FMT from Turkish patients with celiac disease is associated with celiac-like enteropathy features in a rat model

Abstract

Background

This study investigated whether fecal microbiota transfer (FMT) from Turkish celiac disease (CD) patients is associated with the induction of celiac-like enteropathy features in a rat model.

Methods

Wistar rats received FMT from 10 CD patients or 10 healthy controls following microbiota depletion. Physiological, histopathological (Marsh-like classification), and inflammatory markers were evaluated.

Results

The celiac disease fecal microbiota recipient rats (CD-FMT rats)group exhibited weight loss (p < 0.0001) and celiac-like histopathological features in 90% of cases. These included marked villous atrophy and intraepithelial lymphocyte counts > 20 per high-power field (HPF). A weighted kappa analysis (0.667) demonstrated a moderate association between donor Marsh scores and recipient histopathology. Systemic inflammation in the CD-FMT rats group was marked by a two-fold increase in serum IL-17 (~ 245 pg/ml; p < 0.0001) and a three-fold increase in IFN-γ (~ 95 pg/ml; p < 0.001). Additionally, mucosal mRNA expression of IL-15, IL-21, TNF-α, and IFN-α was upregulated approximately three-fold (p < 0.001). Serum β-actin levels were significantly elevated (~ 9.5 ng/ml; p < 0.0001), suggesting increased intestinal injury in this experimental setting.

Conclusion

FMT from Turkish CD patients was associated with the induction of celiac-like enteropathy features in this rat model. These findings suggest that gut microbiota from celiac disease patients may contribute to celiac-like mucosal and immune alterations in this experimental model, although it is not sufficient alone to induce disease and should be interpreted as a modulatory rather than causal factor.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12876-026-05083-y.

Introduction

Celiac disease (CD) is a chronic, immune-mediated systemic disorder triggered by the ingestion of gluten -a protein complex found in wheat, barley, and rye in genetically predisposed individuals. The condition is primarily characterized by persistent intestinal inflammation and villous atrophy within the small intestine, frequently resulting in malabsorption and a spectrum of gastrointestinal symptoms including diarrhea, weight loss, and abdominal discomfort [1, 2]. While historically categorized as a localized intestinal disorder, CD is now recognized as a multi-organ condition due to its diverse extraintestinal manifestations. The global prevalence of CD has increased substantially over recent decades, a trend likely driven by heightened clinical awareness and advancements in diagnostic methodologies [3–5].

The pathogenesis of CD is centered on a dysregulated immune response. Upon gluten exposure in untreated individuals, gluten-derived peptides activate CD4 + T cells within the lamina propria of the small intestinal mucosa. This activation triggers a cascade of pro-inflammatory cytokines, most notably interferon-gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α), alongside a complex network of interleukins including IL-2, IL-6, IL-15, and IL-21 [6, 7]. These mediators drive the recruitment of intraepithelial lymphocytes (IELs) and promote the mucosal destruction characteristic of the disease.

Beyond immune activation, structural alterations in enterocytes are fundamental to CD-associated injury. Previous studies have documented significant modifications to the actin cytoskeleton and the disruption of tight junction integrity, suggesting that cytoskeletal reorganization directly contributes to mucosal degradation. Furthermore, the resulting increase in intestinal permeability facilitates a detrimental feedback loop, allowing enhanced interaction between luminal antigens and the mucosal immune system [1, 8, 9].

The clinical spectrum of CD is remarkably broad, necessitating a diagnostic approach that integrates clinical evaluation, serological screening-specifically anti-tissue transglutaminase immunoglobulin A (tTG-IgA) and histological assessment [10–13]. Despite ongoing research into alternative therapies, a strict, lifelong gluten-free diet (GFD) remains the only effective management strategy, typically leading to symptomatic relief and mucosal recovery [14, 15].

Emerging evidence increasingly implicates the intestinal microbiota as a potentially important modulatory factor in CD pathogenesis [16, 17]. Characterized by an increased abundance of pro-inflammatory gram-negative bacteria and a reduction in protective taxa such as Bifidobacterium species, microbial dysbiosis has been linked to impaired barrier function and exacerbated inflammatory signaling [18]. Although some data suggest that these microbial shifts may precede clinical onset, the exact relationship between microbial alterations and disease development remains a subject of intense investigation. [19, 20].

Fecal microbiota transplantation (FMT) has emerged as a powerful experimental and therapeutic tool for restoring microbial homeostasis. While FMT is a well-established treatment for recurrent Clostridioides difficile infection, its utility in modeling and treating other inflammatory conditions, including inflammatory bowel disease and celiac-like enteropathy, is currently being explored [21–24].

In this context, the present study sought to investigate the contribution of the FMT to the induction of celiac-like enteropathy. By utilizing fecal samples from Turkish CD patients and healthy donors in a recipient rat model, we aimed to evaluate the capacity of patient-derived microbiota to drive celiac-like histopathological changes and systemic inflammatory signatures.

Materials and Methods

Human samples

All human samples were collected at the Gastroenterology Unit of Selçuk University Faculty of Medicine. A criterion-based sampling strategy was used to include both patients with celiac disease (CD) and healthy controls. Individuals with a history of HIV, HBV, or HCV infection, recent antibiotic use (within the past three months), prior gastrointestinal surgery, or alcohol or drug use were excluded. Participants were also screened for gluten-related disorders and metabolic diseases.

The study was approved by the Ethics Committee of Selçuk University Faculty of Medicine (No: 2022/10) and conducted in accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants.

Stool samples were collected from all participants, while intestinal biopsy samples were obtained only from patients with CD for histological evaluation. All patients were newly diagnosed adults (mean age: 39 years) and had not initiated a gluten-free diet prior to sampling. Biopsy samples were snap-frozen in liquid nitrogen and stored until analysis. Serum profiling of the CD patients revealed significantly elevated levels of pro-inflammatory markers, including IL-17 (mean ~ 1.4 ng/ml) and IFN-γ (mean ~ 1.2 ng/ml), alongside increased β-actin levels (mean ~ 1.3 ng/ml), compared to the negligible levels observed in healthy individuals (Table 1).

Table 1.

Details of patient used in the study

ID	Diagnosis	Age	Gender	Level of cytokines (ng/ml		β-Actin (ng/ml)
				IL-17 (ng/ml)	IFN- γ (ng/ml)
CD1	CD	43	Male	1.437	1.242	1.137
CD2	CD	31	Male	1.487	1.217	1.598
CD3	CD	48	Female	1.448	1.053	1.252
CD4	CD	19	Female	1.488	1.227	1.374
CD5	CD	38	Male	1.477	1.175	1.405
CD6	CD	64	Male	1.484	1.347	1.425
CD7	CD	49	Male	1.445	1.266	1.199
CD8	CD	38	Female	1.493	1.25	1.199
CD9	CD	22	Male	1.468	1.318	1.482
CD10	CD	43	Female	1.431	1.369	1.149
N1	Normal	45	Male	0.166	0.223	0.134
N2	Normal	30	Male	0.266	0.065	0.319
N3	Normal	51	Female	0.258	0.159	0.396
N4	Normal	20	Female	0.263	0.214	0.387
N5	Normal	36	Male	0.235	0.742	0.313
N6	Normal	61	Male	0.193	0.958	0.107
N7	Normal	50	Male	0.262	0.369	0.084
N8	Normal	40	Female	0.297	0.385	0.117
N9	Normal	21	Male	0.212	0.278	0.417
N10	Normal	40	Female	0.179	0.319	0.358

Stool samples were screened for infectious agents, including Entamoeba spp., Helicobacter pylori, Salmonella spp., Shigella, Cryptosporidium, adenovirus, and rotavirus, using microscopy, serological assays, and culture-based methods. Only samples negative for infectious agents were included and stored at −80 °C until use.

Animals

A total of 26 Wistar albino rats were used in this study. Animals were obtained from the Selçuk University Experimental Medicine Research and Application Center and maintained under standard laboratory conditions (12-h light/dark cycle, controlled temperature, and ad libitum access to food and water).

Animals were acclimatized for two weeks prior to the experiment.

To reduce the native intestinal microbiota before fecal microbiota transplantation (FMT), an antibiotic regimen was administered. Vancomycin and metronidazole were given via oral gavage once daily for three weeks, while ampicillin and neomycin were administered in drinking water over the same period.

Body weight was recorded at three time points: before antibiotic treatment (BAT), before fecal transfer (BFT), and after fecal transfer (AFT).

The study was approved by the Animal Experiments Ethics Committee of Selçuk University (No: 2022/12) and conducted in accordance with ARRIVE guidelines.

Fecal sample preparation and transplantation

Frozen stool samples were thawed under sterile conditions and processed individually. Each 10 g sample was diluted with 20 mL sterile phosphate-buffered saline (PBS) supplemented with L-cysteine to preserve anaerobic bacteria. The suspension was homogenized, filtered, and centrifuged at 5000 × g for 20 min.The resulting supernatant was aliquoted and stored at −80 °C under anaerobic conditions until use. FMT was performed via oral gavage at a volume of 200 µL per rat, five days per week for three weeks.

Animals were randomly assigned to three groups:

• Celiac disease fecal microbiota recipient rats (CD-FMT rats, n = 10), receiving stool from CD patients

• Healthy donor fecal microbiota recipient rats (HD-FMT rats, n = 10), receiving stool from healthy individuals

• Control rats (Control, n = 6), receiving PBS

Following FMT, animals were monitored for one week prior to sacrifice.

Animal sacrifice and tissue collection

On day 50 of the experiment, animals were euthanized under general anesthesia induced by intraperitoneal administration of xylazine (10 mg/kg) and ketamine (70 mg/kg), followed by cervical dislocation. Tissue samples from the duodenum, ileum, and colon were collected. Portions of the tissues were snap-frozen in liquid nitrogen for molecular analysis, while others were fixed in 10% formalin for histological examination. Additional samples were collected under sterile conditions for microbiological analysis.

Histological examination

Formalin-fixed tissue samples were processed, embedded in paraffin, and sectioned at 4–5 µm thickness. Sections were stained with hematoxylin and eosin (H&E) and examined using a light microscope.

The histopathological changes were evaluated semi-quantitatively using a descriptive approximation based on the Marsh-Oberhuber classification. Although this system is validated for human clinical diagnosis, it was utilized here to provide a standardized comparative assessment of the celiac-like intestinal damage observed in the experimental rat model.

Given the reported involvement of cytoskeletal alterations and barrier dysfunction in CD, histological assessment was used to explore structural changes associated with mucosal injury in this model.

Histopathological data from donor patients were compared with findings observed in FMT recipient animals.

RNA isolation and quantitative RT-PCR

Duodenal tissue samples were collected, placed in sterile tubes, and stored at -80 °C until analysis. Approximately 25-50 mg of tissue was homogenized, and total RNA was extracted according to the manufacturer’s protocol.

RNA quantity and quality were assessed prior to downstream analysis. cDNA synthesis was performed using a commercial reverse transcription kit.

Quantitative real-time PCR (qRT-PCR) was performed to evaluate the expression of IL-15, IL-21, TNF-α, and IFN-α (Table 2). Gene expression levels were normalized to the housekeeping gene GAPDH, and relative expression levels were calculated using the 2^-ΔΔCt method.

Table 2.

List of primers used in this study for qRT-PCR analysis

Target Gene	Primer Sequence*
IL-15	F: TGTGGGCATCTGAATCCACTT R: TTCCCAGACCATGCACAACC
IL- 21	F: TGCCTGCTAAGAGGACAGGA R: AGCCACAACGTGAGAAGTCC
TNF-α	F: GGCTTTCGGAACTCACTGGA R: CCCGTAGGGCGATTACAGTC
IFN-α	F: GTGGAAGGATTAGGACCAAACAGA R: CCTTCTCCAAAGGGAACCCAA
Gapdh#	F: ATGACTCTACCCACGGCAAG R: CTGGAAGATGGTGATGGGTT

F*-Forward primer R*- Reverse primer

Gapdh^#-Glycealdehyde-3-phosphate dehydrogenase

Considering the role of inflammatory mediators in CD and their potential association with barrier dysfunction, selected cytokines were analyzed.

Serum cytokine and β-actin analysis

Serum concentrations of IFN-γ and IL-17 were determined based on standard curves and are reported as absolute concentrations. β-actin was measured as an independent marker of systemic tissue damage and cellular turnover, rather than as a normalization factor or internal reference protein for the ELISA measurements.

Statistical analysis

Statistical analyses were performed using GraphPad Prism (GraphPad Software, San Diego, CA, USA). Data are presented as mean ± standard deviation (SD) or median (interquartile range, IQR), as appropriate.

Prior to statistical testing, data distribution was assessed using the Shapiro-Wilk normality test, and homogeneity of variance was evaluated using Bartlett’s test. Parametric analyses were applied only when assumptions of normality and equal variance were satisfied; otherwise, non-parametric tests were used.

The individual rat was considered the experimental unit for all analyses. FMT was performed using a one-to-one donor-recipient design, and fecal samples were processed and administered individually. Therefore, all measurements represent independent biological replicates.

For comparisons among three independent groups (CD-FMT rats, HD-FMT rats, and control), one-way analysis of variance (ANOVA) or the Kruskal–Wallis test was used, followed by Tukey’s or Dunn’s multiple-comparison post hoc tests, respectively. For analyses involving more than one factor (e.g., treatment group and time point), two-way ANOVA followed by Tukey’s post hoc test was applied. A p-value < 0.05 was considered statistically significant.

Results

The study cohort comprised 10 patients diagnosed with celiac disease and 10 healthy control subjects. The CD group exhibited a balanced gender distribution with 7 males (70%) and 3 females (30%), ranging in age from 19 to 74 years. Similarly, the healthy control group consisted of 7 males (70%) and 3 females (30%), aged 20 to 61 years. The cumulative mean age of all participants was 39.45 years.

Longitudinal monitoring of body weight at three critical phases (BAT, BFT, and AFT) revealed divergent physiological trajectories. Rats in the control and HD-FMT rats groups exhibited consistent and progressive weight gain throughout the experimental period, reflecting normal development. In sharp contrast, the CD-FMT rats group experienced a rapid and significant decline in body weight specifically following fecal microbiota transfer. Although the CD-FMT rats group initially gained weight between the BAT and BFT phases, the post-transfer period was defined by a severe reduction in mass (**** p < 0.0001; Fig. 1), a likely contributing factor to systemic metabolic impairment in this experimental model.

Fig. 1.

Longitudinal dynamics of body weight following FMT. Scatter plot illustrating body weight (g) at three time points: Before Antibiotic Treatment (BAT), Before Fecal Transfer (BFT), and After Fecal Transfer (AFT). A highly significant reduction in body weight occurred exclusively in the CD-FMT rats group post-transfer (**** p < 0.0001), while HD-FMT rats and control groups exhibited steady growth. Statistical analysis was performed using two-way ANOVA followed by Tukey's post hoc test. Significance is indicated as follows: ns, not significant; ****p < 0.0001

As shown in Figs. 2B and 2 C and Supplement Tables 1-3, these rats developed severe mucosal degradation, including marked villous atrophy, blunting, and a significant reduction in the V/C ratio. While the duodenal mucosa of control and HD-FMT rats remained entirely unremarkable, the CD-FMT rats group exhibited discernible macroscopic alterations. Histopathological analysis supported these findings by demonstrating mucosal alterations. Control animals receiving PBS exhibited pristine duodenal architecture, characterized by elongated, slender villi, a physiological villus-to-crypt (V/C) ratio, and intraepithelial lymphocyte (IEL) counts strictly within the normal range of 0-9 per high-power field (HPF) (Fig. 2A; Supplement Tables 1-3). While the HD-FMT rats group maintained preserved villous structures, a marginal, non-pathological increase in IELs (10–15 per HPF) was noted, suggesting a mild but contained response to the donor microbiota. In contrast, the CD-FMT rats group demonstrated characteristic celiac-like histopathological features. This architectural collapse was accompanied by a marked increase in intraepithelial lymphocytes, with counts consistently exceeding 20 per HPF. These findings demonstrate that the transfer of CD associated microbiota may be associated with an enteropathic phenotype that recapitulates celiac-like histopathological features in this experimental setting (Supplement Tables 1-3).

Fig. 2.

Histopathological characterization of duodenal mucosal architecture. A Representative H&E-stained sections (× 20 magnification) from the control (n = 6) and HD-FMT rats (n = 10) groups showing preserved villous architecture and normal mucosal morphology. B Representative sections from the CD-FMT rats group (n = 10) demonstrating severe celiac-like pathology, including villous blunting, reduced V/C ratio, and pathological IEL infiltration (> 20 per HPF). Green arrows indicate villus height and yellow arrows indicate crypt depth. (C) Quantitative comparison of the villus-to-crypt (V/C) ratio across the three experimental groups: control (n = 6), HD-FMT rats (n = 10), and CD-FMT rats (n = 10). The CD-FMT rats group exhibited a significantly reduced V/C ratio compared to both the HD-FMT rats and control groups, consistent with the histopathological features of celiac-like mucosal injury. Data are presented as mean ± SD. Statistical analysis was performed using the Kruskal-Wallis test with appropriate post hoc corrections. Significance is indicated as follows: ns, not significant; **p < 0.01; ****p < 0.0001

The relevance of this animal model was further explored through a direct comparison of donor-recipient histopathology. According to the Marsh-Oberhuber classification, 90% of CD-FMT rats developed Marsh-like lesions ranging from infiltrative to destructive stages (Table 3). A granular analysis of Table 4 reveals a moderate association between the severity of the donor's lesion and the recipient's response. Specifically, in rats receiving microbiota from five patients with Marsh 1 lesions, four (80%) developed corresponding Marsh-like 1 histopathological changes. Identical success was observed in the Marsh-like 3 cohort, where 80% of recipients manifested Marsh-like 3 features. Furthermore, although no Marsh 2 patients were included as donors, one CD-FMT rats (20%) spontaneously developed Marsh-like 2 histopathological changes. Overall, a weighted kappa analysis demonstrated a moderate and statistically robust agreement (0.667) between donor histopathology and the resulting findings in the recipient rats (Table 5), confirming the moderate predictive valueof FMT in modeling individual patient phenotypes.

Table 3.

Histological examinations of fecal-transferred animals using the Marsh-Oberhuber scores

Samples	0	1	2	3a	3b	3c	4
C1	X
C2	X
C3	X
C4	X
C5	X
C6	X
HD-FMT rats 1	X
HD-FMT rats 2	X
HD-FMT rats 3	X
HD-FMT rats 4	X
HD-FMT rats 5	X
HD-FMT rats 6	X
HD-FMT rats 7	X
HD-FMT rats 8	X
HD-FMT rats 9	X
HD-FMT rats 10	X
CD-FMT rats 1					X
CD-FMT rats 2		X
CD-FMT rats 3			X
CD-FMT rats 4	X
CD-FMT rats 5				X
CD-FMT rats 6		X
CD-FMT rats 7		X
CD-FMT rats 8	X
CD-FMT rats 9	X
CD-FMT rats 10		X

Table 4.

Comparison of histopathological results between celiac patients and the CD-FMT rats group of rats

Patient histopathology		Histopathology of the transferred rats
CD1	3b	CD-FMT rats 1	3b
CD2	1	CD-FMT rats 2	1
CD3	1	CD-FMT rats 3	2
CD4	3b	CD-FMT rats 4	3b
CD5	3a	CD-FMT rats 5	3a
CD6	1	CD-FMT rats 6	1
CD7	3a	CD-FMT rats 7	3a
CD8	1	CD-FMT rats 8	1
CD9	3a	CD-FMT rats 9	3a
CD10	1	CD-FMT rats 10	1

Table 5.

Statistical comparison of histopathological results between CD patients and CD-FMT rats

Histopathology (Human)
		1	2	3	Total	Weighted kappa
Histopathology (rats)	1	4 (80)	0 (0)	0 (0)	4
	2	1 (20)	0 (0)	1 (20)	2	0.667
	3	0 (0)	0 (0)	4 (80)	4
	Total	5	0	5	10

The presence of celiac-like features in the CD-FMT rats group was further supported by a marked systemic and mucosal inflammatory response.

Serum analysis demonstrated a stark escalation in the Th17-related cytokine IL-17, which reached approximately 245 pg/ml in the CD-FMT rats group-a near two-fold increase over the HD-FMT rats (~ 135 pg/ml; * p < 0.05) and control (~ 115 pg/ml; **** p < 0.0001) cohorts (Fig. 3A). IFN-γ levels peaked at approximately 95 pg/ml in CD-FMT rats, nearly triple the levels observed in the HD-FMT rats (~ 35 pg/ml; *** p < 0.001) and control (~ 30 pg/ml; ** p < 0.01) groups (Fig. 3A). Furthermore, serum β-actin was analyzed as a separate dataset to serve as a marker of systemic tissue damage [8, 9]. Levels were significantly elevated to ~ 9.5 ng/ml in the CD-FMT rats group compared to ~ 3.0–3.5 ng/ml in the other cohorts (**** p < 0.0001), which may reflect tissue-associated alterations in this experimental model. At the transcriptional level, the duodenal mucosa of CD-FMT rats exhibited a significant up-regulation of cytokines associated with celiac disease pathogenesis. Relative mRNA expression of IL-15 and IL-21 was increased approximately three-fold in the CD-FMT rats group compared to the HD-FMT rats (* p < 0.01) and control (*** p < 0.001) groups (Fig. 3B). Specifically, IL-15 and IL-21 expression values in the CD-FMT rats group (~ 45 and ~ 43 relative units, respectively) stood in sharp contrast to the baseline levels (~ 12-15 units) maintained in the HD-FMT rats and control groups. Similarly, the innate and pro-inflammatory transcripts TNF-α and IFN-α displayed significant and consistent elevations (*** p < 0.001), with the CD-FMT rats group exhibiting mean expression levels exceeding 40 relative units compared to baseline values of approximately 15 units in the comparison groups. No statistically significant differences were detected between the HD-FMT rats and control groups in any of the evaluated gene expression levels.

Fig. 3.

Systemic and mucosal inflammatory markers. A Analysis of absolute serum concentrations of IL-17, IFN-γ, and the tissue damage marker β-actin, showing significant systemic elevation in the CD-FMT rats group. B Relative mRNA expression of IL-15, IL-21, TNF-α, and IFN-α in duodenal tissue, each normalized to the housekeeping gene GAPDH and presented as relative expression units (2^ - ΔΔCt method). As reflected in the Y-axis labels of each panel, all values represent GAPDH-normalized expression. Transcriptional levels of all four pro-inflammatory cytokines were significantly up-regulated in the CD-FMT rats group compared to both the HD-FMT rats and control groups (*** p < 0.001). Statistical analysis was conducted using the Kruskal–Wallis test followed by Dunn's post hoc test. Significance is indicated as follows: ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001

Discussion

The intestinal microbiota has been increasingly recognized as a potential modulatory factor in the pathogenesis of CD, particularly through its potential role in modulating immune responses and intestinal inflammation. Dysbiosis, defined as an imbalance in gut microbial composition characterized by reduced beneficial bacteria and increased potentially pathogenic microorganisms, has been reported in patients with CD [2, 25, 26]. FMT has therefore emerged as a useful experimental approach to investigate microbiota-related mechanisms [27, 28]. In the present study, rats receiving fecal microbiota from CD patients developed characteristic celiac-like histopathological features, including a marked increase in intraepithelial lymphocytes (IEL counts consistently exceeding 20 per HPF), a reduced villus-to-crypt ratio, and severe villous atrophy and blunting. These findings suggest that fecal microbiota transfer may contribute to celiac-like enteropathy features in this experimental model. However, these findings should be interpreted cautiously, as cross-species microbiota transfer may not fully replicate human disease conditions.

Rats receiving fecal microbiota from healthy donors or PBS maintained preserved mucosal architecture. Specifically, control animals receiving PBS exhibited IEL counts strictly within the normal range of 0-9 per HPF, while the HD-FMT rats group showed a marginal, non-pathological increase (10-15 per HPF), suggesting a mild but contained response to the donor FMT.

Body weight changes observed in the experimental groups supported histological findings. While the control and HD-FMT rats groups exhibited consistent and progressive weight gain, the CD-FMT rats group experienced a rapid and significant decline in body weight specifically following fecal microbiota transfer (p < 0.0001). These observations are consistent with impaired nutrient absorption associated with intestinal inflammation [29], suggesting a possible association between FMT and metabolic alterations. In this study, 90% of rats that received FMT from CD patients developed Marsh-like lesions ranging from infiltrative to destructive stages. This variation suggests that the induction of celiac-like enteropathy following microbiota transfer is not uniform and may involve multiple interacting factors. Notably, a granular analysis revealed an 80% success rate in manifesting corresponding histopathological changes in recipients of Marsh 1 and Marsh 3 donor FMT, respectively. A weighted kappa analysis demonstrated a moderate agreement (0.667) between donor histopathology and the resulting findings in the recipient rats, supporting the relevance of this model for investigating microbiota-associated celiac-like features with patient-specific histopathological variability. In addition, the patchy distribution of intestinal lesions, which is a recognized feature of celiac disease in humans, may help explain why different intestinal segments showed different Marsh-like grades. Overall, these findings support a possible role for interactions between the gut microbiota and host immune responses in shaping the severity and distribution of celiac-like histopathological changes [30–32].

Proinflammatory cytokines play a key role in CD pathogenesis. Previous studies have demonstrated increased expression of IL-15, IL-21, TNF-α, and IFN-α in duodenal tissue and elevated serum levels of IL-17 and IFN-γ [33]. Serum IL-17 and IFN-γ levels were also elevated in the CD-FMT rats group, consistent with previous reports [34]. In agreement with these findings, our results demonstrated a profound systemic and mucosal inflammatory signature in rats receiving fecal microbiota from CD-FMT rats. Specifically, serum IL-17 reached approximately 245 pg/ml (a near two-fold increase over controls) and IFN-γ peaked at approximately 95 pg/ml (nearly triple the levels of the HD-FMT rats group). IL-15 is a key cytokine involved in epithelial damage and activation of intraepithelial lymphocytes. Increased IL-15 expression has been reported in active CD [35]. Our results demonstrated that at the transcriptional level, relative mRNA expression of IL-15 (~ 45 relative units) and IL-21 (~ 43 relative units) was increased approximately three-fold in the CD-FMT rats group compared to baseline levels (~ 12-15 units) maintained in the HD-FMT rats and control groups [36–39]. TNF-α and IFN-α are also involved in inflammatory pathways associated with CD. Elevated levels of these cytokines have been reported in previous studies [40–43]. Our findings demonstrated significant and consistent elevations of these transcripts, with mean expression levels exceeding 40 relative units in the CD-FMT rats group compared to baseline values of approximately 15 units in the comparison groups.

Recent studies suggest that the gut microbiota may play a role in the development of celiac disease, rather than being only a secondary effect of inflammation. Some evidence indicates that alterations in microbial communities (dysbiosis) can influence mucosal immune responses and affect how gluten peptides are processed and recognized by the immune system [44, 45]. In this context, certain microbial taxa may contribute to pro-inflammatory signaling, while others may have protective effects by helping to degrade immunogenic gluten fragments [44]. In addition, dietary components appear to interact with the gut microbiota, potentially modulating inflammatory [46, 47]. For example, anti-inflammatory nutrients such as n-3 polyunsaturated fatty acids have been reported to influence microbiota composition and may help reduce cytokine-mediated inflammation [46]. Overall, these findings are in line with our results and support the idea that interactions between diet and gut microbiota may contribute to celiac-like histopathological changes [46–50].

In this context, serum β-actin levels were evaluated as a potential marker associated with epithelial structural alterations and systemic cellular turnover. Critically, β-actin was utilized exclusively as an independent marker of cellular injury and was not used for the normalization of secreted cytokines. As β-actin is a cytoskeletal protein, its release into the serum reflects cell lysis and tissue destruction, making it unsuitable as a stable housekeeping reference in this biological compartment. These findings may reflect non-specific cellular and cytoskeletal alterations associated with inflammatory responses in this experimental setting. However, serum β-actin is not an established biomarker of intestinal mucosal injury, and these observations should be considered exploratory. Further studies are required to clarify its biological relevance.Previous studies have reported structural alterations in enterocytes in CD, including modifications of the actin cytoskeleton and disruption of tight junction integrity. These changes suggest that cytoskeletal reorganization and impaired cell-cell interactions may contribute to mucosal injury. Increased intestinal permeability associated with epithelial barrier dysfunction has also been described in CD [1, 8, 9]. While these findings provide significant insights, certain experimental constraints warrant consideration. The use of standard laboratory chow, which inherently contains gluten, may have contributed as a non-specific dietary cofactor within this experimental setting. The observed celiac-like features likely reflect interactions among transferred microbiota, antibiotic pre-treatment, host-related factors, and dietary components rather than the effect of a single factor alone.

Furthermore, although the cross-species transfer of human microbiota into a rodent model is a useful experimental approach for mechanistic investigation, the inherent physiological differences between humans and rats may influence the full replication of human mucosal features. Notably, standard Wistar rats lack the HLA-DQ2/DQ8 genetic background that confers susceptibility to gluten-driven immune activation in human celiac disease patients and the celiac-like features observed in this model therefore reflect microbiota-associated mucosal and immune modulation rather than a fully humanized disease phenotype. Future studies utilizing defined gluten-free diets and humanized host models may further delineate the precise contributions of the microbiota to celiac-like histopathological changes. In conclusion, fecal microbiota transfer from donors with celiac disease was associated with the development of celiac-like enteropathy features in this rat model, accompanied by a systemic inflammatory signature suggesting modulation of host mucosal responses. These results highlight the potential of FMT as an experimental tool to study the mechanisms underlying celiac-like enteropathy, although further research is needed to elucidate specific host–microbiota interactions.

Abbreviations

CD

Celiac disease

FMT

Fecal microbiota transplantation

HD-FMT rats

Healthy donor fecal microbiota recipient rats

CD-FMT rats

Celiac disease fecal microbiota recipient rats

IELs

Intraepithelial lymphocytes

PBS

Phosphate-buffered saline

qRT-PCR

Quantitative real-time polymerase chain reaction

IFN

Interferon

TNF

Tumor necrosis factor

IL

Interleukin

GFD

Gluten-free diet

H&E

Hematoxylin and eosin

Authors’ contributions

RS and DF planned the study. SM, RS, ZC, MBA, MKK, HK collected the data. DF performed the statistical analysis. RS, BA, DF interpreted the data and drafted the manuscript. All the Authors revised and approved the final version of the manuscript. All authors read and approved the final manuscript. All authors read and approved the final manuscript.

Funding

This study was financially supported by the Selçuk University Research Foundation under grant number 22212019 to RS. Open access funding provided by the Scientific and Technological Research Council of Türkiye (TÜBİTAK).

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The study involving human participants was approved by the Ethics Committee of the Faculty of Medicine, Selçuk University (Approval No: 2022/10) and was conducted in accordance with the Declaration of Helsinki.

All animal procedures were approved by the Animal Experiments Ethics Committee of Selçuk University (Approval No: 2022/12) and were conducted in accordance with institutional guidelines and the ARRIVE guidelines.

All participants provided written informed consent prior to participation.

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.