinal lining, imbalance of gut microbiota, or irregular immune activity may lead to impaired nutrient absorption, reduced feed efficiency, and increased vulnerability to digestive infections (Aruwa et al., 2021; Katu et al., 2025). In more serious cases, the presence of pathogens in poultry products may also pose risks to human health through foodborne transmission (Nii et al., 2020b; Aruwa et al., 2021).

A previous study demonstrated that Lactobacillus reuteri promotes the expression of tight junction proteins such as Claudin1, zona occludens (ZO2), and junctional adhesion molecule (JAM2) to strengthen the intestinal barrier (Nii et al., 2020a). Administration of L. reuteri also modulates immune responses by reducing the concentrations of pro-inflammatory cytokines like IL-6 while enhancing the concentrations of anti-inflammatory markers such as IL-10 (Nii et al., 2020b). In general, the administration of LAB reduces the risk of gastrointestinal colonization by foodborne pathogens, including Escherichia coli, Campylobacter, Clostridium, and Salmonella, to improve the microbiological safety of poultry-derived products (Vieco-Saiz et al., 2019; Aruwa et al., 2021; Evangelista et al., 2021). However, HOP and RVR contain organisms from the Lactobacillaceae family, particularly Lactobacillus sakei (Suenaga et al., 2025), which exhibits anti-Listeria activity and inhibits Campylobacter (Dortu et al., 2008; Catacutan et al., 2022). These findings suggest that the administration of fermented vegetable waste such as HOP containing LAB may provide probiotic benefits to poultry. However, no studies have confirmed the probiotic effects of fermented food waste containing LAB, such as HOP, on the gastrointestinal tract of chickens.

This study aimed to explore the effects of HOP on the gastrointestinal tract and growth performance of broiler chicks. By examining the potential probiotic benefits of this fermented vegetable waste, we sought to determine its effectiveness in improving the intestinal health and well-being of the chicks. Furthermore, the microbiome composition of the jejunum and cecum feces was analyzed to investigate how HOP affected the gastrointestinal microbiome of the chicks.

Materials and methods

Fermented solid vegetable waste and basal diet

Hiroshimana old pickle provided by Yamatoyo Co. (Hiroshima, Japan) was used because of its abundance of LAB (Suenaga et al., 2025). Prior to use, the HOP was meticulously processed using a blender (V1200i, Vitamix, Cleveland, OH, USA) to achieve a finely crushed state to facilitate its optimal incorporation into the basal diet (Power Chicken Crumble, Nichiwa Sangyo Co., Ltd., Kobe, Japan). The nutrient compositions of the HOP and the basal diet are summarized in Table 1. In addition, Hiroshimana pickle is known to contain acetic, lactic, and l-glutamic acids (Kurotobi et al., 2026).

Table 1.

Nutritional value of the diets.

	HOPa	Power Chicken Crumbleb	H1c	H3c
Crude protein [%]	1.3	22	21.8	21.4
Crude Fat [%]	0.5	5	4.96	4.87
Crude fiber [%]	1.3	4	3.97	3.92
Crude ash content [%]	15.5	7	7.11	7.32
Calcium [%]	0.059	0.8	0.79	0.78
Phosphorus [%]	0.015	0.6	0.59	0.58
Calories [kcal/kg]	27	3100	3070	3020

^aAnalyzed by Bureau Veritas FAC Co., Ltd., Japan in accordance with the Food Labeling Guideline (Consumer Affairs Agency, Japan (2020) https://www.caa.go.jp/policies/policy/food_labeling/food_labeling_act/assets/food_labeling_cms201_220830_03.pdf (in Japanese), accessed on September 21, 2023).

^bReported by the manufacturing company, Nichiwa Sangyo Co., Ltd., Kobe, Japan.

^cTheoretically calculated.

Feeding experiment

All experimental procedures were approved by the Hiroshima University Animal Research Committee (approval no. C21-25-2). Fertilized eggs of the Ross 308 strain were commercially obtained from Fukuda Breeding Farm (Okayama, Japan). Upon hatching, only male chicks (average body weight (BW) approximately 40 g) were selected and randomly assigned to 1 of 3 dietary treatment groups (n = 8 per group). The sample size was determined based on the results of a preliminary experiment in which the jejunal villus height-to-crypt depth (V/C) ratio was used as the primary endpoint. The required minimum sample size estimated using Lehr’s approximation (Lehr, 1992) was 5 chicks per group. Therefore, 8 chicks were included in each group (n = 8 per group) to provide an additional margin and account for potential variation. The control group received the basal diet only, and the 2 experimental groups received the basal diet supplemented with either 1% (H1) or 3% (H3) of dry basis HOP. All chicks were housed in a temperature-controlled room at 30°C under a 23-h light and 1-h dark photoperiod. Feed and water were available ad libitum throughout the 14-d feeding period.

During the 14-d feeding trial, the daily feed intake (based on dry weight) was recorded daily, and BW was periodically measured at intervals of 2 or 3 days. The total feed consumption per group was recorded and divided by the number of individuals (n = 8) to estimate the average feed intake per chick. In addition, feed efficiency was evaluated by calculating the feed conversion ratio (FCR) using equation (1), defined as the total feed intake on a dry weight basis (g) divided by the BW gain (g) over the 14-d feeding experiment period.

$$FCR=\frac{totalfeedintake\left(g\right)}{bodyweightgain\left(g\right)}$$ (1)

At the end of the trial period, the chicks were euthanized by carotid exsanguination under anesthesia with carbon dioxide gas, and the jejunum and cecum were collected for analyses of mucosal structure and gene expression related to mucosal barrier functions. To analyze the expressions of the genes related to the molecules involved in mucosal barrier function, mucosal tissues from the jejunum and cecum were collected and subjected to RNA extraction. The luminal contents from the jejunum and cecum were collected and stored at –80°C for microbiome analyses.

Mucosal structure

To examine the histological structure of the intestinal mucosa, the jejunum and cecum samples were opened along their lengths and gently rinsed with 10% formalin in PBS to remove any residual feed and intestinal contents. As described by Nii et al. (2020a) the tissues were then cut into square blocks of approximately 5 mm and placed into sample cassettes for a 2-d fixation period. After fixation, the tissues were thoroughly washed under running tap water overnight. To ensure preservation for long-term analysis, dehydration and paraffin infiltration were conducted using a semi-automatic tissue processor (TP1020; Finetech, Tokyo, Japan). The samples were embedded in paraffin to create solid blocks, sliced into 4 µm thick sections using a rotary microtome (SM2000R; Finetech, Tokyo, Japan), and stained with Hansen’s hematoxylin and eosin. Microscopy images were obtained using the NIS-elements software (Nikon, Tokyo, Japan). For the jejunum, the villus height and crypt depth were measured at 5 randomly selected locations in each sample, and the V/C ratio was calculated. For the cecum, the villus height was measured.

Expressions of genes related to molecules involved in mucosal barrier function

To assess the impact of dietary supplements on intestinal health, the expression levels of genes related to the production of key molecules for mucosal barrier function, inflammatory response, and innate immunity were evaluated. The target genes were those related to tight junction proteins (Claudin3, ZO2, JAM2), pro-inflammatory cytokines (IL-1β, IL-6, TNFSF15), anti-inflammatory cytokines (IL-10, TGF-β3, TGF-β4), and avian β-defensin (AvBD2, AvBD7); additionally, the housekeeping gene RPS17 was used as an internal reference. The total RNA was extracted from the mucosa of the jejunum and cecum using the procedure reported by (Nii et al., 2020a). The tissue samples were washed with sterile PBS to remove the luminal contents. The mucosal layer was then gently scraped with sterile scalpel blades onto treated glass slides. The collected mucosa was homogenized in 500 µL of Sepasol RNA I Super G (Nacalai Tesque, Kyoto, Japan) using a Polytron Homogenizer (PT1200E; Kinematica AG, Switzerland). To prevent RNase contamination, homogenized mucosa samples were treated with RNase-AWAY (Molecular BioProducts, San Diego, CA, USA). After 5 min of incubation at room temperature, 100 µL of chloroform was added and mixed well, and the mixture was centrifuged at 14,000 rpm for 10 min at 4°C. The aqueous phase was transferred to a new tube and combined with 250 µL of isopropanol and 250 µL of 2-propanol, followed by a second centrifugation. The resultant RNA pellet was washed with 75% ethanol, allowed to air-dry, and then dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The purified RNA was stored at –80°C until use.

The total RNA concentration was measured with a NanoDrop Lite spectrophotometer (Thermo Fisher Scientific, MA, USA). Reverse transcription was performed using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd., Osaka, Japan) in accordance with the manufacturer’s protocol. The reaction mixture consisted of 6 µL of RNA solution, 2 µL of gDNA remover mix, and 2 µL of DN Master Mix. Reverse transcription occurred at 37°C for 5 min, followed by 37°C for 15 min, 50°C for 5 min, and 98°C for 5 min using a programmable thermal cycler (PTC-100; MJ Research, MA, USA). Real-time PCR was performed on the AriaMx Real-time PCR System (Agilent Technologies, CA, USA) with the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies). The PCR mix included 5 µL of SYBR Green Master Mix, 0.5 µL of each primer (10 µM), 2.5 µL of diluted cDNA, and 1.5 µL of Milli-Q water to give a total of 10 µL per reaction. The primer sequences for PCR analysis are shown in Table 2 (Nii et al., 2020a). The thermal cycling started with an initial denaturation at 95°C for 5 s, followed by 50 cycles of amplification. The annealing temperatures were optimized for each gene: 58°C for TGF-β4, TNFSF15, and ZO2; 60°C for Claudin3, IL-10, RPS17, and TGF-β3; 62°C for AvBD2; 63°C for AvBD7, IL-1β, and IL-6; and 64°C for JAM2. A melt curve analysis was conducted at the end of the amplification to verify the product specificity. The relative target mRNA expression for each sample was normalized against the RPS17 housekeeping gene and the mean fold-change in gene expression from a standard sample in the control group.

Table 2.

Primer sequences used for analyses of the gene expression.

Target genes	Forward and Reverse Primer	Accession no.
IL-1β	F: GTGAGGCTCAACATTGCGCTGTA R: TGTCCAGGCGGTAGAAGATGAAG	NM_204524.1
IL-6	F: AGAAATCCCTCCTCGCCAAT R: AAATAGCGAACGGCCCTCA	NM_204628.1
TNFSF15	F: CCTGAGTTATTCCAGCAACGCA	NM_001024578.1
IL-10	F: GCTGAGGGTGAAGTTTGAGGAA R: GAAGCGCAGCATCTCTGACA	NM_001004414.2
TGF-β3	F: CAGATCCTGGCGCTCTACA	NM_205454.1
TGF-β4	F: ATGAGTATTGGGCCAAAG	NM_001318456.1
AvBD2	F: GTTCTGTAAAGGAGGGTCCTGCCAC R: ACTCTACAACACAAAACATATTGC	NM_204992.2
AvBD7	F: ACCTGCTGCTGTCTGTCCTC	NM_001001194.1
Claudin3	F: GCCAAGATCACCATCGTCTC R: CACCAGCGGGTTGTAGAAAT	NM_204202.2
ZO2	F: GAAGCAGAGGTCGTAGTAGG R: CTGTCCATAGCCACCATCC	NM_204918.1
JAM2	F: AGCCTCAAATGGGATTGGATT R: CATCAACTTGCATTCGCTTCA	NM_001006257.1
RPS17	F: AAGCTGCAGGAGGAGGAGAGG R: GGTTGGACAGGCTGCCGAAGT	NM_204217.1

Bacterial composition in feces collected from the jejunum and cecum

To evaluate the gut microbial composition, the Fast DNA Spin Kit for Soil (MP Bio, Santa Ana, CA, USA) was used to extract DNA from fecal contents of the cecum and jejunum samples collected at the end of the feeding trial. The bacterial 16S rRNA gene region was amplified by PCR using the universal primer sets 1st-341f_MIX and 1st-805r_MIX, targeting the V3–V4 hypervariable regions of the bacterial 16S rRNA gene. The PCR conditions for amplification were: initial denaturation at 94°C for 2 min, 25 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 30 s, and final extension at 68°C for 7 min. The resulting amplicons were stored at 4°C and submitted to Bioengineering Lab Co., Ltd. for further sequencing and microbiota analysis. Amplicon sequence variants (ASVs) were identified via DADA2 (Callahan et al., 2016), with taxonomic classification carried out using the Greengenes database (version 22.10) (DeSantis et al., 2006).

Statistical analysis

The statistical significance of intergroup differences in the mean values of the chicks’ BW, villus height, crypt depth, V/C ratio, and gene expressions was determined using one-way ANOVA, followed by Tukey’s post hoc test. The statistical analyses were performed using Microsoft Excel (ver. 16, Microsoft, CA, USA). p < 0.05 was considered to indicate a significant difference.

Results and discussion

Growth and feed intake

Fig. 1 shows the BW and cumulative feed intake of broiler chicks during the 14-d feeding trial. At the end of the experiment, there was no significant difference in BW between the control and H1 groups. The BW in the H3 group was 2.3% lower than that in the control group; however, this difference was not statistically significant (p = 0.605). In contrast, the cumulative feed intake was reduced in the H1 and H3 groups; the cumulative feed intake in the H3 group was reduced by approximately 22% relative to the control group. These results indicate that dietary HOP supplementation altered the relationship between feed intake and growth performance.

Fig. 1.

(a) Body weight and (b) cumulative feed intake of the broiler chicks during the feeding experiment. Bars indicate SD. Control: control group fed a commercial diet; H1: group fed the commercial diet with 1% Hiroshimana old pickle (HOP) supplementation; H3: group fed the commercial diet with 3% HOP supplementation. n = 8 per group.

Previous studies have investigated the variable effects of fermented plant-derived by-products on feed intake and growth performance in broilers. For example, Nuraini et al. (2026) reported that a mixture of cassava peel and tofu dregs fermented with Pleurotus ostreatus increases the BW gain of male and female broiler chicks at the 20% inclusion level without affecting the feed ingestion. Another study showed that fermented palm kernel meal with Limosilactobacillus fermentum BN21 increases the BW gain of 11-day-old male broiler chicks (New Lohmann Indian River strain, MB 202 Platinum) but does not affect feed intake at the 2.5% supplementation level; however, the BW gain decreases when the supplementation level is increased to 10% (Fakhruddin et al., 2026). However, feeding palm kernel cakes fermented with Bacillus subtilis and xylanase to 21-day-old Arbor Acres broilers at a supplementation level of 8%–12% does not change either the BW gain or the feed intake (Li et al., 2026). In addition, the supplementation of fermented distillers grain generated in the production of Chinese Baijiu from sorghum, barley, wheat, and other grains does not affect the BW gain and feed intake of 5-day-old broiler chicks (Xu et al., 2025). Taken together, these findings indicate that the effects of fermented plant-derived feed ingredients on feed intake and growth may depend not only on the substrate and fermentation process but also on the supplementation level, broiler strain, and age.

Table 3 summarizes the effects of HOP supplementation on growth performance. The FCR was less than 1.0 in all 3 groups, indicating that less than 1 g of feed was required to achieve 1 g of BW gain. This phenomenon has been reported in ROSS 308 broiler chicks during the early growth phase, where FCR values below 1 can occur owing to the utilization of residual nutrients from the yolk sac (Aviagen, 2022). Both HOP-supplemented groups showed lower FCR values than the control group; however, the biological interpretation of this response differs between the H1 and H3 groups. In the H1 group, the reduced FCR together with the maintained BW suggests improved apparent feed utilization. In contrast, the lower FCR in the H3 group should be interpreted with caution, as the marked reduction in feed intake likely contributed to the ratio without reflecting a true improvement in growth efficiency. Therefore, the H3 response is more appropriately interpreted as a feed intake–restricted condition with a numerically lower FCR, rather than a genuine enhancement of feed conversion.

Table 3.

Effects of Hiroshimana old pickle (HOP) in the diet on the growth performance and feed conversion ratio (FCR) of broiler chicks.

	Control	H1	H3	p -value
Cumulative feed intake [g-dry/ind.]	485.06	439.32	376.30	Not available
Body weight gain [g/ind.] §	515±27	518±45	502±22	0.59
FCR	0.94	0.85	0.75	Not available
Reduction in FCR [%]	Not available	9.6	20.2	Not available

^§The second value represents the standard deviation (n = 8).

Control, commercial feed only; H1, commercial feed supplemented with 1% HOP; H3, commercial feed supplemented with 3% HOP.

A plausible explanation for the favorable response in the H1 group is that HOP derived from the Hiroshimana matrix contains LAB as described later in “Bacterial Community Profiles in the Jejunum and Cecum” and plant-derived bioactive compounds such as flavonoids (Nishiura et al., 1971). Fermented feed, supplementation with fermented plant-derived materials, and LAB are frequently associated with improved feed efficiency and enhanced intestinal morphology in broilers (Peng et al., 2022; Katu et al., 2025; Fakhruddin et al., 2026). This is consistent with the histological findings in the present study, in which the H1 group showed an increased jejunal villus height and a higher V/C ratio than the other 2 groups. In contrast, the reduced growth in the H3 group may be at least partly attributable to excessive salt intake and diet-acceptability constraints. The estimated salt concentrations in the H1 and H3 diets were 0.613 and 1.82 g NaCl equivalent/100 g feed, respectively, whereas recent studies in broilers have suggested that the optimal supplemental dietary NaCl level during the starter phase is around 0.20%–0.24%, and excessive salt can negatively affect physiological balance and jejunal development (Zhang et al., 2022). In addition, Biswas et al. (2024) reported that salt ingestion stimulates thirst and prioritizes water consumption in 11‑day‑old Lohmann broilers while enhancing the renal Na⁺/Cl⁻ excretion and metabolic load, which are both factors that can reduce feeding motivation. Although our experiment used newly hatched Ross 308 broiler chicks, the increased dietary salt may have similarly suppressed feed intake through conserved osmotic regulatory pathways. Thus, comparable salt‑induced physiological constraints might have contributed to the reduced feed intake and growth observed in the H3 group. Taken together, these results suggest that 1% HOP supplementation may improve apparent feed utilization, whereas 3% HOP supplementation likely imposed a nutritional or diet-acceptability constraint on feed intake.

The feed intake in the present study was recorded at the group level rather than for individual chicks. Therefore, individual variation in feed intake could not be assessed, and residual feed intake could not be calculated from the available data. Future studies using individual feeding records or an appropriately replicated pen-based design are needed to more rigorously evaluate the feed efficiency. Because improvements in feed efficiency are often associated with intestinal structural and functional adaptation, the histological characteristics of the jejunum and cecum were further examined.

Histological analysis

Representative histological images of the jejunum and cecum are shown in Fig. 2. The jejunum displayed long and slender villi, whereas the cecum exhibited shorter and broader mucosal projections. Fig. 3 compares the villus height, crypt depth, and V/C ratio in the jejunum and cecum samples. In the cecum, the addition of HOP to the diet did not affect the villus height. In contrast, in the jejunum, although there was no significant change in crypt depth (p = 0.957), the H1 group had a higher villus height than the control group (p = 0.001) and H3 group (p < 0.001). The increase in jejunal villus height in the H1 group resulted in a V/C ratio that tended to be higher than that of the control group (p = 0.055) and was significantly higher than that of the H3 group (p = 0.014). These findings indicate that 1% HOP supplementation promoted structural development of the jejunal mucosa. Because a higher V/C ratio is interpreted as an indicator of improved absorptive surface area and reduced epithelial turnover cost (Nguyen et al., 2021), the positive effects on intestinal mucosal morphology, as indicated by the higher V/C ratio, may have contributed to the lower FCR without reducing the BW gain in the H1 group (Table 3). The improved jejunal villus height and V/C ratio in the H1 group suggest a greater absorptive surface and potentially more favorable epithelial development. In contrast, the absence of comparable improvements in the H3 group indicates that increasing the HOP inclusion level did not produce additional morphological benefits. This non-linear response may reflect a balance between the beneficial effects of LAB and plant-derived bioactive compounds, and the potential adverse effects associated with excessive HOP inclusion, including the higher dietary salt load.

Fig. 2.

Histomorphometry of the (a) jejunum and (b) cecum of the broiler chicks in the control group.

Fig. 3.

Effects of Hiroshimana old pickle (HOP) administration on the villus height, crypt depth, and villus height/crypt depth ratio of the jejunum and cecum of the broiler chicks. Bars represent SD (n = 8). Control: commercial feed only; H1: commercial feed plus 1% HOP; H3: commercial feed plus 3% HOP. a and b indicate significant differences between treatments (p < 0.05).

Fermented feed particularly involving LAB and Lactobacillus-based supplementation has frequently been reported to enhance villus development and intestinal efficiency in broilers (Nii et al., 2020b; Peng et al., 2022; Katu et al., 2025; Fakhruddin et al., 2026). In addition, the V/C ratio is also enhanced by supplementation with fermented plant-derived by-products such as cassava peel and tofu dregs (Nuraini et al., 2026) and distillers grain (Xu et al., 2025) without the addition of LAB. Plant-derived bioactive compounds such as flavonoids may further contribute to the jejunal development by modulating gut microbial communities and intestinal physiology through antimicrobial, anti-inflammatory, and antioxidant properties (Prihambodo et al., 2020); this might be because beneficial gut microbes support intestinal development through both structural and metabolic mechanisms, including enhanced villus elongation and regulated crypt cell proliferation (Pangga et al., 2025). These findings suggest that the LAB and flavonoids in HOP may have caused the higher jejunal villus height in the H1 group.

In contrast to the H1 group, the H3 group did not show histological improvement in the jejunum despite a numerically lower FCR (Fig. 3). Given that the H3 group exhibited a reduced feed intake and lower average BW gain (Table 3), the findings suggest that the effects of HOP supplementation on the histological improvement depend on the dosage. Based on the cumulative feed intake (Table 3) and supplementation percentage, the H3 group ingested more HOP than the H1 group. This indicates that the H1 group demonstrated favorable intestinal adaptation, whereas the inclusion of 3% HOP had a negative impact on feed intake in the H3 group, possibly owing to the high salt content.

It should be noted that the feeding experiment was conducted with 8 chicks per group. As described in the Materials and Methods section, the sample size was determined using the V/C ratio as the endpoint; therefore, a larger sample size would be required to comprehensively evaluate additional effects of HOP. In addition, the feeding experiment was carried out during the first 14 days after hatching because this period represents a biologically relevant window for evaluating early responses to dietary additives in broiler chickens. For example, Christofoli et al. (2023) evaluated phytogenic feed additives in broilers from 1 to 14 days of age and showed that, despite the absence of significant differences in growth performance, essential oil supplementation improves nutrient metabolizability, lipid-related biochemical parameters, and intestinal histomorphometry. In addition, Perricone et al. (2025) reported that yeast-derived nucleotide supplementation exerts more pronounced effects during the starter and grower phases, particularly on BW, intestinal morphology, and tight junction-related gene expression during the first 21 days. However, several of these responses are less evident by 42 days (Perricone et al., 2025). Therefore, although the present findings provide evidence of the early responses of broiler chicks to HOP supplementation, further feeding studies with larger sample sizes and a longer time to market age are needed to confirm the persistence of the observed effects and evaluate the long-term impact of HOP supplementation on productivity.

Gene expression of factors related to mucosal barrier function

Fig. 4 shows the effects of HOP supplementation on the mRNA expression of the tight junction protein-related genes Claudin3, ZO2, and JAM2, which are essential for maintaining the intestinal barrier and preventing paracellular leakage. Because of the wide variation in the control group, there was no significant intergroup difference in the Claudin3 gene expression; however, the average expression of Claudin3 tended to be decreased in both the jejunum and cecum of the H3 group, and tended to be reduced only in the cecum in the H1 group. The ZO2 expression in the jejunum was significantly decreased by 3% HOP supplementation (p = 0.016), and both the H1 and H3 groups showed a significant reduction in the ZO2 expression in the cecum (p < 0.004). Furthermore, the H1 and H3 groups showed a tendency toward reduced jejunal JAM2 gene expression (p = 0.076) and showed significantly reduced JAM2 expression in the cecum (p < 0.046). These changes may be associated with a reduced requirement for the transcription of tight junction-related genes under limited inflammatory or toxic stimulation. These findings align with previous studies showing that tight junction protein-related gene expression either remains stable or declines under non-inflammatory conditions (von Buchholz et al., 2022).

Fig. 4.

Effects of Hiroshimana old pickle (HOP) administration on the mRNA expression of tight junction-related genes in the jejunum and cecum of broiler chicks. Control: commercial feed only; H1: commercial feed plus 1% HOP; H3: commercial feed plus 3% HOP. Each dot represents an individual sample (n = 8), and horizontal bars indicate the mean values. a and b indicate significant differences between treatments (p < 0.05).

Fig. 5 presents the expression levels of the pro-inflammatory cytokine genes IL-1β, IL-6 and TNFSF15, as well as the anti-inflammatory cytokine genes IL-10, TGF-β3 and TGF-β4. In the jejunum, HOP supplementation did not significantly alter the expressions of IL-1β, IL-6, IL-10, TGF-β3, and TGF-β4 (p > 0.05), whereas the TNFSF15 expression was significantly reduced, particularly in the H3 group (p < 0.050). TNFSF15 is a pro-inflammatory cytokine involved in inflammatory responses in chickens, and its expression is induced in the intestinal tract during microbial infection (Park et al., 2007, 2022). Therefore, the reduction in TNFSF15, together with the absence of increased IL-1β and IL-6 expression, indicates that high-level HOP supplementation did not induce an overt pro-inflammatory transcriptional response in the jejunum.

Fig. 5.

Effects of Hiroshimana old pickle (HOP) administration on the mRNA expression of inflammatory-related cytokines in the jejunum and cecum of broiler chicks. Each dot represents an individual sample (n = 8), and horizontal bars indicate the mean values. Control: commercial feed only; H1: commercial feed plus 1% HOP; H3: commercial feed plus 3% HOP. a and b indicate significant differences between treatments (p < 0.05).

In contrast to the jejunum, HOP supplementation significantly reduced the expressions of IL-1β and TGF-β4 within the cecum, particularly in the H3 group (p < 0.043), and significantly reduced the expression of IL-10 in both the H1 and H3 groups (p < 0.026). Although the reduction in IL-6 expression was statistically insignificant (p = 0.055), a downward trend was observed in the H1 and H3 groups. Given that the HOP used in this study contained LAB (Fig. 7), these results agree with a previous study that reported that oral administration of Lactobacillus plantarum attenuates the upregulation of inflammatory mediators such as IL-1β and IL-6 in chicks (Wang et al., 2018). Furthermore, flavonoids have also been reported to reduce expressions of IL-1β and IL-6 (Jin et al., 2010; Sun et al., 2022).

Fig. 7.

(a) Family-level and (b) species-level classifications of the bacteria detected in the fecal samples from the jejunum and cecum and in the Hiroshimana old pickle (HOP). The HOP data were derived from the study by Suenaga et al. (2025).

While the reduced expressions of TGF-β4 and IL-10 may initially appear contradictory, rather than indicating a decline or suppression of immune function, this pattern may reflect a physiological state characterized by limited immune stimulation in which antigenic exposure is reduced and no excessive immune response is required (Kogut et al., 2018). For example, this interpretation is consistent with previous evidence showing that IL-10 expression may increase during active inflammation and decline when inflammatory stimulation is limited (Meunier et al., 2025). The effects of the HOP were not limited to either pro- or anti-inflammatory cytokines but were instead associated with a broad reduction in the expression of immune-related genes. This pattern may indicate reduced mucosal immune stimulation rather than a shift toward an anti-inflammatory state. However, because both pro-inflammatory and anti-inflammatory cytokines were affected, and neither cytokine protein levels nor immune cell activity were assessed, the biological significance of these transcriptional changes remains to be determined.

Fig. 6 shows that dietary supplementation with HOP did not significantly affect the expression of AvBD2 or AvBD7. Avian β-defensins are key components of innate mucosal defense in chickens, and their expression is influenced by microbial and dietary stimuli (Terada et al., 2018). The lack of changes in the expressions of AvBD2 and AvBD7 suggests that the transcriptional responses to HOP were more evident in cytokine-related pathways than in the β-defensin-mediated antimicrobial response under the present experimental conditions.

Fig. 6.

Effects of Hiroshimana old pickle (HOP) administration on the mRNA expressions of the avian β defensin genes (AvBD2 and AvBD7) in the jejunum and cecum of broiler chicks. Each dot represents an individual sample (n = 8), and horizontal bars indicate the mean values. Control: commercial feed only; H1: commercial feed plus 1% HOP; H3: commercial feed plus 3% HOP. a and b indicate significant differences between treatments (p < 0.05).

In the present study, the expression of selected genes representing major pro-inflammatory, anti-inflammatory, antimicrobial, and barrier-related pathways was evaluated at the mRNA level to investigate the immunomodulatory effects of HOP. However, the intestinal permeability, tight junction protein abundance, and cytokine protein levels were not assessed. Therefore, the biological relevance of the observed transcriptional changes requires further investigation. Future studies should incorporate permeability assays, protein-level analyses, and cellular immune assessments to determine whether the observed transcriptional changes translate into functional alterations in intestinal barrier integrity and mucosal immune activity. These future investigations will better characterize the immunomodulatory effects of HOP and determine whether the observed changes in gene expression translate into functional alterations in intestinal barrier integrity and immune activity.

Bacterial community profiles in the jejunum and cecum

Fig. 7 presents the bacterial community analysis at both the family and species levels of fecal samples collected from the jejunum and cecum of chicks and HOP, where “other” includes all bacterial species with less than 1% relative abundance. The HOP used in the present feeding experiment was obtained from the same lot as Lot 1 previously characterized by Suenaga et al. (2025). In their study, 16S rRNA amplicon sequencing showed that Lactobacillaceae accounts for 46% of the bacterial community. Among the predominant Lactobacillales ASVs, the bacterial community is mainly represented by ASVs closely related to Lactobacillus sakei (31%), Lactobacillus ginsenosidimutans (4.7%), and Companilactobacillus alimentarius (2.8%) (Suenaga et al., 2025). The total bacterial abundance of HOP was approximately 6.24 × 10⁸ 16S rRNA gene copies/mg of HOP. Assuming four to nine 16S rRNA gene copies per genome, as reported for Lactobacillus spp. (Lee et al., 2008), and considering the relative abundance of Lactobacillaceae, the abundance of Lactobacillaceae associated with the HOP was estimated to be about 1 × 10⁵ cells/mg of HOP.

Lactobacillaceae has been reported to contribute to nutrient utilization (Katu et al., 2025), epithelial development, and host defense in poultry (Nii et al., 2020a, Nii et al., 2020b; Katu et al., 2025). As shown in Fig. 7, the relative frequency of Lactobacillaceae differed between the jejunum and cecum. Species-level analysis indicated that the Lactobacillaceae in the intestinal fecal samples was primarily represented by Lactobacillus gallinarum and Limosilactobacillus sp., which were different from the primary species of Lactobacillus present in HOP (Fig. 7b). The relative abundance of Lactobacillaceae was higher in the jejunum than the cecum. This trend is consistent with the niche-specific colonization patterns described in previous studies that found that Lactobacillaceae is more common in the jejunum of broiler chickens (Bjerrum et al., 2006; Dumonceaux et al., 2006; Xiao et al., 2017), which is an intestinal region associated with nutrient absorption and transient microbial passage (Walter, 2008). In contrast, Lactobacillaceae remained a minor component of the cecal microbiota in all 3 groups, which agrees with earlier findings that the cecum is primarily dominated by strict anaerobic fermenters such as Lachnospiraceae and Ruminococcaceae rather than facultative anaerobes like Lactobacillaceae (Xiao et al., 2017). The observed difference in the relative abundance of Lactobacillaceae between the jejunum and cecum may reflect the normal physiological ecology.

In the jejunum, the relative abundance of Lactobacillaceae decreased to 26% in the H1 group but increased to 59% in the H3 group. In the H1 group, Lactobacillaceae was accompanied by the appearance and enrichment of Peptostreptococcaceae and Lachnospiraceae, both of which belong to the class Clostridia within the phylum Firmicutes. Members of these families are anaerobic fermenters capable of using lactate produced by LAB to generate short-chain fatty acids, particularly butyrate (Ríos-Covián et al., 2016; Segura-Wang et al., 2021). Although the class Clostridia includes pathogenic bacterial species, no pathogenic taxa were detected. The enrichment of butyrate-producing bacteria likely enhanced the epithelial energy metabolism and promoted enterocyte proliferation (Kihal et al., 2025). In addition, Pseudomonadaceae and Mycobacteriaceae were detected at relatively high abundances in all jejunal samples. These taxa are found in the soil environment (Schlatter et al., 2020). Given their presence in all groups including the control group, these microorganisms might have been unintentionally included in the diet or water and ingested by the broiler chicks.

The cecal microbiota exhibited a more stable and homogeneous population than the jejunal microbiota, regardless of HOP supplementation. As shown in Fig. 7a, the dominant taxa in the cecum were members of the family Lachnospiraceae, followed by Ruminococcaceae. Species-level analysis further revealed that this dominance was primarily attributable to Anaerostipes butyraticus and Lachnoclostridium A130679 sp. within the Lachnospiraceae family, as well as Soleaferrea sp. within the Ruminococcaceae family (Fig. 7b). In addition, Agathobaculum desmolans, which belongs to the family Butyricicoccaceae, was also detected at moderate levels.

Interestingly, the relative abundances of Lachnospiraceae and Butyricicoccaceae in the cecum were increased by the HOP supplementation and were highest in the H3 group. Lachnospiraceae and Butyricicoccaceae are fiber-degrading anaerobes known to play a crucial role in the fermentation of complex carbohydrates together with Ruminococcaceae and the production of short-chain fatty acids, such as butyrate (Ducatelle et al., 2010; Biddle et al., 2013). Butyric acid has immunomodulatory effects in chickens, reducing the expressions of IL-1β, IL-6, and IL-10 in LPS-stimulated chicken macrophages (Zhou et al., 2014). The high relative frequencies of Lachnospiraceae and Ruminococcaceae, both recognized as butyric acid producers in the cecum, might be associated with the suppression of IL-1β and IL-10 and tendency for decreased IL-6 expression in the cecum (Fig. 5, Fig. 6). However, because cecal short-chain fatty acid concentrations were not measured in the present study, future studies including direct measurement of short-chain fatty acids are needed to confirm the functional significance of the observed microbiota changes associated with HOP supplementation.

Potential of HOP as a functional eco-feed

Taken together, the present results showed that HOP has potential as a functional eco-feed capable of improving the intestinal physiology in broiler chicks, although the effects depended on the HOP concentration. Supplementation at 1% (H1) improved the FCR, jejunal villus height, and V/C ratio without reducing the BW gain (Fig. 3, Table 3), indicating favorable intestinal adaptation and improved apparent nutrient utilization efficiency. In addition, both the H1 and H3 groups had reduced expression levels of IL-1β, IL-10, TGFβ4, ZO2, and JAM2 in the cecum, as well as TNFSF15 and ZO2 expression in the jejunum (Fig. 4, Fig. 5), suggesting that HOP supplementation influenced intestinal immune- and barrier-related responses irrespective of the concentration. These effects may be associated with the combined actions of multiple components present in the fermented vegetable matrix, including LAB and plant-derived bioactive compounds such as flavonoids, which may collectively contribute to modulation of the intestinal microbial populations, maintenance of epithelial homeostasis, and suppression of excessive immune activation. However, the present data do not allow direct attribution of these responses to any specific component, and the underlying mechanisms warrant further investigation.

HOP supplementation at 3% (H3) produced a different physiological response to HOP supplementation at 1%. Although reductions in the expressions of intestinal immune- and barrier-related genes were observed in the H3 group (Fig. 4, Fig. 5), this treatment did not improve the V/C ratio and overall FCR and resulted in a lower BW gain (Table 3). These findings suggest that the physiological responses induced by HOP were not linearly dose-dependent. The inclusion of 3% HOP might have adversely affected feed intake, potentially owing to reduced palatability or increased dietary salt load (Zhang et al., 2022), thereby diminishing the beneficial effects of HOP supplementation on growth performance and intestinal morphology. The observation that the expressions of intestinal genes were suppressed in both the H1 and H3 groups, whereas improvements in growth performance and intestinal morphology were detected only in the H1 group, further supports the possibility that the elevated salt content in the H3 diet offset the beneficial effects of HOP supplementation.

The HOP examined in this study was generated in a pickle factory in Hiroshima, Japan at approximately 100 tons/year, with an annual disposal cost of approximately 1 million JPY. Assuming an exchange rate of 1 euro = 180 JPY, the disposal cost is estimated at 5,600 euros. If the HOP is fully incorporated as a feed additive, this amount would represent 1% of 10,000 tons of broiler feed. The estimated market value of 10,000 tons of commercial broiler feed is 2.74–2.80 million euros (Waller, 2007); therefore, a 1% reduction in feed usage would generate an economic benefit of approximately 27,400–28,000 euros.

In addition, supplementation with HOP at 1% reduced FCR by 0.09 (Table 3). Assuming a conservative FCR improvement of 0.05, from 1.85 to 1.80, as reported by Waller (2007), the production of ROSS 308 broiler from 10,000 tons of commercial feed would increase from approximately 5,410-5,560 tons to 5,560-5,710 tons. Based on the reported margin of 0.29-0.30 euros/kg live weight (Waller, 2007), the additional 250 tons of broiler production would correspond to an economic benefit of approximately 72,500-75,000 euros.

Taking both the savings in disposal costs and the additional profit derived from increased broiler production, into account, the utilization of HOP generated from one pickle factory could provide a total economic benefit of approximately 105,500–108,600 euros. However, the cost of preprocessing the HOP prior to feed application should also be included in the economic analysis. In addition, this estimation is based on the results obtained using 8 chicks per group during the first 14 days of the broiler growth period. Overall, although the use of HOP as a feed additive may offer economic and environmental benefits, the feasibility of HOP supplementation in commercial broiler production requires verification in further studies that include long-term feeding trials using a larger sample size and comprehensive cost-benefit analyses.

Conclusions

This study demonstrated that dietary supplementation with HOP induced favorable changes in the feed efficiency and intestinal morphology in broiler chicks. Despite reduced cumulative feed intake and caloric consumption, BW gain was maintained by supplementation of HOP at 1% (H1), resulting in a 9.6% numerically lower FCR compared with the control group. Histological analysis revealed that 1% HOP supplementation significantly increased the jejunal villus height, leading to a higher V/C ratio, which may enhance the absorptive capacity of nutrients. In contrast, although the H3 group also showed a numerically lower FCR, this was not interpreted as improved feed utilization because of the reduced feed intake and BW gain. Furthermore, the improvement in jejunal morphology observed in the H1 group was not evident in the H3 group. HOP supplementation also altered the expression of several immune- and barrier-related genes, although the functional significance of these transcriptional changes remains to be determined. These findings suggest that the physiological responses induced by HOP were not linearly dose-dependent. Microbiome profiling revealed increased abundances in the HOP-supplemented groups of Lachnospiraceae and Ruminococcaceae, including Lachnoclostridium sp., Anaerostipes butyraticus, and Soleaferrea sp., which produce short-chain fatty acids that may contribute to improved mucosal integrity and nutrient utilization. Overall, these findings support the existence of an optimal concentration range for HOP supplementation in the broiler diet. HOP appears to be a promising sustainable feed ingredient derived from fermented vegetable by-products.

Authorship Contributions

BP contributed to the analysis and interpretation of the bacterial composition data and performed bacterial composition analyses. BP drafted the original manuscript and critically revised it for substantive intellectual content. ES acquired experimental data through the feeding experiment, analyzed intestinal mucosal structure, performed qPCR and bacterial composition analyses, and contributed to the interpretation of the resulting data. ES drafted the original manuscript and critically revised it for substantive intellectual content. TN contributed to the methodological design of the study and acquired experimental data by conducting the feeding experiment and analyzing intestinal mucosal structure. TN contributed to the interpretation of the resulting data and critically reviewed the manuscript for substantive intellectual content. SN conceived and designed the overall study, interpreted the experimental data, acquired funding, critically revised the manuscript for substantive intellectual content, and finalized it for submission. TS contributed to the methodological design of the study, performed qPCR and bacterial composition analyses, and interpreted the resulting data. TS critically reviewed the manuscript for substantive intellectual content. TG contributed to the conception and design of the feeding experiment based on preliminary evaluation of acceptable dietary NaCl levels and interpreted the resulting experimental data. TG critically reviewed the manuscript for substantive intellectual content. WN contributed to the conception and design of the feeding experiment based on preliminary evaluation of acceptable dietary NaCl levels and interpreted the resulting experimental data. WN critically reviewed the manuscript for substantive intellectual content. All authors reviewed and explicitly approved the final version of the manuscript and agreed to be personally and publicly accountable for all aspects of the work, including ensuring that any questions related to the accuracy or integrity of the work are appropriately investigated and resolved.

Funding

This study was supported by the Japan Society for the Promotion of Science (JSPS) through JSPS KAKENHI (25K03297) and by the Japan Science and Technology Agency (JST) as part of SICORP (JPMJSC21E8).

Ethics declaration

This study was conducted in accordance with the following guidelines for animal welfare and/or reporting: Hiroshima University Regulations for Animal Experiments. This study was approved by the Hiroshima University Animal Research Committee. (Approval No. C21-25-2).

Disclosures

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Satoshi Nakai reports financial support was provided by the Japan Society for the Promotion of Science and the Japan Science and Technology Agency. Other authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

All data generated or analyzed during this study are included in this article.