Genetic divergence and signatures of historical isolation of the traditionally harvested Amolops marmoratus from the Darjeeling Hill Region in the Himalaya Biodiversity Hotspot

Abstract

Background

The Darjeeling Hill Region (DHR) has numerous freshwater bodies, such as hill streams, springs, and temporary water pools. It receives abundant rainfall and has extensive forest cover, which together play vital roles in sustaining frog diversity. Amolops marmoratus is among the notable hillstream frogs, known for its wide geographic distribution and status as a local delicacy. Thus, A. marmoratus is an important subject for studying genetic divergence and population structure along with anthropogenic pressure. This research investigates the standard morphological characteristics and genetic relationships of A. marmoratus globally using 16S rRNA and COI gene sequences.

Results

Our results revealed low estimates of nucleotide and gene diversity in A. marmoratus from the DHR, whereas comparatively higher values were observed in Southeast Asia, China, and Myanmar. Higher F_ST values were noted between the DHR populations and those from other Asian regions, whereas lower F_ST values were found among populations from Myanmar and Southeast Asia. However, these comparisons warrant caution given unequal sample sizes and the potential for cryptic lineage diversity within this taxonomically complex group. Phylogenetic analysis indicated distinct clades corresponding to different regions, with comparatively shorter branches and limited founders in the DHR group. The significantly negative Fu’s Fs value, along with a unimodal mismatch distribution, indicated a deviation from demographic equilibrium reflecting a historical post-founder demographic expansion.

Conclusion

These findings indicate strong regional differentiation for A. marmoratus. The inherently reduced genetic diversity of A. marmoratus in the DHR is consistent with historical demographic processes and geographic isolation. Furthermore, local frog-eating practices may act as a severe contemporary stressor on this already genetically depauperate population. We recommend framing conservation guidelines and increasing awareness among locals to promote a balanced ecosystem and ensure the long-term survival of A. marmoratus in the DHR.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12864-026-13367-6.

Background

The Darjeeling Hill Region (DHR) includes the hilly areas of the Darjeeling and Kalimpong districts in West Bengal, India. The DHR, an integral part of the Himalaya Biodiversity Hotspot, provides congenial conditions favouring the existence of many species of frogs. Among frogs, Amolops marmoratus is one of the most widely distributed large-sized stream-dwelling frog species. It belongs to the family Ranidae and is commonly known as the “marbled cascade frog” or the “marbled stream frog” [1–3]. In the DHR, it is locally known as “Sisne Paha” or “Sisne Paa”. The marbled cascade frog is distinguished by its eye-catching mottled or marbled skin appearance, which aids in its environmental camouflage. These frogs eat a variety of tiny invertebrates and are mostly active at night. However, studies on this beautiful species in the DHR are limited, and no genetic study has been carried out in this region to date. Thus, a combined approach encompassing analyses of the morphology and genetics of this species is necessary to understand its distribution and diversity in the DHR, its phylogeography and to develop better conservation strategies.

Within the global family Ranidae, the “torrent frogs” or “sucker frogs” [4] belong to the second-most diversified genus, Amolops Cope, 1865. Amolops have a notable gastromyzophorus adhesive disk (ventral sucker) in the tadpole stage and are torrent-dwelling frogs [3, 5]. Currently, Amolops comprises 59 species distributed in Nepal, across Indochina and the Malay Peninsula, Southern China, and Northern India [6]. The montane species of the genus Amolops typically live in rocky, swift-flowing stream environments, such as waterfalls, torrents, and springs [7]. The abdominal suckers in tadpoles and the larger digital pads in post-metamorphic frogs facilitate living in these habitats. Breeding in A. marmoratus is strongly tied to the monsoonal rains [8], with reproductive activity peaking during the wet season when streams swell and provide shallow, stable freshwater pools for egg deposition. Frogs can act as an indicator species [9], as these are highly sensitive to changes in water quality, temperature, and pollution [10, 11]. The population of numerous Amolops species has declined due to environmental pollution, climate change, human disturbance, and local endemism. Species such as A. hongkongensis, A. cucae, A. hainanensis, and A. minutus are listed as Endangered [12]. A. marmoratus has been classified as “Least Concern” with a declining population trend [13]. The threats to A. marmoratus include logging, agricultural deforestation, pollution from forestry and agriculture, and the damming of rivers and streams. These threats highlight the necessity of a comprehensive evaluation of species richness and phylogenetic relationships within this group in every possible habitat. The species richness of the genus Amolops is underestimated because of the unusually high degree of cryptic lineages, which hinders efforts to comprehend species-level diversity within the genus. Since 2000, more than 50% of the known species in Amolops have been described, mostly as a result of enhanced field survey efforts and precise species delimitation using DNA sequence data [14–19].

Previous phylogenetic studies provide strong evidence for the monophyly of Amolops; however, relationships within the genus are still poorly known [16], 20–22]. There have been multiple systematic reorganizations within Amolops [23]. Based on physical similarities, the genus Amolops is currently classified into six “species groups,” namely, A. ricketti, A. hainanensis, A. daiyunensis, A. monticola, A. marmoratus, and A. mantzorum [24, 25]. However, recently, based on DNA sequences, the A. marmoratus and A. mantzorum groups are considered paraphyletic [15, 26]. Additionally, there is uncertainty regarding the phylogenetic positioning of the species A. medogensis and A. viridimaculatus [16]. The monophyletic grouping of A. monticola [27] was questioned due to insufficient evidence [16]. However, it was observed that the A. monticola group was nested not with other Amolops, but rather inside the genus Odorrana [28]. Overall, the phylogenetic refinement of the genus Amolops is still ongoing. Global molecular studies on frogs have focused on mitochondrial and nuclear genes to understand phylogenetic relationships and conservation strategies [29–33]. However, in India, studies on frogs are primarily concentrated in the Western Ghats region. Our understanding of frogs in the Indian Himalaya is limited and demands immediate attention to understand frog diversity in India holistically. A. marmoratus is a widely distributed frog species in the Central and Eastern Himalaya. Thus, understanding its diversity and distribution patterns becomes crucial for understanding its ecosystem services and conservation.

In many regions across the globe, the human consumption of large-sized frogs as a delicacy is a widespread practice that could have far-reaching implications for both the biodiversity and ecological balance of local environments [34, 35]. Frog consumption is culturally and economically important as an alternative source of high-quality protein. People in Myanmar, Thailand, and Northeast India frequently consume Amolops, which some say has therapeutic benefits such as treating burns, fractured bones, and joint pain [36]. In Myanmar, China, Vietnam, and Indonesia, several other large-sized frog and toad species belonging to genera such as Hoplobatrachus, Rana, Paa (now Nanorana), Bufo (now Duttaphrynus), Fejervarya, Limnonectes, etc. are consumed as a palatable food source, and the export of frog legs as a delicacy is a well-established business [37–39]. India and various other countries across the globe are known for frog consumption and frog meat export and import, which may pose a threat to the extinction of some species [40]. In the DHR, the consumption of frogs, particularly Amolops marmoratus and Nanorana liebigii, has been practised by the locals for generations. Among these, Amolops marmoratus is the most abundant and a comparatively large-sized hillstream frog. This frog has long been harvested by local tribal communities as a food resource and traditional medicine [9, 41]. As only two frog species are mainly consumed in the region, harvesting pressure is likely concentrated on A. marmoratus, as it is widely available across the DHR compared to N. liebigii, which is restricted mainly to the higher altitudes. Mostly during the rainy season, the locals catch frogs at night when frogs come out and perch on the boulders of fast-flowing streams and branches of the nearby bushes to feed. This may influence the genetic diversity of A. marmoratus in this region [9] and further exacerbate the already declining diversity due to climate change. Thus, the present study aims to investigate the morphological and genetic diversity of A. marmoratus in the DHR and compare its genetic affinity across the globe. The findings of this study can contribute to the broader conservation efforts in the Himalaya Biodiversity Hotspot.

Materials and methods

Field survey and specimen collection

Frogs are typically found around water bodies or other wet environments. To ensure successful sampling, a prior thorough examination of the vegetation was conducted. Subsequently, large-scale sampling was carried out mostly during the rainy season (June to August). The Directorate of Forests, West Bengal, India, provided the necessary approval and guidelines for this study vide memo number 3204/WL/4R-43/2022. Sampling was mostly done at night by tracking calls or by opportunistic searches. Photographs were taken during the sampling process for proper documentation. A total of 57 places in the DHR were sampled (Fig. 1; Table 1). A GPS navigation device (Garmin 76CSx, Kansas, United States) was used to note geographic coordinates and elevation (in AMSL, or above mean sea level) at each sampling location. Quantum Geographic Information System (QGIS) software v3.32.1 [42] and ArcGIS version 10.8 [Environmental Systems Research Institute (ESRI), Redlands, CA] were used to construct a map with sampling sites. A total of 60 samples were collected from the DHR following the standard protocol [43]. However, 25 samples were released right away after morphometric measurements, and the remaining 35 samples were selected for further examination and brought to the Department of Zoology, University of Calcutta, Kolkata, India. The samples were euthanized in a 5% aqueous solution of tricaine methanesulfonate (MS222) and temporarily preserved in 70% alcohol following standard protocol [43]. Samples were permanently preserved in 100% ethanol. The identification of the species was confirmed by the Amphibia Section, Zoological Survey of India, Kolkata, where the registration number for the voucher specimen was assigned (Voucher Number: ZSI A 16072).

Fig. 1.

Sampling sites of A. marmoratus in the Darjeeling Hill Region (DHR)

Table 1.

Details of sampling sites in the DHR, including their latitude, longitude, and altitude (in AMSL, i.e., above mean sea level)

Sl No	Site	Sampling sites	Area	Latitude	Longitude	Altitude (in AMSL)
1	Whistle Khola	Whistle Khola A	Kurseong, Darjeeling	26.89775	88.276972	525 m
2		Whistle Khola B	Kurseong, Darjeeling	26.896444	88.268661	1243 m
3		Whistle Khola C	Kurseong, Darjeeling	26.895556	88.252228	881 m
4		Whistle Khola D	Kurseong, Darjeeling	26.897778	88.280472	1275 m
5	Singell Tea Estate	Singell Tea Estate A	Kurseong, Darjeeling	26.897889	88.280778	1275 m
6		Single Tea Estate B	Kurseong, Darjeeling	26.896444	88.268661	1243 m
7	Kharey Khola	Kharey Khola	Kurseong, Darjeeling	26.897778	88.280472	881 m
8	Sonada	Sonada A	Sonada, Darjeeling	26.95383	88.2671	2056 m
9		Sonada B	Sonada, Darjeeling	26.95237	88.26521	2056 m
10	Namsu Busty	Namsu Busty	Kurseong, Darjeeling	26.89775	88.276972	525 m
11	Bungkulung	Bunkulung A	Bunkulung, Mirik	26.79758	88.31401	621 m
12		Bunkulung B	Bunkulung, Mirik	26.78758	88.32481	621 m
13		Bunkulung C	Bunkulung, Mirik	26.77758	88.33901	621 m
14		Bunkulung D	Bunkulung, Mirik	26.81758	88.31601	621 m
15	Mirik	Mirik A	Mirik	26.87893	88.18772	1495 m
16		Mirik B	Mirik	26.86758	88.19601	1495 m
17	Manju Tea Garden	Manju Tea Garden	Manju Tea Garden, Mirik	26.83658	88.30109	1575 m
18	Bijanbari	Bijanbari Khola	Bijanbari, Darjeeling	27.070361	88.185075	741 m
19	Bijanbari	Jamuney	Bijanbari, Darjeeling	27.095	88.233056	420 m
20	Teesta	Teesta	Teesta, Darjeeling	27.067944	88.418056	228 m
21	Singla	Singla River	Singla, Darjeeling	27.125556	88.294167	283 m
22	Dabaipani	Dabaipani	Dabaipani, Darjeeling	27.052333	88.312556	912 m
23	Naya Busty	Naya Busty	Upper Dabaipani, Darjeeling	27.0522	88.318734	2158 m
24	Ging Tea Estate	Ging Tea Estate A	Ging Tea Estate, Darjeeling	27.07925	88.285931	1048 m
25		Ging Tea Estate B	Ging Tea Estate, Darjeeling	27.078056	88.286008	1052 m
26	Lamahatta	Lamahatta	Lamahatta, Darjeeling	27.05346	88.35162	2072 m
27	6th Mile	6th Mile A	6th Mile, Darjeeling	27.02856	88.32323	2100 m
28		6th Mile B	6th Mile, Darjeeling	27.03858	88.32857	2100 m
29	Tukdah Forest	Tukdah A	Tukdah, Darjeeling	27.04539	88.34536	1554 m
30		Tukdah B	Tukdah, Darjeeling	27.03639	88.33586	1554 m
31		Tukdah C	Tukdah, Darjeeling	27.04789	88.34786	1554 m
32		Tukdah D	Tukdah, Darjeeling	27.06567	88.35636	1554 m
33	Sukhia	Sukhia A	Sukhia, Darjeeling	27.00309	88.16929	2194 m
34		Sukhia B	Sukhia, Darjeeling	26.99342	88.16369	2194 m
35		Sukhia C	Sukhia, Darjeeling	27.00309	88.16929	2194 m
36		Sukhia D	Sukhia, Darjeeling	26.99437	88.16601	2194 m
37	Simana	Simana	Simana, Darjeeling	26.98239	88.133306	2286 m
38	Lepchajagat	Lepchajagat	Lepchajagat, Darjeeling	27.0131	88.1952	2100 m
39	Tumsong Tea Garden	Tumsong Tea Garden	Tumsong Tea Garden, Darjeeling	27.03048	88.18054	1676 m
40	Ghum	Ghum	Ghum, Darjeeling	27.00723	88.24594	2225 m
41	Happy Valley Tea Estate	Happy Valley Tea Estate	Happy Valley Tea Estate, Darjeeling	27.05094	88.25913	2100 m
42	Chongtong	Chongtong	Darjeeling	27.07761	88.20652	1029 m
43	Marybong	Marybong	Darjeeling	27.04012	88.19705	1830 m
44	Lizahill	Lizahill	Darjeeling	27.04672	88.20533	2042 m
45	Mane Bhanjang	Mane Bhanjang A	Mane Bhanjang, Darjeeling	26.98811	88.12757	1928 m
46		Mane Bhanjang B	Mane Bhanjang, Darjeeling	26.99881	88.11767	1928 m
47		Mane Bhanjang C	Mane Bhanjang, Darjeeling	26.97911	88.140917	1928 m
48		Mane Bhanjang D	Mane Bhanjang, Darjeeling	26.98897	88.13587	1928 m
49		Mane Bhanjang E	Mane Bhanjang, Darjeeling	26.988667	88.123139	1928 m
50	Rimbik	Rimbik	Darjeeling	27.13198	88.076204	2286 m
51	Sirikhola	Srikhola	Darjeeling	27.120675	88.106606	2103 m
52	Timburey	Timburey	Darjeeling	27.126741	88.060865	2438 m
53	Sinjee	Pudung	Kalimpong	27.053660	88.527479	581 m
54	Mankhim	Dungra	Kalimpong	27.069650	88.481671	1020 m
55	Latpanchar A	Latpanchar	Sittong, Darjeeling	26.898864	88.396893	1059 m
56	Latpanchar B	Latpanchar	Sittong, Darjeeling	26.928485	88.40959	1006 m
57	Senchal	Senchal	Ghoom, Darjeeling	27.003838	88.264078	2365 m

Morphological measurements

A vernier calliper with a precision of 0.01 millimeters (mm) was used to measure the morphological characters of each specimen in mm to the nearest 0.1 mm for taxonomic analysis. Following a thorough review of the literature, a total of 36 morphological parameters were examined, viz., SVL (Snout-Vent Length), HL (Head Length, from the rear of the mandible to the tip of the snout), HW (Head Width, at the angle of the jaws), SL (Snout Length, eye to snout tip), EN (Eye-Nostril distance, distance from the front of the eye to the nostril), NS (Nostril-Snout tip distance), ED (horizontal Eye Diameter), TD (Tympanum Diameter), ET (Eye-Tympanum distance), ME (Mandible to Eye distance), MN (Mandible to Nostril length), INL (Inter-Narial Length), IOL (Inter-Orbital Length), UEW (Upper Eyelid Width), FAL (Fore Arm Length, brachium length i.e. from flexed elbow to base of outer palmar tubercle), ABL (Antebrachium Length), HAL (Hand Length, from the base of outer palmar tubercle to the tip of the third finger), 1FL (1st Finger Length), 2FL (2nd Finger Length), 3FL (3rd Finger Length), 3FPW (3rd Finger Pad Width), 4FL (4th Finger Length), SFL (Snout to Fore arm Length), AGL (Axilla-Groin Length), PcW (Pectoral Width), PeW (Pelvic Width), TL (Thigh Length), TiL (Tibia Length i.e. shank length), TFOL (total foot length, from the base of inner metatarsal tubercle to the tip of the third toe), FOL (foot length, from the base of inner metatarsal tubercle to the base of the fourth toe), 1TL (1st Toe Length), 2TL (2nd Toe Length), 3TL (3rd Toe Length), 4TL (4th Toe Length), 4TPW (4th Toe Pad Width), and 5TL (5th Toe Length).

To understand the morphometric variation in the adult A. marmoratus, linear regression analyses were performed using the morphometric data in RStudio 4.1.2 (RStudio Team (2020), RStudio: Integrated Development for R. RStudio, PBC, Boston, MA), and coefficient of determination values, p-values, and FDR-adjusted p-values were represented using Excel (Microsoft Office 2019, Microsoft Corporation, USA). The altitude at each sampling location, along with the corresponding species abundance, was recorded to assess the geographic distribution of A. marmoratus in the DHR. The species abundance was calculated following the standard protocol [44]. For evaluating the effect of altitude on abundance, a Negative Binomial Generalized Linear Model (GLM) with a log-link function was fitted using site-level abundance data from all sampling locations in RStudio 4.1.2. Altitude was treated as a continuous predictor variable, and abundance was used as the response variable. The Negative Binomial distribution was selected to account for overdispersion in count data.

DNA extraction and sequence analysis

From the collected samples, DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. DNA was also isolated using a modified phenol-chloroform method [45]. NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA, USA) was used to examine the quantity and quality of the DNA sample. Furthermore, Agarose gel electrophoresis was used to evaluate DNA quality. The stock DNA samples were diluted to 40 ng/µl for the polymerase chain reaction (PCR). Subsequently, the standard DNA barcoding genes, namely, 16S rRNA and Cytochrome c oxidase subunit I (COI) genes, were amplified for proper taxonomic identification and to estimate genetic variation within the A. marmoratus population. PCR was performed for each sample using 10 picomolar forward and reverse primers, 2X master mix (Promega, Madison, Wisconsin, United States), and 40 ng/µl template DNA. Using nuclease-free water (Promega, Madison, Wisconsin, United States), the total volume of the PCR was adjusted to 15 µl. The 16S rRNA gene (forward primer: L3975; 5’CGCCTGTTTACCAAAAACAT3’, reverse primer: H4551; 5’-CCGGTCTGA ACTCAGATCACGT-3’) [46] and the COI gene (forward primer: T3-AnF1; 5’- ATTAACCCTCACTAAAGACHAAYCAYAAAGAYATYGG-3’, reverse primer: T7-AnR1; 5’-AATACGACTCACTATAGCCRAARAATCARAADARRTGTTG-3’) were amplified [47]. The PCR conditions for 16S rRNA gene amplification are as follows: 5 min of initial denaturation at 94 °C, 35 cycles of denaturation at 94 °C for 30 s, 30 s of annealing at 53 °C, 30 s of extension at 72 °C, and 7 min of final extension at 72 °C. The COI gene was amplified with 3 min of initial denaturation at 95 °C, 35 cycles of denaturation at 95 °C for 20 s, 20 s of annealing at 50 °C, 1 min of extension at 60 °C, and 5 min of final extension at 60 °C. A 2% Agarose gel was used to evaluate the PCR results. Each amplicon was cleaned using ExoSAP-IT™ (Thermo Fisher Scientific, Waltham, Massachusetts, United States) and sequenced in a DNA Analyzer (Applied Biosystems 3730xl Genetic Analyzer, Thermo Fisher Scientific, Waltham, Massachusetts, United States) by outsourcing. The average amplicon length for the 16S rRNA gene was 560 bp, and the COI gene was 530 bp. Sequencing Analysis 5.2 (Applied Biosystems, Thermo Fisher Scientific, Waltham, Massachusetts, United States) was used to assess the quality of the obtained sequences. We retrieved thirty-one 16S rRNA gene sequences of A. marmoratus from the NCBI database that included sequences from China, Southeast Asia, and Myanmar. Following nucleotide BLAST, multiple sequence alignment was carried out using the MUSCLE tool in MEGA 11 [48]. Arlequin 3.5.2.2 (University of Bern, Switzerland) [49] was used to calculate genetic distance, genetic diversity indices, and perform neutrality tests. Rarefaction analysis was performed to standardize comparisons of genetic diversity across regions with unequal sample sizes. Further, we conducted a mismatch distribution analysis for A. marmoratus from the DHR using Arlequin v3.5.2.2 and DnaSP v5.10.1 software [50] to understand the demographic patterns of the population. 16S rRNA sequences were used to construct the global phylogenetic tree of A. marmoratus using the neighbor-joining method with the bootstrap test (500 replicates) in MEGA 11. To learn more about the genetic affinity within A. marmoratus from the DHR, phylogenetic trees were also constructed using the COI sequences and the concatenated sequences of the 16S rRNA and COI gene in MEGA 11 using the bootstrap test (500 repetitions). Onychodactylus zhangyapingi was used as the outgroup in every phylogenetic tree to maintain consistent rooting and enable reliable inference of evolutionary relationships among the ingroup taxa. The median-joining network tree was constructed using 16S rRNA variants with NETWORK 10.2.0.0 software (Fluxus Technology Ltd., England, 2020) to understand haplotype sharing among global A. marmoratus populations.

The compiled sequences were realigned using MEGA 11, where pre- and post-alignment curation were performed. After final curation, 64 samples with 523 sites were kept to perform coalescence estimation using BEAST v2.5 [51]. However, before this, we also performed a test for the best substitution model using MEGA, and based on the result, the HKY substitution model was selected. BEAST was run with the HKY substitution model with a mitochondrial clock rate of 9.2 × 10^{− 4} substitutions/my [52], which was later converted into the per-lineage rate. We set all Amolops marmoratus sequences as monophyletic and used a constraint of origin within 25 MYA following Wu et al., 2020, with a relaxed clock model. BEAST was run for a 60-million MCMC chain with the default Bayesian skyline model. The resulting log file was checked in Tracer to ensure that all effective sample size values were more than 200. The final tree was annotated with the TreeAnnotator package in BEAST, with 20% burn-in, and the resultant tree was visualized using FigTree version 1.4.4 (Institute of Evolutionary Biology, University of Edinburgh, Edinburgh).

Results

Morphological identification and diagnostic characterization keys

The species Amolops marmoratus was first described by Blyth in 1855. We identified Amolops marmoratus following the diagnostic taxonomic characterization keys. The voucher specimen was submitted to the Amphibia section at the Zoological Survey of India (Voucher number ZSI A 16072), where the sample was confirmed to be Amolops marmoratus. It is a medium to large hillstream frog known for its long legs, flat head, and streamlined body (Figs. 2 and 3). It has a rounded, protruding snout that is wider than long, and the nostrils are closer to the snout than the eyes. The eyes are notably large with horizontal pupils, while the tympanum is round and roughly half the size of the eye and is covered by a skin fold. The frog’s skin is mostly granular, transitioning from fine textures on the head to warty on the belly. It has webbed toes with small sticky pads, and the fingers feature larger adhesive pads, with the largest on the first finger. Its back is marbled in dark shades of grey and brown, and the limbs have characteristic brownish crossbands. The underside is pale, with greyish patches extending from the throat. Males have two internal vocal sacs, and the frog exhibits varying colours on its limbs and fingers, with some parts being olive-grey or white.

Fig. 2.

Amolops marmoratus specimen collected from the DHR

Fig. 3.

Diagnostic morphological characters of A. marmoratus. a Dorsal body morphology, b Hindlimb patches, c Eye, d Fingers in the forelimb, e Toes in the hindlimb

Morphological data analysis

A total of 36 morphological characters were analyzed in 44 adult A. marmoratus samples from the DHR. Measurements from juvenile A. marmoratus were not included in the regression analysis to maintain accuracy and standard practice. Linear regression analyses were performed between Snout-Vent length (SVL) and the remaining 35 morphometric traits (Supplementary Table S1). All traits exhibited significant associations with SVL after false discovery rate (FDR) correction (adjusted P < 0.05), although the strength of these relationships varied considerably (R² = 0.1505–0.9692). Traits such as EN, ED, and FOL showed comparatively weaker associations with SVL than most other characters, suggesting greater morphological independence from overall body size. These traits may reflect ecological or functional adaptations associated with sensory performance and locomotion in the semi-aquatic habitat occupied by A. marmoratus.

Altitudinal distribution of amolops marmoratus in the DHR

Environmental and geographical factors play an important role in the distribution of a species in a region. In the DHR, variations in altitude and climatic conditions are prominent. The altitude of A. marmoratus habitat in the DHR ranges from 200 to 2400 m AMSL. A. marmoratus is well distributed in the DHR. Overall, we found A. marmoratus in 57 sampling sites spanning almost the entire altitudinal gradient of the DHR. Analysis of site-level abundance data using a Negative Binomial GLM revealed a significant negative relationship between altitude and abundance. Results showed a regression coefficient (β) = -0.00067 ± 0.00021, Wald z-statistic (z) = -3.217, and probability value (P) = 0.0013. These results indicate that the abundance of A. marmoratus declines significantly with increasing elevation in the DHR (Fig. 4).

Fig. 4.

Relationship between the abundance of Amolops marmoratus and altitude across 57 sampling sites in the Darjeeling Hill Region. Points represent site-level abundance records, while the solid line represents the fitted Negative Binomial Generalized Linear Model (GLM). The shaded area indicates the 95% confidence interval of the fitted model

Molecular data analysis

The 16S rRNA and COI gene sequences were obtained for all 35 samples. To understand the global genetic diversity of A. marmoratus, we retrieved 31 available 16S rRNA sequences from NCBI (Supplementary Table S2). Unfortunately, there was no COI gene sequence of A. marmoratus in NCBI. Therefore, we performed most of the analyses with combined 16S rRNA sequences. Firstly, the obtained sequences were subjected to NCBI nucleotide BLAST, which identified the samples from DHR as Amolops marmoratus. Molecular diversity indices were calculated using Arlequin version 3.5.2.2 with the combined dataset of 16S rRNA sequences of A. marmoratus across the globe (Table 2). Our results revealed that A. marmoratus from the DHR had the lowest nucleotide diversity (0.001244 ± 0.001161), and Southeast Asia had the highest nucleotide diversity (0.103280 ± 0.068526). Mean pairwise differences in A. marmoratus from Southeast Asia (38.833333 ± 21.577297) and Myanmar (33.501976 ± 15.157621) were markedly higher than those from the DHR (0.554622 ± 0.465936) and China (6.000000 ± 3.618136). Gene diversity was observed to be highest in A. marmoratus from Myanmar (0.7352 ± 0.0595) and lowest in the DHR (0.4487 ± 0.1032). The gene diversity estimate for A. marmoratus from Southeast Asia (1.0000 ± 0.1768) indicates that all four sequences are distinct haplotypes; however, with only four unique sequences available in the NCBI database, this estimate is uninformative. Unequal availability of reference samples among regions may constrain direct comparisons of genetic diversity estimates. Rarefaction analysis yielded consistent regional diversity patterns despite unequal sample sizes (Supplementary Table S3). The genetic distance in terms of F_ST was calculated among the four A. marmoratus frog groups (Table 3). We found that A. marmoratus from the DHR and China have the highest F_ST value (0.93945), and A. marmoratus from Southeast Asia and Myanmar have the lowest F_ST value (0.15330). All these analyses revealed that A. marmoratus from the DHR was unique, with significantly reduced genetic diversity. The mismatch distribution of A. marmoratus in the DHR exhibited a unimodal left-skewed distribution pattern, with the observed and expected curves showing substantial overlap and most pairwise differences concentrated at lower values (Supplementary Figure S1). Neutrality analyses produced negative Tajima’s D (-1.703, raw P = 0.027); however, it turned non-significant after Bonferroni correction (Bonferroni-adjusted P = 0.108). Furthermore, neutrality analyses revealed a significantly negative Fu’s Fs (-4.819, raw P = 0.001; Bonferroni-adjusted P = 0.004) value (Supplementary Table S4), indicating a departure from mutation-drift equilibrium and an excess of rare genetic variants within the DHR population due to historical demographic expansion.

Table 2.

Estimates of molecular diversity indices in the global A. marmoratus (Am) populations

Population	Sample size (n)	Mean Pairwise Differences	Nucleotide Diversity	Gene Diversity
Am DHR	35	0.554622 ± 0.465936	0.001244 ± 0.001161	0.4487 ± 0.1032
Am Myanmar	23	33.501976 ± 15.157621	0.073148 ± 0.036909	0.7352 ± 0.0595
Am Southeast Asia	4	38.833333 ± 21.577297	0.103280 ± 0.068526	1.0000 ± 0.1768
Am China	4	6.000000 ± 3.618136	0.036585 ± 0.026344	0.5000 ± 0.2652

Table 3.

Genetic distance (F_ST Value) among the A. marmoratus (Am) populations across the globe

Population	Am DHR	Am Myanmar	Am Southeast Asia	Am China
Am DHR	-	0.72112	0.90440	0.93945
Am Myanmar		-	0.1533	0.50041
Am Southeast Asia			-	0.8488
Am China				-

Amolops marmoratus global phylogeny

To better understand the genetic affinities within the global A. marmoratus, we constructed the phylogenetic tree using the neighbor-joining method with the 16S rRNA sequences in MEGA 11 with a 500 bootstrap value and used Onychodactylus zhangyapingi as an outgroup. The constructed phylogenetic tree showed a distinct clade for each A. marmoratus group from different regions (Fig. 5). The clade containing A. marmoratus from the DHR was separated distinctly from A. marmoratus from other regions. Interestingly, the branch lengths of each taxon in the DHR clade were comparatively shorter than those of other clades. Further, the other two clades contained A. marmoratus from China and Southeast Asia and A. marmoratus from Southeast Asia, China, and Myanmar, respectively. One sample of A. marmoratus from Myanmar (JF794451.1) remained outside these clades (Fig. 5). Due to the unavailability of comparable sequences in public databases, a phylogenetic tree was constructed using COI gene sequences among A. marmoratus from the DHR only. The obtained tree showed that COI sequences may have prospects in barcoding and phylogenetic analysis of A. marmoratus in the future (Supplementary Figure S2). The lack of COI sequences in the NCBI database restricted the global phylogenetic comparison and limited further molecular analyses using COI sequence data. Additionally, a phylogenetic tree was constructed using the concatenated sequences of 16S rRNA and COI genes to understand the phylogenetic relationships of A. marmoratus in the DHR. The obtained tree had 3 clades, indicating that increased sequence resolution had further dissected the tree topology (Supplementary Figure S3). The phylogenetic network tree constructed using 16S rRNA variants revealed significant differences in haplotype sharing among A. marmoratus from the DHR and other A. marmoratus populations worldwide (Fig. 6). We observed all the present-day A. marmoratus coalescing to a common ancestor around 17.40 MYA (95% HPD: 11.44–23.53 MYA) in Asia. Later, one branch diverged into Southeast and another into South Asian (DHR) lineages around 11.23 MYA (95% HPD: 5.44–17.31 MYA). A separate branch containing the Southeast lineages diverged from the common ancestor around 1.43 MYA (95% HPD: 0.31–3.38 MYA). The lineage containing A. marmoratus from the DHR diversified around 0.94 MYA (95% HPD: 0.22–2.26 MYA) (Fig. 7 and Supplementary Figure S4).

Fig. 5.

Phylogenetic tree constructed using the neighbor-joining method with bootstrap values based on 16S rRNA sequences among A. marmoratus (Am) samples from the DHR and other global samples retrieved from the NCBI database using MEGA11

Fig. 6.

Median-joining network tree among the global A. marmoratus (Am) populations constructed using genetic variations in the 16S rRNA gene sequences in NETWORK 10.2.0.0

Fig. 7.

The Bayesian time tree of Amolops marmoratus samples across Asia, calculated with a 95% Confidence Interval. The tree was constructed using the HKY substitution model with a mitochondrial clock rate of 9.2 × 10^− 4 substitutions/million years in BEAST v2.5

Discussion

In this study, we sought to investigate the genetic diversity and phylogenetic relationships of A. marmoratus from different geographical regions using 16S rRNA and COI gene sequences from the DHR and other regions across the globe. Notably, for the first time, we have generated COI gene sequences for A. marmoratus from the DHR through this study, addressing an existing gap in the global genetic database. The combined use of both morphological and genetic data for species identification and population studies is well supported by the present study. The comparatively weaker allometric relationships observed for EN, ED, and FOL with SVL in A. marmoratus from the DHR suggest that these traits may be subject to different developmental or ecological influences than the remaining morphometric characters. Although the functional significance was not evaluated in the present study, variation in eye and hind limb morphology may be associated with ecological requirements such as visual performance under low-light conditions and locomotion in rocky hillstream habitats. Further, a multidisciplinary study combining ecological and functional approaches will be required to test these hypotheses.

Though A. marmoratus is well distributed in the DHR, the highest relative abundance was observed in the altitudinal range between 200 and 400 m AMSL. The observed negative correlation between altitude and abundance suggests that as altitude rises, the population abundance of A. marmoratus decreases (Fig. 4) in the DHR. The results from the regression analysis further reinforce this trend, highlighting a preference for comparatively lower altitudes within the hilly regions of the DHR. This pattern provides valuable insights into the species’ ecological preferences, particularly about elevation, and could add more to our understanding of future conservation strategies, especially those focused on managing habitat suitability across altitudinal gradients.

Analyses of molecular diversity indices revealed that A. marmoratus from Southeast Asia had the highest nucleotide diversity (0.103280 ± 0.068526), indicating a high level of genetic variability in this region (Table 2). In contrast, populations from the DHR displayed the lowest nucleotide diversity (0.001244 ± 0.001161), suggesting a comparatively homogeneous genetic structure. The lower nucleotide diversity may be attributed to geographic isolation, limited gene flow, and possibly a small effective population size within the DHR. The local frog-eating practices might add to this reduced nucleotide diversity and pose a vital challenge to conservation. The mean pairwise differences further corroborated these findings, with higher pairwise differences observed in the A. marmoratus populations from Southeast Asia (38.833333 ± 21.577297) and Myanmar (33.501976 ± 15.157621) compared to the DHR (0.554622 ± 0.465936) and China (6.000000 ± 3.618136). Gene diversity analysis also revealed that A. marmoratus from Myanmar had the highest gene diversity (0.7352 ± 0.0595), whereas the DHR populations had the lowest (0.4487 ± 0.1032), further emphasizing the restricted genetic variability within the DHR. The gene diversity value of 1.0000 for Southeast Asia simply reflects that all four available samples represent distinct haplotypes, making the estimate uninformative due to the small sample size. The regional comparisons were based on unequal sample sizes, reflecting the limited availability of publicly accessible sequences for two geographic regions. Finally, the genetic distance calculated using F_ST values provided further insights into the genetic relationships between A. marmoratus populations across the globe (Table 3). The highest F_ST value (0.93945) was observed between the DHR and China populations, suggesting a significant degree of genetic differentiation and limited gene flow between these regions. Conversely, the lowest F_ST value (0.15330) was noted between Southeast Asia and Myanmar populations, indicating relatively high genetic connectivity or more frequent gene flow between these two regions. Most importantly, the reduced genetic diversity in the A. marmoratus population from the DHR was alarming and needs immediate conservation guidelines in the region. The mismatch distribution pattern, along with a significant negative Fu’s Fs value, suggests that the DHR population of A. marmoratus has experienced a departure from demographic equilibrium, reflecting a deep historical demographic expansion from a previously reduced effective population size (founder effect). Because these statistics integrate demographic history over long coalescent timescales, the concentration of pairwise differences at lower divergence classes and the excess of low-frequency variants are consistent with this ancient expansion. In contrast, the extremely recent anthropogenic threat of traditional frog-eating practices has not yet provided sufficient time for genetic drift to purge these rare alleles and drive Tajima’s D or Fu’s Fs toward positive values. Therefore, contemporary harvesting may act as a modern stressor exacerbating the vulnerability of a population that is already historically isolated and genetically depauperate.

The phylogenetic analyses based on the 16S rRNA gene sequences demonstrated a notable differentiation among A. marmoratus populations from different regions across the globe into distinct clades, where the DHR population also remained as a separate clade (Fig. 5). The obtained tree topology was well supported by the bootstrap values. Interestingly, the shorter branch length of the DHR clade indicates the existence of lower genetic variability and a strong founder effect in the DHR, further supporting our results with reduced genetic diversity. This finding provides a unique insight into the genetic connectivity of populations in this relatively isolated region. The distinctness of A. marmoratus from the DHR was also confirmed by the haplotype sharing among A. marmoratus populations in the median-joining network tree constructed using 16S rRNA variants (Fig. 6). We also observed that the COI sequences may be used as a potential marker and valuable prospective resource for future barcoding and eDNA monitoring.

The genus Amolops originated in Asia approximately 25 MYA [53]. Our study revealed that all the Asian A. marmoratus coalesced into a common ancestor around 17.40 MYA. Interestingly, diversification of A. marmoratus in Asia continued from 17.40 MYA till 0.038 MYA. This time frame succeeds the time frame of the main uplift of the Himalaya around 40 − 20 MYA. Thus, our observation on the diversification of A. marmoratus, after the time of the origin of the Himalaya, supports the origin of A. marmoratus in Asia and its diversification after the formation of a stable Himalayan ecosystem. Our observation of the multiple diversifications of A. marmoratus coincides with major geological events, like mountain building and climate change events during the Miocene epoch [54]. The common ancestor of A. marmoratus from the DHR originated during the early Pleistocene epoch of the Quaternary period in the Cenozoic Era.

Altogether, our results highlight the high level of genetic divergence and isolation among A. marmoratus populations across different regions around the world, especially in the DHR. The low nucleotide and gene diversity in the DHR populations indicates strong regional differentiation and historical isolation. In contrast, populations from Southeast Asia and Myanmar exhibited higher genetic diversity, suggestive of extensive gene flow and larger population sizes. These findings emphasize the critical need to consider genetic diversity in conservation efforts. Populations with low genetic diversity, such as those in the DHR, are more vulnerable to climate change, disease outbreaks, and inbreeding depression, which can threaten the long-term viability of A. marmoratus in this region. On the other hand, populations with higher genetic diversity, such as those in Southeast Asia and Myanmar, may have a better capacity to adapt to changing environmental conditions, making them important reservoirs of genetic diversity for the species.

While our findings highlight strong regional genetic differentiation, we must acknowledge limitations inherent in our cross-regional comparative analyses. The reference sequences retrieved from GenBank (representing populations from Myanmar, China, and Southeast Asia) involve highly unequal sample sizes compared to our robustly sampled DHR dataset. Furthermore, because the A. marmoratus species complex is prone to cryptic speciation across its broad geographical range, the notably high nucleotide diversity and elevated inter-regional F_ST values observed in the reference groups may partially reflect underlying between-species divergence rather than pure within-population variation. Consequently, the reliance on these unequal and potentially taxonomically uncertain reference samples inherently constrains our global diversity comparisons. While the DHR population is clearly isolated and genetically uniform, the comparative contrast highlighting its depauperate nature should be interpreted with these methodological and taxonomic limitations in mind.

The in-depth investigation firmly establishes reduced genetic diversity in A. marmoratus from the DHR. However, the potential influence of traditional frog-eating practices on the comparatively reduced genetic diversity of the DHR population remains a hypothesis that merits further ecological and demographic investigation. Frog-eating practices, while culturally significant and economically important in some areas, can lead to substantial changes in frog populations, including reduced genetic diversity and the disruption of balanced ecological relationships [34, 55]. The impact of such practices extends beyond just the loss of individual frogs; it can influence the overall phylogeography, or the distribution patterns of species across different regions, potentially leading to shifts in the composition of local fauna. On the other hand, frogs also present an alternative source of high-quality protein, which can be particularly beneficial in areas where other sources of animal protein are either scarce or prohibitively expensive [56, 57]. This makes frogs an important nutritional resource for many communities, offering a viable means of subsistence. Additionally, frog consumption can contribute to controlling invasive frog populations, which may pose a threat to local ecosystems and native species. In the DHR, frog-eating traditions have been ingrained in local culture for generations, as oral histories suggest that frogs, especially species like Amolops marmoratus and Nanorana liebigii, have long been harvested as food (Supplementary Figure S5). The more abundant A. marmoratus species, in particular, was historically considered a vital source of nourishment for lactating mothers and ailing individuals, especially during times when other meat sources were less accessible or too expensive. Frogs are abundant in the rainy season when they come out from hiding to feed, making nighttime frog-hunting a common practice. While this traditional practice is an important alternative food resource, it has also placed considerable pressure on A. marmoratus populations in the DHR. Although the present dataset cannot directly disentangle the relative effects of geographic isolation at the range periphery, founder effects, Pleistocene bottlenecks, and historical demographic processes, the widespread and long-standing consumption of A. marmoratus throughout the DHR deserves attention as a severe contemporary pressure acting on this previously established genetic background. Because local harvesting is focused only on a few frog species, particularly A. marmoratus, continued exploitation may further compromise the persistence of an already genetically depauperate population. The interplay between cultural practices and environmental sustainability thus highlights a complex balance between human needs and the conservation of local biodiversity. Thus, the conservation of A. marmoratus should not only focus on maintaining habitat quality but also on restricting unregulated frog-eating practices for better genetic diversity and a healthy ecosystem. Furthermore, the results highlight the importance of extending genetic research to underrepresented regions, such as the DHR and Southeast Asia, where limited genetic data currently exist.

Conclusion

This is the first study on A. marmoratus from the DHR using both morphology and DNA sequence-based analyses. Our results provide important insights into the genetic diversity and phylogenetic relationships of A. marmoratus populations across the globe. Our findings indicate significant genetic uniqueness between populations, with distinct clades identified for frogs from geographically separated areas, particularly highlighting the differentiation of populations from the DHR. The low genetic diversity of A. marmoratus in the DHR may be attributed to various evolutionary and demographic processes, such as geographic isolation at the range periphery, historical population fluctuations, the Pleistocene bottleneck, genetic isolation, and contemporary frog-eating practices, which pose a potential threat to its long-term survival and the ecosystem stability of the DHR. In contrast, populations from Southeast Asia and Myanmar with higher genetic diversity indicated a healthy gene pool with possible reciprocal gene flow. The reduced genetic diversity underscores immediate conservation guidelines to be implemented in the DHR to preserve a component of Himalayan biodiversity. This study may also serve as an eye-opener for the need for integrative ecological, demographic, and conservation assessments to disentangle the processes shaping genetic diversity and population structure and to safeguard A. marmoratus in the Himalaya Biodiversity Hotspot. Most importantly, the locals need to be sensitized about the effects of uncontrolled frog-eating practices to ensure the long-term survival of A. marmoratus in the DHR and, ultimately, the ecologically stable Himalaya.

Abbreviations

16S rRNA

16S ribosomal RNA

COI

Cytochrome c oxidase subunit I

DHR

Darjeeling Hill Region

FST

Fixation index

HKY

Hasegawa-Kishino-Yano

HPD

Highest Posterior Density

MCMC

Markov Chain Monte Carlo

MEGA

Molecular Evolutionary Genetics Analysis

PCR

Polymerase Chain Reaction

Authors’ contributions

RT conceived the ideas and designed the methodology; KM, ST, SS, RT, SD, DR, Shristi Subba, ASM, NAN, and KD collected the data; KM, SD, Shailesh Desai, KD, GC, and RT analyzed the data; KM, GC, and RT led the manuscript writing with inputs from all the coauthors. All the authors gave final approval for publication.

Funding

This study was supported by SERB, Government of India, through the SERB-Empowerment and Equity Grant (EEQ/2019/000750) awarded to RT.

Data availability

The voucher specimens are submitted to the Amphibia Section, Zoological Survey of India, Kolkata (Voucher number- ZSI A 16072). The DNA sequences incorporated in this study have been deposited in GenBank with accession numbers PZ676632-PZ676666 (16S rRNA) and PZ688141-PZ688169 (COI).

Declarations

Ethics approval and consent to participate

This study was carried out following all the guidelines and necessary approval from the Directorate of Forests, West Bengal, India, vide memo number: 3204/WL/4R-43/2022. Euthanasia of selected specimens was performed using tricaine methanesulfonate (MS-222) in accordance with standard herpetological protocols to minimise suffering. The Institutional Animal Ethics Committee of the Department of Zoology, University of Calcutta, certified that this research involving frogs does not fall under its regulatory purview and therefore does not require separate institutional animal ethics approval vide letter Reference Number: RT/EGL/CU/2022. All procedures complied with national wildlife regulations and institutional guidelines for animal welfare.

Consent for publication

All authors gave their consent for publication of these research findings.

Competing interests

The authors declare no competing interests.