Differentially expressed miRNA Cargo From Boar Seminal Extracellular Vesicles Is Linked With Motility Quality in AI Doses

ABSTRACT

Sperm motility is a key parameter for male selection and is closely linked to male fertility status. miRNAs have been proposed as fertility biomarkers, and their regulatory effects on sperm motility have been previously investigated. In the present study, the miRNA cargo from three different sources, seminal extracellular vesicles, free transcripts in seminal plasma and spermatozoa, was analysed from semen samples with high motility and reduced motility. Three differentially expressed miRNAs were identified in seminal extracellular vesicles (miR‐6529‐5p, miR‐146a‐5p and miR‐15a‐5p), two in seminal plasma (miR‐532‐5p and miR‐98‐5p) and one in spermatozoa (miR‐1468‐5p). These miRNAs have been reported to play regulatory roles in other species that may be associated with sperm motility, and could therefore potentially serve as motility‐related biomarkers.

1. Introduction

In animal production systems, male fertility is one of the most important criteria for animal selection. The production of semen doses for artificial insemination is widely used in the porcine industry, and breeding males are selected based on a range of quality parameters, not only on their genetic quality, but also on their reproductive performance. Among them, sperm motility is a key semen quality parameter that is directly associated with the fertility status of males (Fernández‐López et al. ²⁰²²). Computer‐assisted sperm analysis (CASA) systems are extensively used in insemination centres during semen processing and represent a critical parameter in semen doses production, being a selective criterion for male selection. Although the importance of sperm motility is well recognised, the molecular mechanisms underlying differences in sperm motility remain largely unresolved.

Spermatozoa recovered from the epididymis are still immature and remain largely immotile. One component that appears to trigger the motility activation prior to ejaculation is extracellular vesicles (EVs) (Moya‐Fernández et al. ²⁰²⁵). These nanoparticles are secreted by different male sexual glands and are present in seminal plasma (SP), where they interact with spermatozoa before, during and after ejaculation, transferring biologically active molecules to the sperm cells (Rodriguez‐Martinez and Roca ²⁰²²). Several studies have also associated the presence of specific microRNAs (miRNAs) with enhanced sperm motility (Curry et al. 2011), and miRNAs have also been identified within seminal EVs (Y. Zhao et al. ²⁰²⁴). However, the relationship between miRNAs present within spermatozoa and those carried externally through EVs or as free transcripts in SP, as well as their functional consequences, remains poorly understood.

In this study, miRNA presented in sperm cells, EVs and SP from high motility (HM) and reduced motility (RM) boars used in commercial porcine production was analysed in order to identify potential fertility biomarkers for the livestock industry.

2. Methods

2.1. Animal Handling and Sperm Collection and Manipulation

Commercial AI doses from the Landrace boar breed were provided by the AI centre AIM Ibérica, León, Spain (Topigs Norsvin Spain SLU) in accordance with European (2010–63‐EU; ES13RS04P, July 2012) and Spanish regulations (ES300130640127, August 2006). Samples were extended in a commercial extender from Magapor (Spain) to a final concentration of 30 × 10⁶ spermatozoa/mL in a total volume of 80 mL. Semen doses were stored at 17°C until analysis. Sperm motility was assessed using the CASA system (SPERMTECH AI Station 1.2.24, Spain), and the percentage of total motility (TM) was used to classify males into two groups: RM and HM.

2.2. Experimental Design

The aim of this study was to gain insight into the molecular mechanisms underlying differential sperm motility in boars. To this end, the miRNA transcriptome and differentially expressed miRNAs (DEMs) were analysed in seminal plasma EVs (n = 6 RM, n = 6 HM), spermatozoa (n = 6 RM, n = 6 HM) and free transcripts present in seminal plasma (n = 6 RM, n = 6 HM).

2.3. Isolation and Characterisation of Seminal EVs

Seminal EVs were isolated from both RM and HM samples from 20 mL of commercial AI doses from individual males. Sperm cells and debris were eliminated through two centrifugations (1. 1500 × g, 30 min and 2. 14,000 × g, 10 min at 4°C). The resulting SP was ultrafiltrated by centrifugation at 3130 × g at 22°C, and EVs were enriched by size exclusion chromatography (SEC) using an agarose resin column (Izon Science, New Zealand) in 0.22 μm of filtered PBS 1X. Eluted volume between 4 and 7.5 mL was collected and re‐concentrated by ultrafiltration. Seminal EVs were characterised according to the Minimal Information for Studies of Extracellular Vesicles 2023 (MISEV2023) requirements (Welsh et al. 2024).

2.3.1. Western Blot Characterisation

EVs were lysed by sonication in RIPA buffer (2X) supplemented with Triton 1X and protease inhibitors 1X. For sample purity assessment, serial dilutions of porcine serum albumin (0.25–0.00397 μg) and 25 μg of EV protein were loaded (Charette et al. 2010). Samples were denatured in 1X LDS buffer (Thermo Fisher Scientific) with DTT at 95°C for 5 min, separated on Mini‐PROTEAN TGX Stain‐Free gels (BioRad) and transferred to nitrocellulose membranes.

Membranes were blocked for 1 h at room temperature and incubated overnight at 4°C with anti‐ALIX (1:1000, Abcam) and anti‐pig albumin (1:1000, Bethyl Laboratories Inc.) antibodies, followed by HRP‐conjugated secondary antibodies 1:10000: HRP mouse anti‐goat IgG (205‐035‐108; Jackson Immuno Research Laboratories) and HRP goat anti‐rabbit IgG (926‐80,011; LI‐COR). Proteins were detected using a C‐DIGIT Blot Scanner.

2.3.2. Flow Cytometer Characterisation

Seminal EVs were detected by flow cytometry (CytoFLEX; Beckman Coulter) equipped with 405, 488 and 638 nm lasers, with the side scatter detector collecting signal from the 405‐nm laser. Size calibration beads (200 nm–2 μm; Thermo Fisher Scientific) were used to establish the detection threshold (V‐SSC > 5000) and assess sensitivity. Recombinant GFP EV standards (5 × 10⁷ particles/mL; Sigma‐Aldrich) in filtered PBS were used to gate the EV population.

EVs were stained with CellTrace Violet (5 μM; Invitrogen) for 30 min at 38°C and detected with the UV450 photodetector. For immunophenotyping, ~2.0 × 10⁹ EVs/mL were incubated with anti‐CD63‐PE, anti‐CD81‐APC, anti‐Hsp70‐FITC and anti‐CD9‐FITC antibodies (1:50; Miltenyi Biotec) for 30 min at 38°C. Stained EVs (5 μL) were diluted in 345 μL of filtered PBS before acquisition. Data were acquired at 10 μL/s, collecting at least 30,000 events. Controls included filtered PBS, unstained EVs and detergent‐lysed EVs (Triton 1X + 0.1% SDS) to confirm EV‐specific signals. Data were analysed using Kaluza Analysis Software v2.1 (Beckman Coulter).

2.4. Isolation and Characterisation of Seminal EVs

To separate spermatozoa from SP, 10 mL of commercial semen doses (containing a total of 300 × 10⁶ sperm cells) from six HM and six RM individual males was centrifuged for 5 min at 1500 × g at 22°C. The supernatant (seminal plasma) was transferred to a new tube, and the sperm pellet was washed with 1 mL of filtered PBS 1X followed by centrifugation (5 min at 1500 × g at 22°C).

2.5. Transcriptomics

Total RNA isolation, including miRNAs and DEB‐seq, was performed by BGI (BGI Genomics Co., China). Sequencing reads were processed by adapter trimming, removal of low‐quality reads and contaminants to obtain and analyse just the high‐quality small RNA sequences with a length between 18 and 30 nt using SOAPnuke (v1.5.6). Total miRNA reads of high‐ and reduced‐motility samples were analysed by the Mann–Whitney U test for non‐parametric and Welch's t‐test for parametric samples.

miRNAs were identified using miRbase, and differential expression analysis (q‐value < 0.05; |Log₂ Fold Change| > 1) was performed with DESeq2 (v1.40.2) and clustering with pheatmap (v1.0.12) in RStudio (v4.5.2). Validated target genes of DEMs were analysed using multiMiR, and orthologous pig genes were identified with biomaRt and ENSEMBL. For differentially expressed miRNA in spermatozoa (miR‐1468‐5p), their predicted target genes were also analysed. GO annotation and KEGG enrichment analyses were conducted using clusterProfiler (p‐value cutoff = 0.05; q‐value cutoff = 0.2, where the q‐value represents the false discovery rate [FDR]), and redundant GO terms were simplified (similarity cutoff = 0.7). The enrich GO function uses a hypergeometric test to assess enrichment and applies the Benjamini–Hochberg method to adjust for multiple testing, and the top 15 GO terms were selected based on q‐value.

3. Results

3.1. Sperm Motility

Sperm motility was assessed, and animals were divided into two groups: RM animals (60.9%–89.0%) and HM animals (89.9%–94.1%).

3.2. EVs Characterisation

The presence of EVs was confirmed following the MISEV2023 guidelines (Welsh et al. 2024). EVs were detected by NTA (concentration: 8.33 × 10¹⁰ ± 1.5 × 10¹⁰ particles/mL; size: 251.3 ± 4.9 nm) and TEM imaging, showing a regular cup‐shaped morphology with intact membranes and no observable anomalies (Figure S1A). Western blot and flow cytometry analyses revealed the presence of EV‐specific proteins, including ALIX (Figure S1B), CD81, CD63, Hsp70 and CD9 (Figure S1C), and no albumin contamination was detected in EV samples by Western blotting.

3.3. Transcriptomics Analysis

Total RNA content after extraction is shown in Table S1. No differential significance (p > 0.05) was detected in total miRNA reads between high‐ and reduced‐motility samples in EVs, seminal plasma or spermatozoa (Table S2). Differential expression analysis identified six DEMs across all sample types (q‐value < 0.05).

EVs contained the highest number of DEMs (3), followed by seminal plasma (2) and spermatozoa (1) (Table 1). The total number of miRNAs identified in each group is represented by a Venn diagram (Figure S2), which shows 97 miRNAs shared among the three groups. Spermatozoa exhibited 39 unique miRNAs, seminal plasma showed 3, and no miRNAs were found to be unique to extracellular vesicles.

TABLE 1.

Differentially expressed miRNAs (DEMs) in seminal extracellular vesicles (EVs), seminal plasma (SP) and spermatozoa (Spz) of Sus scrofa .

Source	miRNA	log2FC	q	Sequence
EVs	ssc‐miR‐6529‐5p	11.7	0.00061	GAGAGAUCAGAGGCGCAGAGU
	ssc‐miR‐146a‐5p	8.4	0.035	UGAGAACUGAAUUCCAUGGGUU
	ssc‐miR‐15a‐5p	−9.4	0.035	UAGCAGCACAUAAUGGUUUGU
SP	ssc‐miR‐532‐5p	11.5	0.000034	CAUGCCUUGAGUGUAGGACCGU
	ssc‐miR‐98‐5p	−4.0	0.016	UGAGGUAGUAAGUUGUAUUGUU
Spz	ssc‐miR‐1468‐5p	2.4	0.0025	CUCCGUUUGCCUGUUUUGCUGA

Note: The DEMs were chosen according to their Log2 Fold Change (FC) (|Log2FC (High motility/Reduced motility)| > 1) with a q‐value < 0.05. Positive Log₂FC means upregulation in HM and negative Log₂FC means downregulation in HM.

In EVs, miR‐6529‐5p and miR‐146a‐5p were upregulated in HM EVs, while miR‐15a‐5p was upregulated in RM EVs. GO analysis of validated target genes revealed enrichment in protein modification, cellular response, protein kinase activity and signalling pathways such as MAPK (Figure 1). Motility‐related GO terms (regulation of cell motility) included 287 target genes, among which ABL1, ACVR1, ADAM10, ADAM8 and ADRA2A were the most frequently represented across enriched GO terms (Table S3).

FIGURE 1.

Gene Ontology (GO) enrichment analysis and KEGG pathway classification of the target genes of the differentially expressed miRNAs in extracellular vesicles from high motility and reduced motility sperm.

In SP, miR‐532‐5p was upregulated in HM samples, whereas miR‐98‐5p was upregulated in RM samples. GO and KEGG analyses revealed a profile very similar to that observed for EV miRNAs (Figure 2), sharing most of the top target genes except for ADAM8, with APP identified instead (Table S3).

FIGURE 2.

Gene Ontology (GO) enrichment analysis and KEGG pathway classification of the target genes of the differentially expressed miRNAs in seminal plasma from high motility and reduced motility sperm.

In spermatozoa, only miR‐1468‐5p was upregulated in HM samples, and no significant GO terms or KEGG pathways were identified in either validated or predicted target genes (p adjust > 0.05).

4. Discussion and Conclusions

Sperm motility is directly linked to male fertility status (Fernández‐López et al. ²⁰²²), making it one of the key quality parameters considered for male selection at AI centres for semen dose production. Several studies have associated different factors with the regulation of sperm motility, including miRNAs (Alves et al. 2020). However, the molecular mechanisms underlying the differences in motility rates between males remain poorly understood. This highlights the relevance of investigating novel molecular biomarkers that could be detected and used for male selection (Bae et al. 2024), such as miRNA cargo analysis of seminal EVs, free transcripts in seminal plasma and miRNAs within spermatozoa from semen doses.

Seminal EVs have been described as a key component of seminal plasma potentially associated with male fertility due to their specialised molecular cargo (Aalberts et al. 2014). Our results confirmed that miR‐6529‐5p and miR‐146a‐5p were upregulated in HM EVs. miR‐146a‐5p is known for its anti‐inflammatory properties (Attia et al. 2021) and has also been associated with heat stress responses in bull sperm (Alves et al. 2021). In contrast, miR‐15a‐5p was downregulated in HM EVs. A previous study has shown that in high‐fertility bulls, miR‐15a is downregulated while BCL2 is upregulated, inhibiting apoptosis (Menezes et al. 2020). This mechanism could increase the proportion of viable sperm, potentially contributing to higher motility rates. Free miRNAs present in SP were also found to exhibit differential expression. miR‐532‐5p was upregulated in HM samples and has been associated with normal sperm functionality in Holstein bulls (Zhang et al. 2015), suggesting that this miRNA may be linked to mechanisms supporting sperm viability and functionality. Conversely, miR‐98‐5p was upregulated in RM samples and has been correlated with porcine sperm apoptosis, widely associated with impaired sperm motility and viability (Chang et al. 2016). Finally, only one miRNA, miR‐1468‐5p, was upregulated in HM sperm and it has previously been detected in sperm cells (M.‐J. Zhao et al. ²⁰²³), although its relationship with sperm motility has not yet been described.

In conclusion, the differential expression of miRNAs in seminal EVs, seminal plasma and sperm cells appears to be associated with sperm motility and may represent potential motility biomarkers. However, further studies are needed to validate this hypothesis within production systems and validate these miRNAs as motility‐related biomarkers in Sus scrofa .

Author Contributions

Adrián Martín‐San Juan: writing and editing – original draft, investigation, conceptualization, methodology, software, bioinformatics and data analysis. Claudia Cerrato Martín‐Hinojal: review and editing, investigation, software, methodology, data analysis. Maria José Martinez‐Alborcia: review and editing, investigation, methodology. Helena Nieto‐Cristóbal: review and editing, conceptualization, software, methodology. Eduardo de Mercado: writing and editing – original draft, software, project administration, methodology, funding acquisition, investigation, conceptualization. Manuel Álvarez‐Rodríguez: writing and editing – original draft, supervision, software, project administration, methodology, funding acquisition, conceptualization.

Funding

This work was supported by Ministerio de Ciencia, Innovación y Universidades, PID2022‐136561OB‐I00, CNS2023‐144564.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: (A) Extracellular vesicles (EVs) characterisation by transmission electron microscopy (TEM) isolated from boar seminal plasma. Scale bar: 1 μm. (B) Western blotting analysis testing positive for EVs protein marker ALIX in high motility (HM) and reduced motility (RM) EVs. (C) Cytometry plots and histograms of seminal EVs characterisation. (C1) Flow cytometry beads of known size (200 nm–2 μm). (C2) GFP EVs were used to identify EV population. (C3) PBS 1X 0.22 μM filtered. (C4) HM and RM unstained EVs. (C5) HM CTV‐stained EVs, + anti human CD81‐APC antibody (1:50), + anti human CD63‐PE antibody (1:50), + anti human Hsp70‐FITC antibody (1:50), + anti human CD9 antibody‐FITC (1:50). (C6) RM CTV‐stained EVs, + anti human CD81‐APC antibody (1:50), + anti human CD63‐PE antibody (1:50), + anti human Hsp70‐FITC antibody (1:50), + anti human CD9 antibody‐FITC (1:50). (C7) Lysated EVs with Triton 1X + 0.1% SDS. Photodetectors used: Violet Side Scatter—Height (Violet SSC‐H), Blue 525‐Area (B525‐A), Blue 525‐Height (B525‐H), Violet 450‐Height (V450‐H), Blue 585‐Height (B585‐H) and Red 660‐Height (R660‐H).

Figure S2: Venn diagram of the total number of miRNAs found in seminal extracellular vesicles (EVs), spermatozoa (SPZ) and within seminal plasma (SP).

Table S1:. Total RNA concentration in ng/μL after RNA isolation of extracellular vesicles (EVs), seminal plasma (SP) and spermatozoa (Spz) of Sus scrofa .

Table S2:. miRNA total reads of extracellular vesicles (EVs), seminal plasma (SP) and spermatozoa (Spz) of Sus scrofa .

Table S3:. Top 5 target genes of the differentially expressed miRNAs (DEMs) found in extracellular vesicles (EVs) and seminal plasma (SP) of Sus scrofa .

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.