MKRN1 suppresses cuproptosis in colorectal cancer through ubiquitin-dependent regulation of SLC31A1

Abstract

Background

Despite the emerging role of cuproptosis in cancer biology, the regulatory mechanism by which ubiquitination modulates this process through MKRN1 and SLC31A1 in colorectal cancer (CRC) progression remains unclear. This study aimed to elucidate the functional relationship between MKRN1, SLC31A1, and cuproptosis in CRC.

Methods

Stable MKRN1-knockdown and MKRN1-overexpressing colorectal cancer (CRC) cell lines were established. Cuproptosis was induced using elesclomol and copper sulfate, and assessed by cell viability assays,, measurement of intracellular copper levels, and western blot analysis of hallmark proteins (HSP70 and DLAT). The MKRN1-SLC31A1 interaction was examined by co-immunofluorescence, ubiquitination assays (employing MG132, CHX, and linkage-specific ubiquitin mutants), and quantitative real-time PCR (q-PCR). Mitochondrial function was evaluated via JC-1 staining and transmission electron microscopy. Rescue experiments were conducted using dual genetic manipulation of MKRN1 and SLC31A1. Finally, in vivo validation was performed using a xenograft model in NOD-SCID mice.

Results

MKRN1 overexpression significantly attenuated cuproptosis agonist-induced cytotoxicity and reduced intracellular copper accumulation. Mechanistically, MKRN1 directly interacts with SLC31A1 and promotes its polyubiquitination and subsequent proteasomal degradation. This degradation prevents copper overload, helping to maintain mitochondrial integrity.(as evidenced by maintained mitochondrial membrane potential and Tomm20 expression) and suppressing key cuproptosis hallmarks, including HSP70 induction and DLAT oligomerization. Genetic rescue experiments confirmed that SLC31A1 knockdown reversed the cuproptosis sensitivity conferred by MKRN1 depletion. Consistently, MKRN1 overexpression promoted tumor growth in vivo while concurrently suppressing cuproptosis.

Conclusion

In summary, MKRN1 suppresses copper-induced cell death in colorectal cancer by promoting the ubiquitination and proteasomal degradation of the copper transporter SLC31A1, thus limiting copper accumulation and mitochondrial toxicity. This mechanism confers resistance to copper-induced cell death and facilitates tumor progression, establishing the MKRN1/SLC31A1 axis as a promising therapeutic target.

Introduction

Colorectal cancer (CRC) ranks as the third leading cause of cancer-related deaths in the United States [1]. Globally, the incidence of CRC continues to rise [2], with a concerning trend toward younger patient populations, driven largely by dietary patterns, obesity, and lifestyle factors [3]. Epidemiological data project approximately 153,020 new CRC cases and 52,550 CRC-related deaths in 2023, including 19,550 cases and 3,750 deaths among individuals under 50 years of age [4]. Current therapeutic strategies for CRC encompass surgical resection combined with chemotherapy, radiotherapy, targeted therapy, and immunotherapy [5, 6]. However, chemoresistance remains a major clinical challenge, significantly limiting treatment efficacy and worsening patient prognosis [7]. Given the frequent adverse effects and dynamic nature of drug resistance, the development of safer and more effective therapeutic agents for CRC is urgently needed [8].Growing evidence suggests that chemoresistance is closely linked to the suppression of regulated cell death pathways, including apoptosis, pyroptosis, and ferroptosis. This highlights the critical importance of targeting these pathways as a promising strategy for improving CRC treatment outcomes.

Cuproptosis represents a distinct form of regulated cell death (RCD) that differs fundamentally from other RCD modalities, characterized by its copper dependence, accumulation of lipoylated proteins, and depletion of Fe-S cluster proteins [9]. As an essential trace element, copper serves as a cofactor for over thirty enzymes involved in diverse physiological processes [10]. Intracellular copper levels must be tightly regulated alongside other metals—deficiency impairs metal-dependent enzymatic functions, while excess leads to cytotoxic effects and cell death [11]. Analogous to other cell death pathways, cuproptosis has demonstrated significant potential for cancer therapeutics [12].

The SLC31A1 gene encodes a protein that functions as a homotrimer in dietary copper uptake [13], serving as the principal mediator of Cu²⁺ absorption in mammalian cells and tissues [14]. Emerging evidence reveals its dual role in tumor progression: As an oncogenic promoter, SLC31A1 facilitates copper transport in tumor cells and stimulates angiogenesis, thereby accelerating cancer progression [15]. The LNP-miR-155-cy5 inhibitor exerts antitumor effects by downregulating SLC31A1-mediated copper transport and disrupting intracellular copper homeostasis, subsequently modulating the β-catenin/TCF4 pathway [16]. Furthermore, SLC31A1 undergoes ubiquitination and degradation mediated by the E3 ligase NEDD4L, which suppresses CTR1-AKT signaling and tumor growth [17].

Conversely, tumor-suppressive functions have also been documented. Multiple studies demonstrate that SLC31A1 modulates cisplatin concentrations across various malignancies and significantly influences patient prognosis [18–20]. The conceptualization of cuproptosis has further illuminated its role in copper overload-induced cell death: Advanced glycation end products (AGEs) induced by chronic hyperglycemia upregulate SLC31A1 expression, elevating intracellular copper levels and disrupting copper homeostasis to promote apoptosis in murine cardiomyocytes [21].SLC31A1 overexpression induces cuproptosis in both 293 T cells and human lung adenocarcinoma cells [9], suggesting its potential as a tumor suppressor through copper-dependent cell death mechanisms.

Eukaryotic cells maintain protein homeostasis through two principal degradation pathways: (1) the ubiquitin–proteasome system (UPS) and (2) the autophagy-lysosome pathway (ALP) [22]. Ubiquitination, a critical post-translational modification, plays a pivotal role in regulating cellular protein turnover [23]. Emerging evidence highlights the involvement of E3 ubiquitin ligases in modulating diverse biological processes associated with cancer progression and cellular stress responses [24]. These enzymes are classified into three major families based on their structural domains: the RING (Really Interesting New Gene) family [25], HECT (Homologous to E6AP C-Terminus) domain family [26], and U-box family [24]. Notably, RING-type E3 ligases have been extensively characterized as key regulators of oncogenic processes, functioning either as tumor promoters or suppressors to control critical cellular behaviors including proliferation, migration, and epithelial-mesenchymal transition (EMT) [27, 28]. The ubiquitination cascade involves coordinated action of three enzymes: E1 (ubiquitin-activating enzyme), E2 (ubiquitin-conjugating enzyme), and E3 (ubiquitin ligase). E3 ligases serve as the crucial determinant of substrate specificity by selectively recognizing target proteins and facilitating their transfer to the E2 ~ Ub complex [29]. This unique position in the ubiquitination machinery establishes E3 ligases as the most influential regulators of protein ubiquitination.

The MKRN1 gene, located on the long arm of chromosome 7 (7q), exhibits remarkable evolutionary conservation across species [30]. This gene encodes an E3 ubiquitin ligase that critically regulates both metabolic disorders and malignant transformation through substrate-specific ubiquitination [31]. Emerging evidence demonstrates MKRN1's multifaceted role in oncogenesis via ubiquitin-mediated degradation of key regulatory proteins: Direct ubiquitination of APC promotes Wnt/β-catenin signaling activation and tumor progression. Post-translational modification of p14ARF accelerates gastric tumorigenesis. FADD degradation-mediated apoptosis suppression enhances melanoma growth. SNIP1 protein degradation activates TGF-β signaling to facilitate colorectal cancer metastasis [32–35]. While these findings establish MKRN1 as a crucial oncogenic regulator, its complete mechanistic repertoire in tumor progression remains to be fully elucidated. Our bioinformatic analysis of the UCLCAN database reveals significant upregulation of copper transporter proteins and copper homeostasis regulators in colorectal cancer (CRC), indicating heightened copper demand in malignant cells. Maintenance of copper homeostasis appears essential for CRC progression, though copper's dual nature renders it cytotoxic at elevated intracellular concentrations [36]. Notably, we observed: Elevated SLC31A1 mRNA expression in TCGA CRC datasets. Paradoxically low/undetectable SLC31A1 protein levels in clinical specimens (HPA database) [37]. This discordance suggests post-translational regulation of SLC31A1, likely through ubiquitin-mediated degradation, which would directly impact: Intracellular copper accumulation, Cellular sensitivity to cuproptosis inducers, Copper-dependent signaling pathways.We hypothesize that E3 ubiquitin ligase-mediated degradation of SLC31A1 (potentially by MKRN1) represents a novel mechanism for modulating copper homeostasis in CRC, offering new therapeutic opportunities for cuproptosis-based interventions [38].

The clinical application of copper ionophores remains suboptimal, likely due to limited pharmacological studies and the emergence of therapy resistance, which reduces tumor sensitivity to these agents. MKRN1 has been implicated in promoting tumor progression, with multiple studies linking its expression to chemoresistance in cancers such as cervical and breast cancer [39–41]. However, experimental evidence regarding the regulatory role of MKRN1 in copper-induced cell death (cuproptosis) remains lacking. Our preliminary studies have demonstrated that MKRN1 is overexpressed in colorectal cancer (CRC), where it drives tumor progression while suppressing key cuproptosis-related genes. This finding provides novel insights into how tumor cells evade cuproptosis. Building on this foundation, we further investigate the mechanistic link between MKRN1 and cuproptosis in CRC, as well as the potential therapeutic value of SLC31A1 (a critical copper transporter) in clinical CRC treatment.

Methods

Cell culture

HEK-293 T, HT29, and HCT15 cell lines were maintained in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (dual antibiotics). Cells were cultured at 37 °C in a 5% CO₂ incubator and passaged at 80% ~ 90% confluence using standard protocols. Post-passage, cells were cultured under identical conditions.

SLC31A1-shRNA design

Three distinct SLC31A1-targeting shRNA sequences (Table 1) were designed and synthesized by BioSune Biotech (BIO) to ensure optimal knockdown efficiency.

Table 1.

Three shRNA target sequences of SLC31A1 gene

Gene	Sense(5′—3′)
sh1	5′-CCGGCGGTACAGGATACTTCCTCTTCTCGAGAAGAGGAAGTATCCTGTACCGTTTTT- 3′
sh2	5′-CCGGGATGCCTATGACCTTCTACTTCTCGAGAAGTAGAAGGTCATAGGCATCTTTTTT- 3′
sh3	5′-CCGGGCGTAAGTCACAAGTCAGCATCTCGAGATGCTGACTTGTGACTTACGCTTTTTT- 3′

The design sequence of the PLVX-SLC31A1-Myc-puro plasmid overexpressing SLC31A1 is shown in Table 2

Table 2.

Target sequence for the overexpression of the SLC31A1 gene

Gene

Sense(5′—3′)

PLVX-SLC31A1-Myc-puro

5′-ATGGATCATTCCCACCATATGGGGATGAGCTATATGGACTCCAACAGTACCATGCAACCTTCTCACCATCACCCAACCACTTCAGCCTCACACTCCCATGGTGGAGGAGACAGCAGCATGATGATGATGCCTATGACCTTCTACTTTGGCTTTAAGAATGTGGAACTACTGTTTTCCGGTTTGGTGATCAATACAGCTGGAGAAATGGCTGGAGCTTTTGTGGCAGTGTTTTTACTAGCAATGTTCTATGAAGGACTCAAGATAGCCCGAGAGAGCCTGCTGCGTAAGTCACAAGTCAGCATTCGCTACAATTCCATGCCTGTCCCAGGACCAAATGGAACCATCCTTATGGAGACACACAAAACTGTTGGGCAACAGATGCTGAGCTTTCCTCACCTCCTGCAAACAGTGCTGCACATCATCCAGGTGGTCATAAGCTACTTCCTCATGCTCATCTTCATGACCTACAACGGGTACCTCTGCATTGCAGTAGCAGCAGGGGCCGGTACAGGATACTTCCTCTTCAGCTGGAAGAAGGCAGTGGTAGTGGATATCACAGAGCATTGCCAT- 3′

The designs of pCMV-HA-Ub, HA-Ub-K11 plasmids, HA-Ub-K48 plasmids, HA-Ub-K63 plasmids were synthesized by BIO.

Plasmid amplification and extraction

Plasmid extraction mainly includes three steps: bacterial proliferation, bacterial lysis to release plasmid DNA, and the isolation and purification of plasmid DNA.

Western Blot

The key steps of Western Blotting include: (1) Sample preparation (cell/tissue lysis, protein quantification using BCA/Bradford assay, and denaturation in Laemmli buffer at 95 °C ~ 100 °C); (2) SDS-PAGE electrophoresis (protein separation based on molecular weight using a discontinuous polyacrylamide gel); (3) Membrane transfer (electrophoretic transfer of proteins onto PVDF or nitrocellulose membranes via wet/tank blotting); (4) Blocking (incubation with 5% non-fat milk or BSA in TBST to minimize nonspecific binding); (5) Primary antibody incubation (overnight at 4 °C or 1–2 h at RT with target-specific antibodies); (6) Secondary antibody incubation (HRP-conjugated antibody, 1 h at RT); and (7) Detection (ECL-based chemiluminescent substrate exposure for signal visualization). Protein expression levels are quantified by densitometric analysis (e.g., ImageJ) and normalized to internal controls (e.g., β-actin or GAPDH).

Separation of soluble and insoluble proteins

Add NP40 cell lysis buffer containing protease inhibitor to the collected cell precipitate, mix thoroughly, and then slowly shake it on a 4 °C cold storage shaker for lysis for 30 to 60 min. Centrifuge at 4 ℃ and 12,000 rpm for 20 min under centrifugation conditions. Separate the above-mentioned supernatant and precipitate. Add 5 × Loading Buffer protein Loading Buffer to the supernatant, dilute the 5 × Loading Buffer to 1 × with NP40, and resuspend the precipitate with 1 × loading buffer. Then boil the two components for protein denaturation and store them at −80 ℃ for later use.

qRT-PCR

Total RNA is extracted from samples (e.g., cells/tissues) using TRIzol® or column-based kits, followed by DNase treatment to eliminate genomic DNA. RNA quality/purity is verified via spectrophotometry (A260/A280 ratio ≥ 1.8) and electrophoresis. cDNA is synthesized via reverse transcription (RT) with oligo(dT) primers or random hexamers. qPCR is performed using SYBR® Green or TaqMan® probes in a thermal cycler: denaturation (95 °C, 30 s), amplification (40 cycles of 95 °C for 5 s and 60 °C for 30 s), and melting curve analysis (SYBR® Green only) to confirm specificity. Each reaction includes technical triplicates, no-template controls (NTCs), and reference genes (e.g., GAPDH/β-actin) for normalization. Data are analyzed via the ΔΔCt method to quantify relative gene expression. Key parameters include amplification efficiency (90% ~ 110%) and R² > 0.98 for standard curves. The primer sequences are shown in Table 3.

Table 3.

Primer sequences

Gene	Sense(5′—3′)		产物长度 (bp)
MKRN1	Sense Antisense	GCATTGAGGCCCATGAGAAG GTAGGTGTGGTTGCAGTTGG	152
SLC31A1	Sense Antisense	GATGAGCTATATGGACTCCAACAAGGATGGTTCCATTTGGTCC	325
GAPDH	Sense Antisense	GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG	197

Cell viability was detected by CCK-8

Collect the cells by trypsin digestion, centrifuge (1,000 rpm, 5 min), discard the supernatant, and dilute and count with PBS.

Inoculated 96-well plates at 3,000 cells per well and cultured at 37 °C with 5% CO₂. After adhesion, it was pretreated with 10 μmol TTM for 4 h and then cultured in the medium containing Elesclomol (40 nmol) + Cu²⁺(10 μmol) + TTM.

During the detection, the serum-free medium was changed and incubated with CCK-8 for 2 h. The OD value was measured at 450 nm.

The copper ion detection Kit for cells and tissues is used to detect the copper ion levels in cells and tissues.

Detection of copper ion levels in cells and tissues: Collect the protein lysate according to the steps for obtaining the protein lysate of tissues and cells, and aspirate the supernatant of the protein lysate into a new EP tube for ① BCA detection of protein concentration ② detection of copper levels in cells.

Detection of GSH levels in cells

Cell lysis: Centrifuge to collect the precipitate, add 100 μL of lysis buffer (working solution 1), ultrasonically break up, centrifuge at 4 °C and 12,000 rpm to obtain the supernatant, and dilute 10 times for testing. Incubation solution preparation: Mix the working solutions 2 and 3 in proportion, add 200 μL to each well, and then add 40 μL of sample diluent. Determination: The OD value is detected by an microplate reader.

Hoechst (33,258) staining experiment

Cell plating: After trypsin digestion, 1 × 10⁴ cells per well (six-well plate) were inoculated. After adhesion, TTM pretreatment was performed for 4 h, and copper death was induced by using medium containing Elesclomol + Cu²⁺. Fixed staining: After 48 h, fix with 4% paraformaldehyde for 15 min, wash with PBS, stain in the dark with Hoechst 33,258 (5 μg/mL) for 10 min, and wash with PBS three times. Fluorescence detection: Observe apoptotic cells (strong fluorescence) and normal cells (weak fluorescence) under a fluorescence microscope, and take photos for analysis.

Mitochondrial membrane potential JC-1 staining experiment

(1) Cell plating: After trypsin digestion, resuspend the cells and inoculate them into six-well plates at a rate of 5 × 105 cells per well. When the cells adhered, the medium of the dosing group was replaced with the medium containing copper death agonists combined with copper ions.(2) JC-1 staining: The next day, the cells were digested with trypsin, centrifuged to remove the supernatant, and then resuspended in fresh medium. The cells were spread back into the original six-well plate, and JC-1 staining solution was added. Incubated at 37 °C for 5 min.(3) Red and green fluorescence is detected by a fluorescence spectrophotometer. Photograph and record with a fluorescence microscope.

Immunofluorescence co-localization assay

Cells cultured on coverslips are fixed (4% paraformaldehyde, 15 min), permeabilized (0.1% Triton X-100, 10 min), and blocked (5% BSA, 1 h). Primary antibodies targeting proteins of interest (raised in different species) are incubated overnight at 4 °C. After PBS washes, species-specific secondary antibodies conjugated to spectrally distinct fluorophores (e.g., Alexa Fluor 488/594) are applied (1 h, dark). Nuclei are stained with DAPI (5 min). Samples are mounted with antifade reagent and imaged by confocal microscopy (sequential scanning to minimize bleed-through). Z-stack images (0.5 μm intervals) are acquired for 3D analysis. Co-localization is quantified using Pearson’s coefficient (PCC) or Manders’ overlap coefficient (MOC) in ImageJ (Coloc2 plugin). Controls include single-labeling, no-primary antibody, and unstained samples. Data represent mean ± SEM of ≥ 3 independent experiments.

Co-immunoprecipitation (Co-IP)

Cells were lysed in 600 μL NP-40 buffer (1 mM PMSF) and centrifuged (12,000 × g, 15 min, 4 °C). For input controls, 100 μL supernatant was mixed with 5 × Laemmli buffer (1:4), boiled (100 °C, 10 min), and stored at −80 °C. Lysates were pre-cleared with 20 μL Protein A/G beads (500 μL lysis buffer, 4 °C, 30 min, rotation; 3,000 × g, 5 min). Immunoprecipitation was performed by incubating pre-cleared lysates with primary antibody (1 μg/mg protein, 2 h, RT) followed by 35 μL A/G beads (overnight, 4 °C). Beads were washed (3 × PBS), and bound proteins were eluted (70 μL 1 × Laemmli buffer, 100 °C, 10 min) for WB analysis of SLC31A1-MKRN1 interaction. Input (10% lysate) and IgG controls were included.

In vivo ubiquitination experiment

The cells were spread in a 10 cm dish at the concentration required for the experiment. When the cell density reached 80% ~ 90%, 10 μM/L MG132 was added to the culture dish to treat the cells for 8 h. Collect the cells treated above, centrifuge and add 150 μL of SDS lysis buffer containing protease inhibitor and 1 mM/L DTT (SDS lysis buffer: DTT = 100:1), and boil in a metal bath at 100 °C until the solution is clear and free of sediment. Vortex and mix well while boiling.

The subsequent treatment was the same as the co-immunoprecipitation experiment, and the ubiquitination level of SLC31A1 was analyzed by WB.

Animal study

1. Mutant adenomatous colorectal polyp (Apc) MKRN1 conditional knockout mice were purchased from Saiye Biotechnology Co., Ltd., and they were divided into the following groups: Apc [MU/], Mkrn1 [/, pVillin-Cre], Apc [MU/], and Mkrn1 [flox/flox, pVillin-Cre].

2. Construction of xenograft tumor Models.

   NOD-SCID mice (18 ~ 20 g) were randomly divided into two groups: Vector and OE-MKRN1. Each group was injected with 2 × 10⁶ stably transfected HCT15 cells. Observe the tumor formation and the growth of mice. Two weeks later, the NOD-SCID mice were sacrificed and the tumor tissues were weighed.

Statistical analysis

Data analysis was conducted using Image J and Graphpad Prism 8 software. All measurement data were expressed as mean ± standard deviation. The t-test was used for comparison between the two groups, and a P value < 0.05 was considered statistically significant. Each group of experiments was repeated three times *P < 0.05, ** P < 0.01, *** P < 0.001.

Results

Biological Validation of the Association Between Cuproptosis and MKRN1 in Colorectal Cancer

Cuproptosis, a form of cell death driven by copper ion overload, represents a potential therapeutic strategy for cancer. This study investigated whether MKRN1 regulates cuproptosis in colorectal cancer (CRC). Bioinformatics analysis revealed upregulation of copper transport and homeostasis-related genes in CRC (Fig. 1A), whereas genes encoding cuproptosis-inducing toxic proteins were downregulated. Conversely, negative regulators of cuproptosis, such as CDKN2A and GLS, showed reduced expression in CRC (Fig. 1B). Elevated intracellular copper levels in tumor cells were associated with decreased expression of iron-sulfur cluster protein-encoding genes (FDX1 and DLD) (Fig. 1C).

Fig. 1.

Bioinformatic analysis implicates MKRN1 in cuproptosis regulation in colorectal cancer. A Expression of copper transport-related proteins in CRC. B-C Differential expression analysis of genes encoding cuproptosis-inducing toxic proteins B and negative regulators of cuproptosis C in CRC. D Drug sensitivity correlation analysis from the GDSC database showed that MKRN1 expression was weakly positively correlated with sensitivity to elesclomol (a copper-induced cell death agent) across multiple compounds *P < 0.05, **P < 0.01, ***P < 0.001

MKRN1 is known to be highly expressed in CRC. Our bioinformatics analysis further indicated that in CRC cells, cuproptosis-promoting genes are expressed at low levels, whereas negative regulators are expressed at high levels. Although analysis of the GDSC database revealed a weak positive correlation between MKRN1 mRNA levels and sensitivity to the copper ionophore elesclomol (R = 0.15, FDR < 0.05) (Fig. 1D), the precise role and direction of MKRN1 in cuproptosis remain unclear. Therefore, this study aimed to perform functional validation to elucidate the regulatory relationship between MKRN1 and cuproptosis and explore its potential therapeutic relevance.

MKRN1 Attenuates the Cytotoxic Effects of Cuproptosis Inducers in CRC Cells

Our research group had previously established stable MKRN1-overexpressing and MKRN1-knockdown cell lines in both HCT15 and HT29 CRC cell lines. To investigate the regulatory relationship between MKRN1 and cuproptosis in CRC, we previously established stable MKRN1-overexpressing and MKRN1-knockdown cell lines in both HCT15 and HT29 CRC cells. The efficiency of MKRN1 modulation was confirmed by Western blot analysis (Fig. 2A).

Fig. 2.

MKRN1 attenuates the cytotoxic effects of cuproptosis inducers in CRC cells. A Verification of stable knockdown (shMKRN1) and overexpression (OE-MKRN1) of MKRN1 in HCT15 and HT29 colorectal cancer cell lines using Western blot. GAPDH was used as a loading control. B-C After treatment with ferroptosis inducers for 48 h, the changes in cell death rates upon MKRN1 knockdown/overexpression in HT29 and HCT15 cells were assessed using trypan blue staining and CCK-8 assays. D Representative images of cell death under the above treatment conditions in HCT15 and HT29 cells. E–F Representative images of apoptotic nuclei (brightly stained) observed by Hoechst 33,258 staining after 48 h of ferroptosis inducer treatment. Data are presented as mean ± standard deviation of three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001, compared with the non-intervention MKRN1 regulation group

Functional assessment using trypan blue and Hoechst 33,258 staining revealed that MKRN1 expression levels significantly influenced the cytotoxic effects of cuproptosis inducers. Compared with control cells, MKRN1-overexpressing CRC cells exhibited lower mortality following cuproptosis induction, whereas MKRN1-knockdown cells showed higher mortality under the same conditions (Fig. 2B–E).

Consistently, CCK-8 assays demonstrated that treatment with the cuproptosis inducer (elesclomol + Cu²⁺) substantially inhibited cell proliferation. Notably, MKRN1 overexpression conferred resistance to this growth inhibition, whereas MKRN1 knockdown enhanced sensitivity (Fig. 2F-H).

Collectively, these findings indicate that MKRN1 protects CRC cells from cuproptosis-induced cytotoxicity, thereby promoting tumor progression. Targeting the MKRN1–cuproptosis axis may thus represent a potential therapeutic strategy for CRC.

MKRN1 suppresses expression of cuproptosis markers

Given that cuproptosis is characterized by upregulation of toxic effector proteins (HSP70 and oligomerized DLAT) and destabilization of iron-sulfur cluster proteins following intracellular copper accumulation, we examined the expression levels of key cuproptosis markers (DLAT, FDX1, HSP70, and SLC31A1) in MKRN1-modified cell lines to elucidate the mechanism by which MKRN1 inhibits this process.

Notably, MKRN1 overexpression resulted in: Reduced expression of the cuproptotic effector HSP70; enhanced stability of iron-sulfur cluster protein FDX1; increased monomeric DLAT protein levels; decreased expression of high-affinity copper transporter SLC31A1. Conversely, MKRN1 knockdown produced the opposite effects on these molecular markers (Fig. 3A-D).

Fig. 3.

MKRN1 suppresses the expression of key cuproptosis markers. A-D Western blot analysis of cuproptosis-related proteins in MKRN1-modified HCT15 and HT29 cells. MKRN1 overexpression decreased levels of the toxic effector HSP70 and the copper transporter SLC31A1, while increasing the stability of the iron-sulfur cluster protein FDX1 and monomeric DLAT. MKRN1 knockdown had the opposite effects. GAPDH was used as a loading control. E–F Analysis of DLAT oligomerization, a hallmark of cuproptosis. Cells were fractionated into soluble (monomeric) and insoluble (oligomeric) protein fractions. Western blot shows that MKRN1 overexpression reduced, while MKRN1 knockdown increased, the accumulation of insoluble DLAT oligomers. G Western blot of intestinal tissues from Mkrn1 knockout (KO) mice compared to wild-type (WT) littermates, showing upregulation of pro-cuproptotic proteins (HSP70, SLC31A1) and downregulation of FDX1. Data are mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001

These findings indicate that MKRN1 mediates its anti-cuproptotic effects by coordinately regulating multiple components of the copper-dependent cell death pathway.

Emerging evidence indicates that cuproptosis is an oxidative phosphorylation-dependent process characterized by DLAT oligomerization, which induces mitochondrial dysfunction and subsequent cell death [42]. Recent methodological advances have enabled the detection of oligomerized DLAT through fractionation of soluble and insoluble protein fractions [43].

Our immunoblotting analysis of these fractions revealed that: MKRN1-overexpressing CRC cells exhibited significantly reduced insoluble DLAT oligomers; MKRN1-knockdown cells showed marked accumulation of insoluble DLAT aggregates (Fig. 3E-F).

Complementary in vivo studies using intestinal tissues from MKRN1-knockout mice demonstrated: Upregulation of cuproptosis effector proteins; increased expression of pro-cuptoptotic copper transporters (Fig. 3G).

These findings collectively demonstrate that MKRN1 functions as a critical regulator of DLAT oligomerization and cuproptosis progression through both cellular and organismal mechanisms.

MKRN1 attenuates copper overload in colorectal cancer cells

Copper is an essential trace element, yet its imbalance—whether deficiency or excess—can induce cell death. In cuproptosis, elevated intracellular copper levels disrupt copper homeostasis. To investigate the regulatory role of MKRN1 in this process in colorectal cancer (CRC), we measured copper concentrations in MKRN1-modified CRC cells using a copper assay kit (Fig. 4A-B) and further validated these findings in intestinal tissues from MKRN1-knockout mice (Fig. 4C). Concurrent analysis of glutathione (GSH), an endogenous copper chelator, revealed that MKRN1-overexpressing HCT15 cells exhibited significantly lower copper levels and higher GSH content compared with controls. Conversely, MKRN1-knockdown cells showed marked copper accumulation accompanied by GSH depletion (Fig. 4D). Collectively, these results demonstrate that MKRN1 maintains copper homeostasis in CRC cells through coordinated regulation of intracellular copper levels and GSH-mediated copper buffering capacity.

Fig. 4.

MKRN1 maintains copper homeostasis and prevents copper overload in CRC cells. A Standard curve for the copper ion detection assay. B Intracellular copper ion concentrations measured in HCT15 cells with MKRN1 knockdown or overexpression. C Copper levels in intestinal tissues from Mkrn1 KO and WT mice. D Intracellular glutathione (GSH) levels, a major copper chelator, in MKRN1-modified HCT15 cells. MKRN1 overexpression correlated with lower copper and higher GSH levels, indicating effective copper buffering. Data are mean ± SD from three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001

MKRN1 Interacts with and Regulates SLC31A1 Localization

Our findings indicate that MKRN1 modulates intracellular copper levels in CRC cells, potentially through regulation of copper transport. Western blot analysis revealed reduced expression of copper transporters in MKRN1-overexpressing cells, whereas their expression increased upon MKRN1 knockdown. Given the known E3 ubiquitin ligase activity of MKRN1, we sought to identify its potential ubiquitination substrates. Bioinformatics analysis of TCGA data revealed elevated SLC31A1 mRNA expression in CRC tissues; however, protein expression analysis from the Human Protein Atlas (HPA) showed low or absent SLC31A1 protein levels (Fig. 5A-B), suggesting post-translational regulation of SLC31A1 in CRC. Immunohistochemical validation in intestinal tissues from conditional MKRN1-knockout mice confirmed upregulation of SLC31A1 protein expression (Fig. 5C), consistent with the bioinformatics findings. Collectively, these results strongly suggest that SLC31A1 undergoes MKRN1-mediated ubiquitination and subsequent degradation in colorectal cancer. To determine whether MKRN1 regulates SLC31A1 expression via ubiquitination, we first examined their subcellular localization by confocal microscopy. MKRN1 (green) was distributed in both the nucleus and cytoplasm, whereas SLC31A1 (red) predominantly localized to the plasma membrane (Fig. 5D). As a transmembrane transporter, SLC31A1 forms cytoplasmic dimers that subsequently trimerize to facilitate membrane localization and copper transport activity.

Fig. 5.

MKRN1 physically interacts with and regulates the subcellular localization of SLC31A1. A SLC31A1 mRNA is upregulated in TCGA CRC tumors. B Representative images from the Human Protein Atlas show low or undetectable SLC31A1 protein in clinical CRC specimens. C Immunohistochemistry confirms increased SLC31A1 protein expression in intestinal tissues of Mkrn1 KO mice. Scale bar, 50 µm. D Immunofluorescence co-localization in HCT15 cells shows MKRN1 (green) distributed in the nucleus and cytoplasm, while SLC31A1 (red) primarily localizes to the plasma membrane. Nuclei are stained with DAPI (blue). Scale bar, 10 µm. E–F Subcellular localization of SLC31A1 (red) in HT29 cells upon MKRN1 knockdown. MKRN1 depletion enhances SLC31A1 membrane localization. Scale bar, 20 µm. G-H Co-immunoprecipitation (Co-IP) assays confirm a direct interaction. G Endogenous MKRN1 co-precipitates with SLC31A1. H Exogenously expressed Flag-MKRN1 and Myc-SLC31A1 interact in 293 T cells. I-J qRT-PCR analysis confirms that MKRN1 modulation does not affect SLC31A1 mRNA levels, indicating post-transcriptional regulation. Data are mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001)

Notably, MKRN1 knockdown enhanced the membrane localization of SLC31A1 (Fig. 5E–F), suggesting that MKRN1 regulates its trafficking. Reciprocal co-immunoprecipitation (Co-IP) assays using both endogenous and exogenous proteins confirmed a direct interaction between MKRN1 and SLC31A1 (Fig. 7G–H). PCR analysis excluded transcriptional regulation, indicating that this interaction occurs at the post-translational level (Fig. 7I–J).

Fig. 7.

MKRN1 protects mitochondria from cuproptosis-induced damage. A Gene Ontology (GO) enrichment analysis of differentially expressed proteins upon MKRN1 knockdown, highlighting significant association with mitochondrial respiratory chain and oxidative phosphorylation complexes. B-C JC-1 staining to assess mitochondrial membrane potential (ΔΨm). Red fluorescence indicates aggregated JC-1 (high ΔΨm), green indicates monomeric JC-1 (low ΔΨm). MKRN1 overexpression increases the red/green ratio, while knockdown decreases it. Scale bar, 20 µm. (D-E) JC-1 staining after treatment with the cuproptosis inducer (Elesclomol + Cu.²⁺). MKRN1 overexpression mitigates the loss of ΔΨm, while knockdown exacerbates it. (F-G) Representative transmission electron microscopy images of HCT15 cells. MKRN1 overexpression preserves mitochondrial cristae structure and prevents swelling following cuproptosis inducer treatment. Scale bars: 500 nm (F), 200 nm (G). (H–K) Western blot analysis shows that MKRN1 overexpression upregulates (H-I), while MKRN1 knockdown downregulates (J-K), the expression of Tomm20, a key component of the mitochondrial import receptor complex. Data are mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001

MKRN1 Promotes K63 and K48 chains of Ubiquitin to SLC31A1 and break it down

Given that MKRN1 overexpression downregulates SLC31A1 protein expression, we performed dose-dependent MKRN1 overexpression in HCT15 cells. Western blot analysis revealed a progressive decrease in SLC31A1 levels corresponding to increasing MKRN1 expression (Fig. 6A). Treatment with the proteasome inhibitor MG132 rescued MKRN1-induced SLC31A1 degradation (Fig. 6B), confirming proteasome-dependent regulation.

Fig. 6.

MKRN1 Promotes K63 and K48 chains of Ubiquitin to SLC31A1 and break it down. A Dose-dependent reduction of SLC31A1 protein levels with increasing MKRN1 overexpression in HCT15 cells. B The proteasome inhibitor MG132 (10 µM, 8 h) rescues MKRN1-induced SLC31A1 degradation. C-D Cycloheximide (CHX, 100 µg/mL) chase assays demonstrate that MKRN1 knockdown extends (C), while MKRN1 overexpression shortens (D), the half-life of SLC31A1 protein. (E–F) In vivo ubiquitination assays. G Specific ubiquitin linkage analysis. Co-expression of MKRN1 with various linkage-specific ubiquitin mutants (K11-only, K48-only, K63-only) in 293 T cells reveals that MKRN1 mediates both K48 and K63-linked polyubiquitination of SLC31A1

To further characterize this regulation, we examined SLC31A1 protein stability using cycloheximide (CHX) chase assays. MKRN1 knockdown significantly prolonged SLC31A1 half-life (Fig. 6C), while MKRN1 overexpression accelerated its degradation (Fig. 6D). Ubiquitination assays demonstrated enhanced SLC31A1 polyubiquitination upon MKRN1 overexpression (Fig. 6E) and reduced ubiquitination following MKRN1 knockdown (Fig. 6F).

These results demonstrate that MKRN1 mediates SLC31A1 ubiquitination, a post-translational modification that targets SLC31A1 for proteasomal degradation, thereby dynamically regulating SLC31A1 protein stability in colorectal cancer cells.Polyubiquitination involves the sequential attachment of ubiquitin molecules through specific lysine residues (e.g., K48 or K63), which determines whether the modified protein undergoes proteasomal degradation or participates in signaling pathways. To characterize the specific ubiquitin linkage mediated by MKRN1, we co-transfected cells with Myc-SLC31A1, FLAG-MKRN1, and plasmids encoding different ubiquitin chain types (K48-only or K63-only). Western blot analysis revealed that MKRN1 induces both K48-linked and K63-linked polyubiquitination of SLC31A1 (Fig. 6E). Subsequent experiments using lysine-to-arginine mutant ubiquitin constructs (K63R) demonstrated that the K63R mutation significantly attenuated SLC31A1 ubiquitination (Fig. 6F), indicating that MKRN1 primarily mediates K63-linked polyubiquitination of SLC31A1. These findings indicate that MKRN1 mainly regulates SLC31A1 levels in colorectal cancer through K63- and K48-linked ubiquitination and degradation, thereby controlling intracellular copper levels and the subsequent occurrence of cuproptosis.

MKRN1 inhibits cuproptosis by mitigating mitochondrial damage through stabilization of Tomm20

To explore the role of MKRN1 in cuproptosis, differential gene expression analysis was performed following MKRN1 knockdown. Functional enrichment analysis revealed that the differentially expressed genes were primarily associated with mitochondrial respiratory chain complexes, oxidative phosphorylation enzymes, cytochrome c oxidase, and the tricarboxylic acid (TCA) cycle (Fig. 7A).

Given that cuproptosis is a mitochondria-dependent cell death process linked to the TCA cycle, mitochondrial membrane potential (ΔΨm) was assessed using JC-1 staining. MKRN1 overexpression in colorectal cancer cells increased mitochondrial membrane potential, whereas MKRN1 knockdown decreased it (Fig. 7B-C).

To further examine whether MKRN1 regulates cuproptosis, cells were treated with a cuproptosis inducer. MKRN1 overexpression reduced JC-1 green monomer formation, while MKRN1 knockdown enhanced JC-1 green monomer accumulation upon cuproptosis induction (Fig. 7D-E). Our ultrastructural analysis by transmission electron microscopy demonstrated that MKRN1 overexpression significantly prevented mitochondrial swelling and preserved cristae integrity (Fig. 7F-G) in CRC cells, even under cuproptosis inducer challenge. At the molecular level, immunoblotting quantification revealed that MKRN1 overexpression robustly enhanced Tomm20 protein expression (Fig. 7H-I), whereas MKRN1 depletion markedly reduced Tomm20 levels (Fig. 7J-K), establishing a clear dose-dependent relationship between MKRN1 expression and this key mitochondrial import receptor.

Validation of SLC31A1 knockdown and overexpression efficiency

To investigate the involvement of SLC31A1 in MKRN1-mediated regulation of cuproptosis in CRC, rescue experiments were performed. HCT15 and HT29 colorectal cancer cells were transfected with either SLC31A1 overexpression or knockdown plasmids, followed by validation of transfection efficiency (Fig. 8A-D).

Fig. 8.

Validation of SLC31A1 knockdown and overexpression efficiency. A-B Western blot (A) and quantification (B) confirming efficient overexpression of SLC31A1 (OE-SLC31A1) in HCT15 cells. C-D Western blot (C) and quantification (D) confirming efficient knockdown of SLC31A1 using a specific shRNA (sh-SLC31A1) in HT29 cells. Data are mean ± SD (n = 3). ***p < 0.001

MKRN1 regulates mitochondrial function in CRC cells through ubiquitin-mediated degradation of SLC31A1

To elucidate the mechanistic relationship between MKRN1 and SLC31A1, we performed rescue experiments in CRC cells with either MKRN1 overexpression or knockdown (using sh1 sequence). Mitochondrial functional alterations were assessed through: (1) JC-1 staining for ΔΨm measurement (Fig. 9A-B), and (2) immunoblotting analysis of the mitochondrial protective protein Tomm20 (Fig. 9C-D).

Fig. 9.

MKRN1 regulates mitochondrial function through SLC31A1. A In HCT15 cells, overexpression of SLC31A1 (OE-SLC31A1) reversed the increase in mitochondrial membrane potential induced by MKRN1 overexpression (OE-MKRN1). B In HT29 cells, knockdown of SLC31A1 (sh-SLC31A1) rescued the decrease in mitochondrial membrane potential induced by MKRN1 knockdown (sh-MKRN1). Scale bar, 20 µm. C Co-overexpression of SLC31A1 reversed the stabilizing effect of MKRN1 on Tomm20 protein levels. D Co-knockdown of SLC31A1 reversed the decrease in Tomm20 expression caused by MKRN1 knockdown. Data are presented as mean ± standard deviation (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant

MKRN1 inhibits cuproptosis in CRC cellsviaubiquitin-mediated degradation of SLC31A1

To further investigate the role of MKRN1 in regulating cuproptosis, rescue experiments were performed using Hoechst 33,258 staining (Fig. 10A-B) and trypan blue exclusion assay (Fig. 10C-D) to assess cell death. The results showed that the increased mortality induced by MKRN1 knockdown was reversed by concurrent SLC31A1 knockdown, while the reduced cell death caused by MKRN1 overexpression was abrogated by SLC31A1 co-overexpression.

Fig. 10.

The MKRN1-SLC31A1 axis governs sensitivity to cuproptosis. A SLC31A1 overexpression reverses the reduction in cell death conferred by MKRN1 overexpression. B SLC31A1 knockdown reverses the increase in cell death caused by MKRN1 knockdown. Scale bar, 50 µm. C-D Trypan blue exclusion assay quantifying cell viability. E-F Western blot analysis of the cuproptosis effector protein HSP70. MKRN1 overexpression suppresses HSP70 induction, which is restored by SLC31A1 co-overexpression (E). Conversely, MKRN1 knockdown enhances HSP70, which is attenuated by SLC31A1 co-knockdown (F). Cells were treated with Elesclomol + Cu²⁺ for 24–48 h where applicable. Data are mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant

Immunoblot analysis revealed that MKRN1 overexpression suppressed the accumulation of toxic proteins during cuproptosis, an effect that could be counteracted by SLC31A1 overexpression (Fig. 10E-F). Conversely, the enhanced toxic protein expression resulting from MKRN1 knockdown was attenuated by SLC31A1 knockdown.

These findings demonstrate that MKRN1-mediated degradation of SLC31A1 represents a critical regulatory mechanism that inhibits cuproptosis, maintains mitochondrial function, and consequently promotes CRC progression.

MKRN1 inhibits cuproptosis and promotes CRC progressionin vivothrough SLC31A1 suppression

To validate the physiological relevance of MKRN1-mediated SLC31A1 regulation, we performed subcutaneous xenograft experiments using HCT15 CRC cells stably overexpressing MKRN1 or control vector. Tumor growth was monitored for two weeks before sacrifice and tumor collection (Fig. 11A-D). Immunohistochemical analysis and Western blotting of tumor tissues revealed that MKRN1 overexpression significantly reduced SLC31A1 expression while suppressing cuproptosis markers (Fig. 11E–G). Collectively, these in vivo findings confirm that MKRN1 promotes CRC progression through ubiquitin-dependent degradation of SLC31A1, thereby inhibiting cuproptosis and preserving mitochondrial function within the tumor microenvironme.nt.

Fig. 11.

MKRN1 promotes tumor growth and suppresses cuproptosis in vivo. A Representative images of NOD-SCID mice bearing subcutaneous xenografts of HCT15 cells stably expressing Vector or OE-MKRN1, two weeks after injection. B Excised tumor specimens from each group. C-D Quantitative analysis of final tumor weight (C) and volume (D) shows that MKRN1 overexpression significantly promotes tumor growth. (E) Immunohistochemical staining of xenograft tumor sections for MKRN1 and FDX1. MKRN1-overexpressing tumors exhibit higher MKRN1 and preserved FDX1 expression. Scale bar, 50 µm. (F-G) Western blot (F) and quantification (G) of FDX1 and MKRN1 protein levels in tumor lysates, consistent with IHC results. Data are mean ± SD (n = 5 mice per group). *P < 0.05, **P < 0.01.)

MKRN1 promotes colorectal cancer progression by suppressing cuproptosis through SLC31A1 degradation

Elesclomol acts as a copper ionophore that facilitates extracellular Cu²⁺ transport across the plasma membrane independently of canonical copper transporters such as CTR1. Once internalized, it elevates bioavailable copper levels, thereby inducing cuproptosis (Fig. 12).

Fig. 12.

Schematic model of the proposed mechanism

In summary, our findings demonstrate that MKRN1 regulates copper homeostasis in colorectal cancer cells by mediating ubiquitin-dependent degradation of SLC31A1. This mechanism prevents copper overload-induced pathological effects, including iron-sulfur cluster depletion, DLAT oligomerization, HSP70 upregulation, and mitochondrial dysfunction characterized by loss of membrane potential. Collectively, these results establish MKRN1 as a critical regulator of copper metabolism that promotes colorectal cancer progression by inhibiting SLC31A1-mediated cuproptosis.

In colorectal cancer cells, high expression of the E3 ubiquitin ligase MKRN1 promotes the polyubiquitination of SLC31A1 and subsequent proteasomal degradation of the copper influx transporter SLC31A1. This reduces SLC31A1 localization at the plasma membrane, limiting copper ion uptake and preventing intracellular copper overload. Consequently, key cuproptosis events are suppressed: mitochondrial damage (loss of ΔΨm and Tomm20 downregulation) is mitigated, iron-sulfur cluster proteins (e.g., FDX1) remain stable, and toxic protein aggregation (DLAT oligomerization and HSP70 induction) is inhibited. This axis enables cancer cells to evade copper-induced cell death, thereby promoting tumor progression. Targeting the MKRN1/SLC31A1 ubiquitination axis may therefore represent a therapeutic strategy to restore cuproptosis sensitivity.

Discussion

Colorectal cancer (CRC) remains one of the most prevalent malignancies of the digestive tract and a leading cause of cancer-related mortality worldwide [44]. As the second deadliest cancer in the United States [45] CRC ranks third in incidence among males and second among females globally, accounting for approximately 900,000 annual deaths [46].Despite advances in screening and treatment, CRC continues to pose substantial clinical challenges due to its high incidence, mortality, and metastatic potential. Elucidating the molecular mechanisms underlying CRC pathogenesis is therefore essential for early detection, prognosis evaluation, and the development of novel therapeutic strategies.

Recent progress in CRC biomarker discovery has revealed that dysregulation of E3 ubiquitin ligases can lead to aberrant degradation or functional alteration of key proteins involved in cell cycle regulation, apoptosis, DNA repair, and metastatic signaling pathways [47]. These findings highlight the potential of targeting the ubiquitin–proteasome system for developing innovative anti-tumor strategies.

Copper homeostasis plays a dual role in cellular physiology and tumor biology. Although essential for normal cellular functions, excessive copper accumulation induces cytotoxicity through a recently identified cell death mechanism termed cuproptosis [36]. This process involves copper overload-mediated binding to lipoylated components of the tricarboxylic acid (TCA) cycle, leading to protein aggregation, loss of iron-sulfur cluster proteins, and subsequent proteotoxic stress [11]. Notably, cancer cells reliant on mitochondrial respiration exhibit heightened sensitivity to copper-induced cytotoxicity; for instance, NCI-H2030 lung cancer cells display nearly 1,000-fold greater susceptibility to elesclomol-Cu²⁺ when cultured in galactose versus glucose [42]. This highlights the therapeutic potential of cuproptosis induction in malignancies characterized.

Our investigation revealed elevated copper levels in CRC cells compared to normal counterparts, with MKRN1 overexpression significantly reducing intracellular copper concentrations. This observation suggests that MKRN1 maintains copper homeostasis within a physiological range, thereby conferring resistance to cuproptosis inducers. Mechanistically, we identified SLC31A1, a high-affinity copper transporter [9], as a key substrate of MKRN1-mediated ubiquitination. Through comprehensive biochemical and functional assays, we demonstrated that MKRN1 regulates cellular sensitivity to elesclomol by controlling SLC31A1 protein stability. Genetic rescue experiments confirmed that SLC31A1 knockdown reverses the enhanced cuproptosis sensitivity induced by MKRN1 depletion, while SLC31A1 overexpression abolishes MKRN1-mediated resistance.

In the early phase of this study, analysis of the GDSC database revealed a weak positive correlation between MKRN1 mRNA expression and sensitivity to elesclomol (Fig. 1D), suggesting a potential role for MKRN1 in cuproptosis regulation. However, subsequent functional experiments demonstrated that MKRN1 overexpression inhibited elesclomol-induced cuproptosis, whereas MKRN1 knockdown enhanced it. This apparent discrepancy can be explained by several factors. First, the GDSC analysis was based on mRNA levels, whereas MKRN1 primarily regulates SLC31A1 at the protein level via ubiquitin-mediated degradation; thus, mRNA and protein expression may not be concordant. Second, as a copper ionophore, elesclomol exerts cytotoxicity through multiple mechanisms, with cuproptosis representing only one of them; consequently, cellular sensitivity to elesclomol may reflect the integration of cuproptosis and other pathways. Third, TCGA data revealed marked discordance between SLC31A1 mRNA and protein expression in colorectal cancer, supporting a predominant role for post-translational regulation in copper metabolism. Collectively, our mechanistic findings indicate that MKRN1 suppresses cuproptosis by promoting ubiquitin-dependent degradation of SLC31A1, thereby uncovering a complex regulatory network underlying the initial bioinformatic correlation.

Consistent with established cuproptosis mechanisms, MKRN1 overexpression protected mitochondrial integrity against copper-induced damage, as evidenced by preserved membrane potential and cristae morphology. Conversely, these protective effects were negated by SLC31A1 co-overexpression. In vivo studies further validated the tumor-promoting function of MKRN1, with xenograft models showing increased FDX1 expression in MKRN1-overexpressing tumors, indicative of preserved iron-sulfur cluster proteins and suppressed proteotoxic stress.

In conclusion, our study establishes MKRN1 as a critical regulator of copper homeostasis that promotes CRC progression through ubiquitin-dependent degradation of SLC31A1. This molecular axis maintains sub-toxic copper levels and confers resistance to cuproptosis inducers, suggesting that targeted disruption of the MKRN1/SLC31A1 interaction may represent a promising therapeutic strategy. Future investigations will explore combinatorial approaches integrating cuproptosis inducers with conventional CRC therapies, with the aim of enhancing treatment efficacy through MKRN1 modulation.

While the E3 ligase NEDD4L has been reported to ubiquitinate SLC31A1, our work uncovers a distinct regulatory axis mediated by MKRN1. Notably, we identify K63-linked polyubiquitination as the primary mechanism, which often directs substrates for lysosomal degradation or signal modulation rather than canonical proteasomal degradation, suggesting a novel layer of regulation in copper transporter turnover.

Our findings posit the MKRN1/SLC31A1 interface as a ‘druggable’ node. Therapeutic strategies could include the development of small-molecule inhibitors that disrupt the MKRN1-SLC31A1 interaction, or PROTACs (proteolysis-targeting chimeras) designed to selectively degrade MKRN1 in CRC cells. Such approaches would be predicted to stabilize SLC31A1, sensitize tumors to existing cuproptosis inducers like elesclomol, and potentially reverse chemoresistance.

Limitations and future perspectives

Our study establishes MKRN1 as a critical regulator of copper homeostasis in CRC through ubiquitin-dependent degradation of SLC31A1, yet several aspects require further investigation. Although we demonstrated that MKRN1 overexpression promotes tumor progression in vivo, its role in conferring resistance to copper-mediated therapies remains to be validated in animal models. Additionally, the precise molecular mechanisms governing MKRN1's substrate specificity and ubiquitination of SLC31A1 warrant deeper exploration, potentially through structural studies to map critical interaction domains.

We acknowledge that our mitochondrial data are largely correlative; direct measurements of OCR, ATP, TCA activity, and ROS, as well as the functional role of TOMM20, await future investigation.

We acknowledge that the in vivo evidence presented here is limited. Although MKRN1 knockdown intestinal tissues and MKRN1-overexpressing xenografts consistently support the role of MKRN1 in suppressing cuproptosis via SLC31A1, future studies using conditional knockout mice in an APC-driven spontaneous colorectal cancer model will be necessary to fully address the physiological relevance of this axis in tumorigenesis. Technical difficulties in xenograft establishment also highlight the need for more robust models in follow-up investigations.

Future research should focus on translating these findings into therapeutic applications, including the development of MKRN1-targeted strategies to sensitize CRC cells to cuproptosis inducers. The clinical relevance of MKRN1 expression as a predictive biomarker for copper-based therapies also merits investigation. Furthermore, given the emerging role of copper metabolism in cancer biology, exploring whether this regulatory axis extends to other malignancies could broaden the potential therapeutic implications. Addressing these questions will advance our understanding of copper-dependent cell death mechanisms and may lead to novel treatment paradigms for CRC and beyond.

Although we have not performed in vivo combination therapy or clinical dataset analyses, our identification of the MKRN1/SLC31A1 axis as a cuproptosis regulator provides a rationale for future translational studies, including testing MKRN1 depletion with elesclomol in animal models and evaluating its prognostic value in CRC cohorts.

Authors’ contribution

Acknowledgements The authors thank all contributors for their valuable roles in this work. Huali Luo contributed to writing the original draft, visualization, validation, software, methodology, investigation, formal analysis, data curation, and conceptualization. Jiaxin Hu participated in writing – review and editing, investigation, formal analysis, and conceptualization. Xiaojing Lin contributed to visualization, validation, software, methodology, and formal analysis. Shu Zhao provided methodology, investigation, and formal analysis. Mengxing Li and Qinshan Li jointly supervised the project, contributed to writing – review and editing, and were responsible for resources, project administration, funding acquisition, and conceptualization. All authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

This study was supported by the National Natural Science Foundation of China (10.13039/501100001809) (81960476, 81460365, and 81760039), Guizhou Provincial Key Laboratory for Digestive System Diseases (Grant qiankehepingtai-ZSYS (2025)021).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This study was reviewed and approved by the Ethics Committee of Guizhou Medical University (No. 2403612). For the retrospective clinical data analysis, the requirement for informed consent was waived due to the use of anonymized patient records. All animal experiments were conducted in accordance with ethical guidelines and were approved by the Animal Welfare of Guizhou Medical University.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.