Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2026 Sep 14;105(12):107772. doi: 10.1016/j.psj.2026.107772

Effects of monochromatic light on thyroid hormone and endoplasmic reticulum stress-related signaling in broilers

Miao Chen a, Ge Hu b, Guifang Cao c, Daqing Wang c, Chenguang Du c, Zixu Wang a, Yaoxing Chen a, Jing Cao a,⁎
PMCID: PMC13625778  PMID: 42777370

Abstract

Thyroid hormones (TH) are pivotal regulators of poultry growth and development. However, the effects of monochromatic light on thyroid function in broilers remain unclear. Therefore, newly hatched Arbor Acre (AA) broilers were randomly reared under white light (WL, 400-700 nm), red light (RL, 660 nm), green light (GL, 560 nm), and blue light (BL, 480 nm) until 42 days. The results showed that compared with WL, RL reduced thyroid weight and elevated serum free triiodothyronine (FT3) levels, whereas GL produced no significant alterations in thyroid weight or circulating TH levels. In contrast, BL increased thyroid weight and thyroid index and decreased serum triiodothyronine (T3) and FT3 concentrations. Furthermore, thyroid hormone synthesis-related genes were slightly upregulated in RL compared with WL, although these changes were not statistically significant. Conversely, BL downregulated the expression of thyroid hormone synthesis-related genes, including thyroid-stimulating hormone receptor (TshR), thyroid transcription factor 1 (Ttf1), sodium-iodide cotransporter (Nis), and thyroid peroxidase (Tpo), and decreased type 2 deiodinase (Dio2) protein expression. Moreover, endoplasmic reticulum (ER) stress-related markers were slightly decreased in RL but elevated in BL, which activated the PERK-eIF2α-ATF4-CHOP pathway and was associated with oxidative stress and increased Bax expression. These findings suggest that monochromatic light affects thyroid function in broilers, and BL exposure is associated with altered thyroid hormone synthesis and ER stress-related signaling.

Keywords: thyroid hormone, endoplasmic reticulum stress, monochromatic light, broiler

Introduction

In recent years, driven by the pursuit of a healthy lifestyle and balanced nutrition, chicken consumption has steadily increased due to its low fat and high protein content, prompting producers to explore more efficient broiler rearing strategies. Poultry possess a unique photoreceptive system, and light—as a key environmental factor—markedly influences growth, reproduction, and metabolism (Rozenboim et al., 1999; Zhang et al., 2016; Wang et al., 2024). Previous studies have demonstrated that BL can promote body weight gain, reduce the feed conversion ratio, accelerate skeletal muscle development, and improve meat quality in broilers (Cao et al., 2008; Ke et al., 2011). The endocrine system plays a critical regulatory role in adaptive responses to external environmental cues (Paul and Brown, 2019), and the release of most endocrine signals exhibits diurnal variation (Czeisler and Klerman, 1999). Consequently, the lighting environment constitutes an important factor affecting neuroendocrine function.

As a key component of the avian endocrine system, the thyroid gland produces thyroid hormones (TH), which are essential regulators of growth and developmental processes (Mondal et al., 2020). Photoperiod length markedly modulates circulating thyroid hormone concentrations in avian species. Studies in Japanese quail have validated that long photoperiods significantly upregulate type II deiodinase (Dio2) expression in the ventral hypothalamic ependymal layer, accelerate local conversion of thyroxine (T4) to bioactive triiodothyronine (T3), and elevate hypothalamic T3 concentrations (Yoshimura et al., 2003). Investigations in pigeons further demonstrate that prolonged daily light hours increase plasma free thyroxine (FT4) and total T4 levels without eliciting significant alterations in circulating T3 (Rintamäki et al., 1985). Moreover, 12 h daily green light irradiation during chicken embryonic incubation accelerates embryonic development and elevates plasma T3 concentrations together with the T3/T4 ratio relative to dark incubation conditions (Tong et al., 2018). Conversely, combined blue–green monochromatic light exposure suppresses thyroid follicular development and reduces serum TH concentrations in broiler (Liu et al., 2024).

Iodothyronine deiodinases perform core functions in regulating the bioactivity of thyroid hormones. Dio2shows reciprocal expression patterns in response to altered thyroid status and modulates cellular thyroid‑hormone status to meet variable physiological requirements. Previous investigations on chickens have revealed a unique tissue-specific expression pattern inside thyroid glands. Dio2 serves as the predominant isoform, Dio3 displays moderate abundance, and Dio1 has the lowest expression quantity (Kowalik and Sechman, 2022). Quantification of intrathyroidal Dio2 and Dio3 expression can yield more direct insights into local thyroid‑hormone homeostasis and follicular epithelial cell function within the thyroid gland.

Endoplasmic reticulum (ER) stress is a cellular response to environmental stressors, such as an excessive protein folding load. Studies have confirmed that activation of ER stress in thyroid cells may affect thyroid function by slowing or interrupting the synthesis of THs (Ma et al., 2021). Under severe ER stress, thyroid follicles exhibit colloid depletion and vacuolization, and the proliferative capacity of follicular epithelial cells is markedly impaired (Xu et al., 2022). Moreover, ER stress can directly or indirectly disrupt proper folding of thyroglobulin (TG), thereby reducing TH synthesis(Wu et al., 2025).

Materials and Methods

Animal Housing and Sampling

Forty post-hatching day 0 (P0) male AA broiler chickens (Cangzhou Heshi Poultry Technology Co., Ltd., Hebei, China) were randomly allocated to four groups (n = 10) and raised under white light (WL, 400-700 nm), red light (RL, 660 nm), green light (GL, 560 nm), and blue light (BL, 480 nm). The broilers were kept on a 23 h light:1 h dark (23L:1D) photoperiod, with an irradiance of 0.025 W/m2 at the bird-head height. The birds were provided with ad libitum feed and water. At 42 days of age, broilers were weighed prior to blood collection from the wing veins. Serum was extracted from blood samples by centrifuged at 3000 rpm for 15 min. The serum was then kept at −80°C for further analysis. Broilers were humanely euthanized via cervical dislocation. Thyroid tissues were harvested and weighed, and the thyroid organ index was calculated accordingly.Tissue preservation protocols and experimental arrangements followed published methods (Wang et al., 2024). All animal procedures were approved by the Animal Welfare Committee of Beijing University of Agriculture (BUA612506133).

Hematoxylin and Eosin Staining (H&E Staining)

Thyroid tissue was fixed in 4% paraformaldehyde phosphate-buffered solution (pH 7.4) for 48 h, dehydrated by an alcohol gradient, and embedded in paraffin and sectioned into 5-μm-thick sections. The sections were stained with hematoxylin and eosin, and histological structures were observed via photomicrography (BX51, Olympus, Japan).

Immunohistochemical Staining (IHC)

Thyroid tissue was processed as described above to produce 5 µm-thick paraffin sections. The citrate buffer microwave heating approach was used to retrieve the antigen after slices underwent dewaxing in xylene and serial graded ethanol solutions. After 30 minutes of treatment with 3% hydrogen peroxide diluted in methanol, sections were rinsed three times with PBS (0.01 M, pH 7.4), and incubated with goat serum for 30 min. Subsequently, the sections were incubated with the primary antibody, proliferating cell nuclear antigen (PCNA, 10205-2-AP, rabbit, 1:800; Proteintech Group, Inc., USA) at 4°C overnight. Sections were washed with PBS and then incubated for 2 h at room temperature (RT) with biotin-conjugated goat anti-rabbit secondary antibody (A0277, 1:300; CoWin Biotech Co., Ltd., China). Following a PBS wash, the sections were incubated for 1.5 h at RT using streptavidin-horseradish peroxidase (SA-5004-1, 1:300, Vector Laboratories Inc., USA). Sections were stained with 0.05% 3,3′-diaminobenzidine tetrahydrochloride (DAB, Cat. No. D12384, Sigma, USA) to visualize immunoreactivity. ImageJ software was used to assess integrated optical density (IOD).

Periodic acid-Schiff staining (PAS staining)

The sections of 5-µm-thick thyroid tissue were dewaxed with xylene and alcohol and incubated the sections in a 1% periodic acid solution in the dark for 15 min. Sections were then stained with Schiff’s reagent for 10 minutes, counterstained with hematoxylin, and mounted with neutral gum. Histological observations were performed under a microscope, and mean gray values were quantified using ImageJ software.

Enzyme-Linked Immunosorbent Assay

Thyroid-stimulating hormone ( TSH, SL14004), T3 (SL02907), T4 (SL02908), free triiodothyronine (FT3, SL16971), and FT4 (SL16970) were measured in serum using commercial ELISA kits (Beijing SLCY Bio-Technology Co., Ltd., China).

Real-Time Quantitative PCR (RT-qPCR)

Total RNA was isolated from thyroid tissues with TRIzol reagent (CW0580, CwBiotech Co., Ltd., China). Reverse transcription was carried out with RevertAid reverse transcriptase (EP0441, Thermo Fisher Scientific Inc., USA) and RiboLock RNase inhibitor (EO0381, Thermo Fisher Scientific Inc., USA) to synthesize cDNA. RT-qPCR detection was carried out using the StepOnePlus real-time PCR system from Applied Biosystems (Applied Biosystems, USA). In Table 1, primers were listed. The 2−ΔΔCt technique was used to quantify the relative mRNA expression levels of target genes (Livak and Schmittgen, 2001).

Table 1.

Sequences of primers used for RT-qPCR.

Gene Accession no. Primer sequence (5′−3′)1 Product size (bp)
TshR NM_001033850.2 F:TGCCACTGGTTAGAGTCAGC 225
R:TCAGCACAGCCATCCTCTTG
Ttf1 XM_040649393.2 F:TGGCGGTAACGGCGG 253
R:TGCAGAAGGACTCAGCACAG
Nis HM131213 F:CACCACGGAGGCTGATGTT 75
R:GCGCAGCCACCGTGAT
Tg NM_001389477.2 F:GTCTGTAGGAGCTGACCGTG 279
R:CCGCTTATCGCTAGGAGCTT
Tpo XM_046939321.1 F:TACTGAGGCAATCCAGAAGG 105
R:AGCAGTGAGGTAGGACTTGCT
Dio2 NM_204114.3 F:GCTTCAGATCTTGCCGGTCT 261
R:CTATTGCTGCCATCGTTGCC
Dio3 NM_001122648.2 F:TACATCGAAGAAGCGCACCC 298
R:GCCGGGTTTTGTACTGGTCT
Grp78 NM_205491.2 F:GAGAAGTTTGCTGAGGAAGA 235
R:CCAGCTCCTTCTTCTTTGAT
Ire1 NM_001285499.2 F:AGCATTGCAGGAGATGCTGT 301
R:TGGAAGCTTGGTTTCCTCAA
Xbp1 NM_001006192.2 F:GCTTGGACGCTTTGAAGACA 243
R:GGGTCCAGACTGTCCAGAAA
Atf6 BM487177.1 F:TCCCCTGAAGGAGATGCAGA 285
R:GTTTTGGTTGTATCGATGGCCT
Perk XM_040671515.2 F:TACAGGGGCCAGCTGTATCT 175
R:ATTCATCCGACCCCACCAAC
eIF2α NM_001031323.2 F:GCTGCGAGTCAGTAATGGGTATAA 103
R:CTGCCAGGAAACTTGCCACA
Atf4 NM_204880.2 F:AATTGGCTCGCTGTGGACAG 148
R:CGGTGGCTTCCAGATGTTCC
Chop XM_040693765.2 F:GCATCCAGAAGGAAGAGCGT 200
R:GGGGACGTTGAGACAGCAAT
Bax XM_015274606.1 F: TCCTCATCGCCATGCTCAT 107
R: CCTTGGTCTGGAAGCAGAAGA
Bcl2 NM_205339.2 F: GATGACCGAGTACCTGAACC 114
R:CAGGAGAAATCGAACAAAGGC
Gapdh NM_204305.1 F:ATCACAGCCACACAGAAGACG 124
R:TGACTTTCCCCACAGCCTTA
Open in a new tab

1F = forward primer; R = reverse primer.

Antioxidant Activity Analysis

Serum and thyroid tissue levels of superoxide dismutase (SOD, A001-3), glutathione peroxidase (GSH-Px, A005-1), total antioxidant capacity (T-AOC, A015-1), and malondialdehyde (MDA, A003-1) were measured using commercial kits (Nanjing Jiancheng Biotechnology Co., Ltd., China) according to the instructions.

Western Blotting Analysis

Protein extraction and BCA protein quantification were carried out in accordance with previously published protocols (Wang et al., 2024). SDS-PAGE was used to separate protein samples (20 μg), which were then placed on PVDF membranes (IPVH00010, Merck Millipore, Germany). After blocking the membranes with 5% skim milk at RT for 2 h and then incubated overnight at 4°C with the following primary antibodies: from Proteintech Group, Inc., USA: PCNA (10205-2-AP, rabbit, 1:2000), BCL2-associated X protein (BAX, 50599-2-Ig, rabbit, 1:2000), B-cell lymphoma-2 (BCL2, 26593-1-AP, rabbit, 1:2000), and β-actin (66009-1-Ig, mouse, 1:8000); from Affinity Biosciences, USA: type 2 iodothyronine deiodinase (DIO2, DF12941, rabbit, 1:500); from Abmart Bio-medical Co., Ltd., China: glucose-regulated protein 78 (GRP78, T55166, rabbit, 1:1000); and from ABclonal Technology Co., Ltd., China: eukaryotic initiation factor 2 alpha (EIF2A, A16205, rabbit, 1:500), activating transcription factor 4 (ATF4, A0201, rabbit, 1:500), and C/EBP homologous protein (CHOP, A0221, rabbit, 1:500). After washing, membranes were exposed to HRP-conjugated goat anti-rabbit or goat anti-mouse secondary antibodies (1:8000; CoWin Biotech Co., Ltd., China) over 1.5 h. Immunoblots were visualized using a chemiluminescence kit (36208ES76, Yisheng Biotechnology Co., Ltd., China) in an electrochemiluminescence system, and grayscale values were analyzed by ImageJ software.

Statistical Analysis

Statistical analyses were conducted using SPSS 24.0 (SPSS Inc., USA) and GraphPad Prism 10.5 (GraphPad Software Inc., USA). One-way ANOVA was utilized to detect intergroup differences, and Tukey’s multiple range test was applied for post-hoc analysis. All experimental data were expressed as mean ± SEM. Differences reaching P < 0.05 were considered statistically significant.

Results

Effects of Monochromatic Light on the Morphological Structure of the Thyroid

Thyroid mass was markedly higher in the GL and BL groups than in the RL group, with increases of 27.32% (P = 0.0156) and 44.04% (P = 0.0002), respectively. The RL group exhibited a smaller thyroid organ index relative to the WL group. This index was 22.46% lower than that of the GL group (P = 0.0287) and 24.52% lower than that of the BL group (P = 0.0128). Thyroid follicular area expanded in the RL and BL groups. The GL group showed smaller follicular areas. No significant differences were observed between these indicators and those of the WL group (P > 0.05). The GL group had significantly elevated thyroid follicular density. Immunohistochemical detection of PCNA revealed greater PCNA abundance in the follicular epithelial cells of the RL group, representing a 54.23% increase relative to the GL group (P = 0.0038). No significant differences were detected in the average gray intensity of PAS staining across all light treatment groups (P > 0.05) (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Effects of monochromatic light on the morphological structure of thyroid tissue in broilers. (A) Paraffin sections of thyroid tissue stained with HE, immunohistochemistry, and PAS, Scale bar = 50 μm. (B) Thyroid weight. (C) Thyroid organ index. (D) Thyroid follicular area. (E) Thyroid follicular density. (F) IOD of PCNA. (G) Mean gray value of PAS staining. (H-I) PCNA protein expression levels in the thyroid. Data are the mean ± SEM. Bars with different letters indicate significant differences between groups (P < 0.05). Abbreviations: PCNA, proliferating cell nuclear antigen; WL, white light; RL, red light; GL, green light; BL, blue light.

Effects of Monochromatic Light on Thyroid Hormone levels

The RL group had the highest levels of serum TSH, T3, and T4, which were elevated by 19.37%–38.16% (P = 0.0002–0.0462) compared to the BL group; however, no significant changes were observed compared to the WL group (P > 0.05). Furthermore, serum FT3 and FT4 concentrations in the RL group were significantly greater than those in the GL group by 11.73%–42.52% (P = 0.0029–0.0235) and than those in the BL group by 24.42%–51.85% (P < 0.007) (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Effect of monochromatic light on serum TH levels in broilers. (A) Serum TSH levels. (B) Serum T3 levels. (C) Serum T4 levels. (D) Serum FT3 levels. (E) Serum FT4 levels. Data are the mean ± SEM. Bars with different letters indicate significant differences between groups (P < 0.05). Abbreviations: TSH, thyroid-stimulating hormone; T3, triiodothyronine; T4, thyroxine; FT3, free triiodothyronine; FT4, free thyroxine; WL, white light; RL, red light; GL, green light; BL, blue light.

Effects of Monochromatic Light on mRNA and protein levels of genes related to Thyroid Hormone Synthesis

Thyroid-stimulating hormone receptor (TshR), thyroid transcription factor 1 (Ttf1), sodium-iodide cotransporter (Nis), thyroid peroxidase (Tpo), and type II deiodinase (Dio2) had the highest mRNA expression levels in the RL group, with significant increases of 68.41% (P = 0.0036), 76.03% (P = 0.0049), 71.23% (P = 0.0291), 54.41% (P = 0.0004), and 54.30% (P = 0.0004)respectively, compared to the BL group. However, compared to the WL group, there were no significant differences in the mRNA levels of Ttf1, Nis, Tpo, or Dio2 (P > 0.05). Furthermore, the RL group had the lowest level of type III deiodinase (Dio3) mRNA expression, with a significant decrease of 30.68% (P = 0.0368) compared to the BL group (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Effects of monochromatic light on mRNA and protein levels of genes related to thyroid synthesis in broilers. The relative mRNA levels of TshR (A), Ttf1 (B), Nis (C), Tg (D), Tpo (E) , Dio3 (F), and Dio2 (G) . (H-I) Protein expression level of DIO2. Data are the mean ± SEM. Bars with different letters indicate significant differences between groups (P < 0.05). Abbreviations: TSHR, thyroid-stimulating hormone receptor; TTF1, thyroid transcription factor 1; NIS, sodium-iodide cotransporter; TG, thyroglobulin; TPO, thyroid peroxidase; DIO2, type II deiodinase; DIO3, type III deiodinase; WL, white light; RL, red light; GL, green light; BL, blue light.

Effect of Monochromatic Light on Antioxidant Activity in Serum and Thyroid

Antioxidant enzyme levels in the blood and thyroid, as well as overall antioxidant capacity, were significantly greater in the GL group than in the RL group. In particular, serum and thyroid tissue showed increases in SOD of 70.44% (P < 0.0001) and 41.75% (P = 0.0027), GSH-Px of 15.00% (P = 0.0165) and 73.80% (P = 0.0010), and T-AOC of 66.96% (P < 0.0001) and 36.82% (P = 0.0003). These parameters did not change significantly between the GL and BL groups (P > 0.05). Malondialdehyde (MDA) levels were also lowest in the GL group. MDA concentrations were 26.79%–49.11% (P < 0.0001) and 39.12%–59.48% (P < 0.0001) lower than those in the RL and BL groups, respectively. The GL and WL groups did not differ significantly (P > 0.05) (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Effects of monochromatic light on antioxidant levels in serum and thyroid of broilers. (A) Serum SOD levels. (B) Serum GSH-Px levels. (C) Serum T-AOC levels. (D) Serum MDA levels. (E) Thyroid SOD levels. (F) Thyroid GSH-Px levels. (G) Thyroid T-AOC levels. (H) Thyroid MDA levels. Data are the mean ± SEM. Bars with different letters indicate significant differences between groups (P < 0.05). Abbreviations: SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; T-AOC,total antioxidant capacity; MDA, malondialdehyde; WL, white light; RL, red light; GL, green light; BL, blue light.

Effects of Monochromatic Light on Endoplasmic Reticulum Stress in the Thyroid

There were significant differences in the endoplasmic reticulum stress marker GRP78′s mRNA and protein levels between the light treatment groups. GRP78 expression was greatest in the BL group and was significantly higher than in the RL group by 58.20% (P = 0.0077) at the mRNA level and 73.65% (P = 0.0200) at the protein level. The mRNA levels of inositol-requiring enzyme 1 (Ire1), X-box binding protein 1 (Xbp1), and activating transcription factor 6 (Atf6), three important genes of the three main unfolded protein response (UPR) pathways, did not significantly change between the light treatment groups (P > 0.05). On the other hand, downstream molecules of the protein kinase R-like ER kinase (PERK) pathway showed significant color-specific changes: EIF2A, ATF4, and CHOP mRNA and protein levels were significantly upregulated in the BL group, with mRNA levels rising by 51.10%–66.22% (P = 0.0052–0.0237) and protein levels rising by 68.40%–110.51% (P = 0.0006–0.0043) (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Effects of monochromatic light on mRNA and protein levels of endoplasmic reticulum stress-related genes in thyroid of broilers. The relative mRNA levels of Grp78 (A), Ire1 (B), Xbp1 (C), Atf6 (D), Perk (E), eIF2α (F), Atf4 (G), and Chop (H) . The protein expression levels of GRP78 (I), eIF2A (J), ATF4 (K), and CHOP (L). Data are the mean ± SEM. Bars with different letters indicate significant differences between groups (P < 0.05). Abbreviations:GRP78, glucose-regulated protein 78; IRE1, inositol-requiring enzyme 1; XBP1, X-box binding protein 1; ATF6, activating transcription factor 6; PERK, protein kinase R-like endoplasmic reticulum kinase; eIF2A, eukaryotic initiation factor 2 alpha; ATF4, activating transcription factor 4; CHOP, C/EBP homologous protein; WL, white light; RL, red light; GL, green light; BL, blue light.

Effects of Monochromatic Light on Apoptosis of Thyroid

The pro-apoptotic factor BAX had the greatest mRNA and protein levels in the BL group, which were significantly greater than those in the RL group by 58.02% (P = 0.0035) and 62.13% (P = 0.0486), respectively. On the other hand, the anti-apoptotic factor BCL2′s mRNA and protein levels were significantly lower than those of the RL group by 39.27% (P = 0.0168) for mRNA and 36.43% (P = 0.0319) for protein; no significant changes were seen when compared to the GL group (P > 0.05) (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

Effects of monochromatic light on apoptosis in thyroid of broilers. The mRNA expression level of Bax (A) and Bcl2 (B) . The protein expression levels of BAX (C) and BCL2 (D). Data are the mean ± SEM. Bars with different letters indicate significant differences between groups (P < 0.05). Abbreviations: BAX, BCL2-associated X protein; BCL2, B-cell lymphoma-2; WL, white light; RL, red light; GL, green light; BL, blue light.

Discussion

It has been demonstrated that monochromatic light controls broiler growth and development, with green and blue light particularly encouraging body weight gain (Cao et al., 2008). Furthermore, it has been observed that exposure to monochromatic blue light increases the percentage of oxidative muscle fibers in broiler gastrocnemius muscle (Liu et al., 2024). Birds possess a unique photoreceptive system. Deep-brain photoreceptors such as OPN5 capture light stimuli and transmit photic signals to the pituitary pars tuberalis to trigger TSH secretion (Nakane and Yoshimura, 2019). This cascade only elevates thyroid hormone concentrations within the mediobasal hypothalamic microenvironment. The accumulated high levels of T3 subsequently bind thyroid hormone receptor β (TRβ) to suppress TRH release, thereby modulating the canonical hypothalamic-pituitary-thyroid (HPT) signaling axis (Lezoualc'h et al., 1992). As important modulators of basal metabolism and systemic homeostasis, thyroid hormones are necessary for healthy growth and development (Mullur et al., 2014). It has been shown that the proportion of oxidized muscle fibers is negatively correlated with TH levels (Liu et al., 2024). Furthermore, exposure to green monochromatic light has been shown to decrease metabolic rate and improve energy utilization efficiency via modulation of TH levels, thereby promoting weight gain (Galan et al., 2025). In this investigation, we found that monochromatic red light reduced thyroid weight in broilers but caused no significant difference in thyroid organ index relative to white light and exerted negligible effects on thyroid tissue. In contrast, monochromatic blue light markedly enhanced thyroid weight and organ index, accompanied by enlarged follicular area, which indicates that blue light can promote thyroid development in broilers.

Early studies conducted in the 1980s first established that avian thyroid glands secrete significantly lower levels of T3 relative to T4. (McNabb et al., 1984; Lam et al., 1986), and T3 is primarily generated extrathyroidally through the deiodination of T4 (Darras et al., 2006). Circulating free THs reach target tissues via the bloodstream, with specific transmembrane proteins mediating their transport and ensuring proper physiological function (Bourgeois et al., 2016). In broilers, T3 and T4 are considered to exert both growth-inhibitory and compensatory growth-promoting effects (Yahav, 1999). Excessively low TH levels significantly reduce basal metabolic rate (Dulloo, 2025; Xie et al., 2025), resulting in increased fat deposition and obesity (Notova et al., 2019), increased levels of very-low-density lipoprotein (VLDL) and total cholesterol in the blood, as well as a greater percentage of oxidative muscle fibers in skeletal muscle, which reduces total energy expenditure (Dulloo, 2025). Conversely, hyperthyroid states are associated with elevated metabolic rates, marked body weight reduction (Notova et al., 2019), and systemic oxidative stress (Teixeira et al., 2019). The effects of four distinct monochromatic light treatments on TH production were examined in this study. The findings demonstrated that whereas exposure to short-wavelength blue light caused a significant decrease in TH concentrations, red light significantly increased circulating TH levels. These findings indicate that light of different wavelengths may differentially regulate thyroid function.

Thyroid hormone synthesis is regulated by a coordinated network of thyroid-specific transcription factors and functional genes. In chickens, genes involved in thyroid hormone biosynthesis, including TTF1, TSHR, NIS, TG, and TPO, exhibit developmental expression patterns closely associated with changes in circulating thyroid hormone levels, indicating their conserved roles in regulating thyroid function (Grommen et al., 2011). TSHR signaling regulates the expression of thyroid-specific genes involved in iodide uptake, thyroglobulin synthesis, and hormone production, whereas deiodinases such as DIO2 and DIO3 control local thyroid hormone activation and inactivation, thereby maintaining thyroid hormone homeostasis (Kowalik and Sechman, 2022). lterations in the expression of these genes directly affect the efficiency of TH synthesis. This study found that monochromatic red light promotes the expression of downstream genes related to TH synthesis by increasing the mRNA levels of TshR and Ttf1, thereby ensuring the high TH levels observed in the RL group.

The ER serves as the site of protein synthesis and folding. Accumulation of misfolded or improperly folded proteins can compromise cellular function and induce ER stress, further disrupting proper protein folding within the ER (Lin et al., 2010). When the burden of misfolded or unfolded proteins exceeds a critical threshold, the UPR is activated. This response encompasses at least three signaling pathways: the PERK pathway, the ATF6 pathway, and the IRE1 pathway (Li et al., 2025). To a certain extent, the UPR facilitates the clearance of misfolded or unfolded proteins, thereby restoring ER homeostasis (Xu et al., 2005). In the present study, exposure to blue light activated GRP78 and the PERK-EIF2A-ATF4 signaling pathway, whereas red light (RL) and green light (GL) induced no significant alterations compared with white light.

ER stress is not only associated with protein misfolding but can also activate apoptotic pathways (Oyadomari and Mori, 2004) As a pro-apoptotic factor, upregulation of BAX is directly linked to apoptosis induction, whereas, as an anti-apoptotic factor, downregulation of BCL2 may exacerbate the apoptotic response. In the present study, Bax expression was significantly elevated and BCL2 expression markedly reduced in the thyroid glands of broilers exposed to blue light, indicating that blue light induces apoptosis via ER stress.

Oxidative stress reactions can also be triggered by severe ER stress. ER stress dramatically raised reactive oxygen species (ROS) levels in a rat model of hypothyroidism, causing DNA damage and lipid peroxidation (Torres-Manzo et al., 2018). An imbalance between excessive ROS and antioxidant capacity triggers oxidative stress (Jelic et al., 2021). The amounts of many antioxidant enzymes, including SOD, GSH-Px, and T-AOC, determine antioxidant capability (Karkucinska-Wieckowska et al., 2022). In this study, the BL group exhibited a relatively complex antioxidant status, characterized by elevated antioxidant enzyme activity but still severe oxidative damage.

Conclusion

Monochromatic light differentially affected thyroid function in broilers. Red light increased serum FT3 concentration despite reduced thyroid weight, whereas blue light increased thyroid weight but decreased circulating TH levels and downregulated thyroid hormone synthesis-related genes. Moreover, blue light exposure was associated with ER stress-related signaling activation and oxidative stress responses in the thyroid gland. These findings suggest that monochromatic light, particularly blue light, influences thyroid function in broilers, with ER stress-related responses potentially involved in light wavelength-associated thyroid alterations.

Ethics declaration

Animal subject

This study was conducted in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines. This study was approved by the Animal Welfare Committee of Beijing University of Agriculture. (Approval No. BUA612506133)

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in the present study.

Author contributions

Miao Chen made substantial contributions to the conception and design of the study, methodology development, data curation, validation, and manuscript drafting. Ge Hu made substantial contributions to the analysis and interpretation of the data and contributed to project administration and the provision of resources. Guifang Cao made substantial contributions to the interpretation of the data and contributed to scientific supervision and the provision of resources. Daqing Wang made substantial contributions to the interpretation of the data and contributed to scientific supervision and the provision of resources. Chenguang Du made substantial contributions to the interpretation of the data and contributed to scientific supervision and the provision of resources. Zixu Wang made substantial contributions to data analysis and interpretation and contributed to project administration. Yaoxing Chen made substantial contributions to data analysis and interpretation and contributed to scientific supervision. Jing Cao made substantial contributions to the conception and design of the study, methodology development, scientific supervision, project administration, provision of resources, funding acquisition, and critical revision of the manuscript. All authors reviewed and critically revised the manuscript for important intellectual content, explicitly approved the final version of the manuscript, and agree to be personally and publicly accountable for all aspects of the work, ensuring that any questions regarding the accuracy or integrity of the work are appropriately investigated and resolved.

Acknowledgments

The authors thank Chen Tong and Zhaohui Zhang for their assistance in providing the experimental materials.This work was supported by the Natural Science Foundation of Beijing Municipality of China (6242017 and 6192012), the National Natural Science Foundation of China (32673797, 32573308, 31972632, and 31572474), the Foreign Cooperation Projects of Fujian Province of China (2024I0008), and the Open Project of the Key Laboratory of Higher Education in the Inner Mongolia Autonomous Region of Animal Embryo and Development Engineering.

Footnotes

Scientific Section: Physiology and Reproduction

References

  1. Bourgeois N.M., Van Herck S.L., Vancamp P., Delbaere J., Zevenbergen C., Kersseboom S., Darras V.M., Visser T.J. Characterization of chicken thyroid hormone transporters. Endocrinology. 2016;157(6):2560–2574. doi: 10.1210/en.2015-2025. [DOI] [PubMed] [Google Scholar]
  2. Cao J., Liu W., Wang Z., Xie D., Jia L., Chen Y. Green and blue monochromatic lights promote growth and development of broilers via stimulating testosterone secretion and myofiber growth. J. Appl. Poult. Res. 2008;17(2):211–218. [Google Scholar]
  3. Czeisler C.A., Klerman E.B. Circadian and sleep-dependent regulation of hormone release in humans. Recent Prog Horm Res. 1999;54(1999):97–130. discussion 130. [PubMed] [Google Scholar]
  4. Darras V.M., Verhoelst C.H., Reyns G.E., Kühn E.R., Van der Geyten S. Thyroid hormone deiodination in birds. Thyroid. 2006;16(1):25–35. doi: 10.1089/thy.2006.16.25. [DOI] [PubMed] [Google Scholar]
  5. Dulloo A.G. Adaptive thermogenesis driving catch-up fat during weight regain: a role for skeletal muscle hypothyroidism and a risk for sarcopenic obesity. Rev. Endocr. Metab. Disord. 2025;26(5):871–888. doi: 10.1007/s11154-025-09970-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Galan L., Solcan G., Solcan C. The influence of different light spectra on broiler chicken endocrine systems and productivity. Animals. 2025;15(21):3209. doi: 10.3390/ani15213209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Grommen S.V., Iwasawa A., Beck V., Darras V.M., De Groef B. Ontogenic expression profiles of thyroid-specific genes in embryonic and hatching chicks. Domest Anim Endocrinol. 2011;40(1):10–18. doi: 10.1016/j.domaniend.2010.08.002. [DOI] [PubMed] [Google Scholar]
  8. Jelic M.D., Mandic A.D., Maricic S.M., Srdjenovic B.U. Oxidative stress and its role in cancer. J. Canc. Res. Ther. 2021;17(1):22–28. doi: 10.4103/jcrt.JCRT_862_16. [DOI] [PubMed] [Google Scholar]
  9. Karkucinska-Wieckowska A., Simoes I.C., Kalinowski P., Lebiedzinska-Arciszewska M., Zieniewicz K., Milkiewicz P., Górska-Ponikowska M., Pinton P., Malik A.N., Krawczyk M. Mitochondria, oxidative stress and nonalcoholic fatty liver disease: a complex relationship. Eur. J. Clin. Invest. 2022;52(3) doi: 10.1111/eci.13622. [DOI] [PubMed] [Google Scholar]
  10. Ke Y., Liu W., Wang Z., Chen Y. Effects of monochromatic light on quality properties and antioxidation of meat in broilers. Poult. Sci. 2011;90(11):2632–2637. doi: 10.3382/ps.2011-01523. [DOI] [PubMed] [Google Scholar]
  11. Kowalik K., Sechman A. In vitro effects of polychlorinated biphenyls and their hydroxylated metabolites on the synthesis and metabolism of iodothyronines in the chicken (Gallus domesticus) thyroid gland. Gen Comp Endocrinol. 2022;318 doi: 10.1016/j.ygcen.2022.113989. [DOI] [PubMed] [Google Scholar]
  12. Lam S.K., Harvey S., Hall T.R. In vitro release of triiodothyronine and thyroxine from thyroid glands of the domestic fowl (Gallus domesticus) Gen Comp Endocrinol. 1986;63(2):178–185. doi: 10.1016/0016-6480(86)90154-1. [DOI] [PubMed] [Google Scholar]
  13. Lezoualc'h F., Hassan A.H., Giraud P., Loeffler J.P., Lee S.L., Demeneix B.A. Assignment of the beta-thyroid hormone receptor to 3,5,3′-triiodothyronine-dependent inhibition of transcription from the thyrotropin-releasing hormone promoter in chick hypothalamic neurons. Mol Endocrinol. 1992;6(11):1797–1804. doi: 10.1210/mend.6.11.1480171. [DOI] [PubMed] [Google Scholar]
  14. Li Y.-W., Liu Y., Luo S.-Z., Huang X.-J., Shen Y., Wang W.-S., Lang Z.-C. The significance of calcium ions in cerebral ischemia-reperfusion injury: mechanisms and intervention strategies. Front. Mol. Biosci. 2025;12 doi: 10.3389/fmolb.2025.1585758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lin C.F., Chen C.L., Huang W.C., Cheng Y.L., Hsieh C.Y., Wang C.Y., Hong M.Y. Different types of cell death induced by enterotoxins. Toxins. 2010;2(8):2158–2176. doi: 10.3390/toxins2082158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Liu Y., Wang Z., Cao J., Dong Y., Gao T., Chen Y. Effects of thyroid hormone on monochromatic light combinations mediate skeletal muscle fiber pattern in broilers. Poult. Sci. 2024;103(9) doi: 10.1016/j.psj.2024.103999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  18. Ma R., Li B., Zhang C., Lei R., Zhang X., Wang C., Zhang S., Wang A. Roles of endoplasmic reticulum stress in 2,2’,4,4’-tetrabromodiphenylether-induced thyroid cell apoptosis and autophagy. Ecotoxicol Environ Saf. 2021;214 doi: 10.1016/j.ecoenv.2021.112077. [DOI] [PubMed] [Google Scholar]
  19. McNabb F.M., Stanton F.W., Weirich R.T., Hughes T.E. Responses to thyrotropin during development in Japanese quail. Endocrinology. 1984;114(4):1238–1244. doi: 10.1210/endo-114-4-1238. [DOI] [PubMed] [Google Scholar]
  20. Mondal S., Manna D., Raja K., Mugesh G. Halogen bonding in biomimetic deiodination of thyroid hormones and their metabolites and dehalogenation of halogenated nucleosides. ChemBioChem. 2020;21(7):911–923. doi: 10.1002/cbic.201900619. [DOI] [PubMed] [Google Scholar]
  21. Mullur R., Liu Y.-Y., Brent G.A. Thyroid hormone regulation of metabolism. Physiol. Rev. 2014;94(2):355–382. doi: 10.1152/physrev.00030.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Nakane Y., Yoshimura T. Photoperiodic regulation of reproduction in vertebrates. Annu Rev Anim Biosci. 2019;7:173–194. doi: 10.1146/annurev-animal-020518-115216. [DOI] [PubMed] [Google Scholar]
  23. Notova S., Kiyaeva E., Miroshnikov S., Kazakova T. Influence of thyroid status on the content of essential chemical elements in the body of laboratory animals. IOP Conf. Ser.: Earth Environ. Sci. 2019;341(1) [Google Scholar]
  24. Oyadomari S., Mori M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 2004;11(4):381–389. doi: 10.1038/sj.cdd.4401373. [DOI] [PubMed] [Google Scholar]
  25. Paul S., Brown T.M. Direct effects of the light environment on daily neuroendocrine control. J. Endocrinol. 2019;243(1):R1–R18. doi: 10.1530/JOE-19-0302. [DOI] [PubMed] [Google Scholar]
  26. Rintamäki H., Reijonen H., Hissa R. The effect of pinealectomy on plasma levels of thyroid hormones in pigeons reared under different photoperiods. Comp Biochem Physiol A Comp Physiol. 1985;82(1):97–100. doi: 10.1016/0300-9629(85)90710-8. [DOI] [PubMed] [Google Scholar]
  27. Rozenboim I., Robinzon B., Rosenstrauch A. Effect of light source and regimen on growing broilers. Br. Poult. Sci. 1999;40(4):452–457. doi: 10.1080/00071669987197. [DOI] [PubMed] [Google Scholar]
  28. Teixeira R.B., Fernandes-Piedras T.R.G., Belló-Klein A., Carraro C.C., Araujo A.S.d.R. An early stage in T4-induced hyperthyroidism is related to systemic oxidative stress but does not influence the pentose cycle in erythrocytes and systemic inflammatory status. Arch. Endocrinol. Metab. 2019;63(3):228–234. doi: 10.20945/2359-3997000000128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tong Q., McGonnell I.M., Demmers T.G.M., Roulston N., Bergoug H., Romanini C.E., Verhelst R., Guinebretière M., Eterradossi N., Berckmans D., Exadaktylos V. Effect of a photoperiodic green light programme during incubation on embryo development and hatch process. Animal. 2018;12(4):765–773. doi: 10.1017/S1751731117002117. [DOI] [PubMed] [Google Scholar]
  30. Torres-Manzo A.P., Franco-Colín M., Blas-Valdivia V., Pineda-Reynoso M., Cano-Europa E. Hypothyroidism causes endoplasmic reticulum stress in adult rat hippocampus: a mechanism associated with hippocampal damage. Oxidative Med. Cell. Longev. 2018;2018(1) doi: 10.1155/2018/2089404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang L., Wang Z., Chen Y., Cao J. Effects of monochromatic light on hepatic glycogen and lipid synthesis in broilers. Poult. Sci. 2024;103(1) doi: 10.1016/j.psj.2023.103193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wu C., Sun M., He Y., Jiang J., Wang L., Wang Y., Yu Y. PERK/eIF2α pathway affected the thyroid hormone synthetic in hypertensive disorders of pregnancy rats. Front. Endocrinol. 2025;16 doi: 10.3389/fendo.2025.1552065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Xie L., Huang Y., Ma X., Ma X., Wang J., Gao T., Chen W. Effects of subclinical hypothyroidism during pregnancy on mtDNA methylation in the brain of rat offspring. BMC Neurosci. 2025;26(1):6. doi: 10.1186/s12868-025-00930-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Xu C., Bailly-Maitre B., Reed J.C. Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest. 2005;115(10):2656–2664. doi: 10.1172/JCI26373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Xu Q., Zhao T., Ri H., Ye J., Zhao W., Zhang Y., Ye L. Di (2-ethylhexyl) phthalate induced thyroid toxicity via endoplasmic reticulum stress: in vivo and in vitro study. Environ. Toxicol. 2022;37(12):2924–2936. doi: 10.1002/tox.23648. [DOI] [PubMed] [Google Scholar]
  36. Yahav S. Effect of early-age thermal conditioning and food restriction on performance and thermotolerance of male broiler chickens. Br. Poult. Sci. 1999;40(1):120–126. doi: 10.1080/00071669987944. [DOI] [PubMed] [Google Scholar]
  37. Yoshimura T., Yasuo S., Watanabe M., Iigo M., Yamamura T., Hirunagi K., Ebihara S. Light-induced hormone conversion of T4 to T3 regulates photoperiodic response of gonads in birds. Nature. 2003;426(6963):178–181. doi: 10.1038/nature02117. [DOI] [PubMed] [Google Scholar]
  38. Zhang L., Cao J., Wang Z., Dong Y., Chen Y. Melatonin modulates monochromatic light-induced GHRH expression in the hypothalamus and GH secretion in chicks. Acta Histochem. 2016;118(3):286–292. doi: 10.1016/j.acthis.2016.02.005. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES