Dual targeting of interlocked PTK2B and MAPK signaling triggers synergistic ferroptosis via autophagic flux disruption in BRAF^V600E glioma

Abstract

Background

BRAF^V600E mutation is one of the most common oncogenic drivers in gliomas, sharing the highest incidence in pediatric low-grade gliomas (~ 20%) and being frequently associated with poor prognosis. Although combination therapies targeting both BRAF^V600E and downstream MAPK signaling have been developed, their efficacy is substantially limited by acquired drug resistance. Consequently, identifying the underlying mechanisms of resistance and novel therapeutic vulnerabilities remains an urgent need.

Methods

Using patient gene expression profiles, immunohistochemistry on glioma samples, glioma cell lines, and a Drosophila glioma model, we identified Protein Tyrosine Kinase 2 Beta (PTK2B) as a druggable vulnerability in BRAF^V600E glioma. Loss-of-function studies were achieved by PTK2B knockdown in DBTRG-05MG cells and Fak knockout in Drosophila, assessing effects on tumor survival/proliferation. The underlying signaling mechanisms were investigated using RNA sequencing, proteomics and a suite of assays (e.g., Western blot, immunofluorescence, flow cytometry). Finally, the reciprocal compensatory mechanism between PTK2B and MAPK signaling was established in both cellular and Drosophila models, and the synergistic effect of their co-inhibition was validated in DBTRG-05MG and AM-38 cells.

Results

PTK2B and its Drosophila orthologue Focal adhesion kinase (Fak) are highly expressed in BRAF^V600E/dRaf^GOF glioma, and their inhibition significantly suppresses tumor growth. Our studies revealed that PTK2B knockdown triggers potent ferroptosis in glioma cells through endoplasmic reticulum stress-induced autophagic flux disruption, a mechanism which is partially overlapped with the cell death induced by MAPK signaling inhibition. We uncovered the interlocking mechanism between highly expressed PTK2B and hyperactive MAPK signaling in BRAF^V600E glioma, wherein suppression of either one prompts compensatory upregulation of the other, thereby attenuating tumor cell death under the stress. Simultaneous inhibition of PTK2B and MAPK signaling achieves strong synergistic anti-tumor effect, highlighting the therapeutic promise of this combination strategy.

Conclusions

Our findings establish PTK2B as a critical regulator and co-targetable vulnerability in BRAF^V600E glioma. We delineate a novel interlocking mechanism wherein PTK2B and MAPK engage in reciprocal negative feedback regulation, enabling adaptive resistance. This work provides a compelling mechanistic rationale for co-targeting PTK2B and MAPK to disrupt this survival axis and overcome therapeutic resistance.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12964-026-03045-1.

Introduction

BRAF, a serine/threonine kinase in the MAPK signaling pathway, is mutated in nearly 7% of human cancers [1, 2]. The BRAF^V600E mutation (c.1799T > A), where valine substitutes glutamate at residue 600, accounts for about 90% of BRAF mutations in tumors (Fig. S1a) [2]. This mutation induces constitutive, RAS-independent monomeric activation of BRAF, resulting in hyperactive MAPK signaling and uncontrolled tumor growth [1, 3]. The BRAF^V600E mutation is frequently detected in gliomas, demonstrates the highest incidence in pediatric low-grade gliomas (pLGGs, ~ 20%), and is associated with a worse prognosis compared to wild-type cases [4, 5]. Targeted therapies using BRAF inhibitors (e.g., Dabrafenib) alone or in combination with MEK inhibitors (e.g., Trametinib) are clinically approved [6, 7]. However, resistance primarily driven by paradoxical MAPK reactivation frequently leads to relapse, creating an urgent need for new therapeutic approaches [8, 9].

Protein Tyrosine Kinase 2 Beta (PTK2B/PYK2), a FAK-family non-receptor tyrosine kinase (nRTK), is distinctively activated by Ca²⁺ and highly expressed in the central nervous system [10–12]. As reported, PTK2B is upregulated in diverse malignancies, contributing to tumor progression and poor prognosis [13]. In glioma, PTK2B promotes proliferation, migration, invasion, Temozolomide resistance and recurrence through multiple molecular mechanisms [14–17], but its role in BRAF^V600E glioma and its functional relationship to MAPK signaling remain insufficiently defined.

Fak, the conserved Drosophila ortholog of human PTK2B (Fig. S1b), is a validated tumor regulator in Drosophila glioma models [18, 19]. A Fak-MAPK regulatory axis has been described in Drosophila epithelial tumors, echoing PTK2B-dependent mechanisms in humans [20]. The dRaf gain-of-function (dRaf^GOF) line harbors a deletion of residues 2-431 that disrupts the autoinhibitory domain, resulting in constitutive kinase activation (Fig. S1c) [21]. Glial-specific dRaf^GOF overexpression generates fly glioma model that mimics pLGGs [18], enabling in vivo genetic dissection aligned with mammalian systems.

Multiple stress-response networks critically govern glioma viability. Endoplasmic reticulum (ER) stress, triggered by proteotoxic imbalance [22], activates the adaptive unfolded protein response (UPR) to restore proteostasis [23]; its failure induces cell death [24]. ER stress contributes to oncogenesis and therapy responses across diseases, including glioma [25, 26]. Such stress can disrupt autophagic flux, a conserved lysosomal degradation process that maintains cellular homeostasis [27], thereby causing toxic accumulation and ultimate cell death [28]. Notably, autophagy serves as a key regulator of ferroptosis [29], an iron-dependent, lipid peroxidation-driven programmed cell death distinct from apoptosis and necrosis [30, 31]. By releasing Fe²⁺ and exacerbating lipid peroxidation through ferritinophagy [32] or impaired autophagy [33], ferroptosis, especially autophagy-dependent ferroptosis has been reported mechanistically associated with cancer [34, 35], representing a promising therapeutic target in glioma.

In this study, we uncovered an interlocking mechanism between PTK2B and MAPK signaling in BRAF^V600E glioma. PTK2B was highly expressed in BRAF^V600E glioma, and its knockdown significantly suppressed tumor growth via an ER stress-autophagic flux disruption-ferroptosis axis. These findings were recapitulated in a Drosophila dRaf^GOF glioma model, where Fak, the PTK2B ortholog, was also upregulated, and its knockout substantially attenuated tumor progression. Highly expressed PTK2B and hyperactive MAPK signaling pathway work together to effectively sustain BRAF^V600E glioma proliferation through partially overlapped mechanisms. Inhibition of either one triggered compensatory upregulation of the other, whereas simultaneous inhibition of them induced maximal ferroptosis. In summary, our results establish PTK2B as a promising target in BRAF^V600E glioma and support dual PTK2B/MAPK inhibition as a superior therapeutic strategy.

Materials and methods

Samples from patients and immunohistochemistry

Paraffin embedded sections of glioma samples from ten patients were obtained from the Children’s Hospital, Zhejiang University School of Medicine. Anti-PTK2B was used to stain these sections. Slides were subsequently imaged with a Nikon ECLIPSE 80i microscope.

Drosophila stocks

The Gal4/UAS system was applied for Drosophila genetic engineering in this study [36]. Fly stocks used in this study are listed as following: w1118 (THJ025) as wild-type was purchased from Tsinghua Drosophila center; repo-Gal4 was a gift from Prof. Shujun He; UAS-Raf^GOF (2033), UAS-Fak (600482) were purchased from the Bloomington Drosophila Stock Center; dFak^ko was gift from Prof. Renjie Jiao. All flies were kept at 25 °C with standard cornmeal/yeast/agar medium. Late 3rd instar larvae were collected for studies unless otherwise stated.

Drosophila genotypic identification

To extract fly genomic DNA, individual adult Drosophila were flash-frozen at -80 °C. Each fly was homogenized in 100 µL lysate buffer (formulated from 0.1 M Tris-HCl, 0.1 M EDTA, 0.1 M NaCl and 2% SDS) by pipetting, followed by incubation at 65 °C for 30 min. Next, 200 µL freshly prepared LiCl/KAc solution (4.3 M LiCl and 1.4 M KAc mixed in equal volumes) was added and incubated on ice for 10 min. After centrifugation (12,000 × g, 4 °C, 15 min), mixed the supernatant with 250 µL Isopropanol, and incubated at room temperature (RT) for 10 min. Following centrifugation (12,000 × g, 4 °C, 20 min), the pellet was washed with 500 µL 75% Ethanol, centrifuged again (12,000 × g, 4 °C, 5 min), and air-dried. DNA was dissolved in 20 µL deionized water. Reagents used in this experiment are listed below: Tris-HCl (Vetec, V900312), EDTA (Hushi, 10009717), NaCl (Hushi, 10019318), SDS (Aladdin, S108347), LiCl (Hushi, 20022961), KAc (Hushi, 30154518).

To amplify the gene to be identified from genomic DNA, 2×Taq MasterMix (Dye) (CWBIO, CW0682M) and ProFlex PCR system (Life technologies, 4483636) were used following the manufacturer’s instructions. Primers used in this study (constructed by SUNYA Biotech, China, Zhejiang) are listed below. Fak: forward: AAGGAGGTGATTTGGCTGGC, reverse: TGGCTTTGATGTGGCTATCACAG.

Cell culture

DBTRG-05MG (CTCC-001-0711), T98G (CTCC-001-0047) and U-251 MG (CTCC-400-0022) cells were purchased from Meisen BioTech (Zhejiang, China). HEK293T was a gift from Prof. Hongqing Liang. The four cells were cultured in high-glucose Dulbecco’s Modified Eagle Medium (DMEM) (BasalMedia, L110KJ) supplemented with 10% fetal bovine serum (FBS) (Excell bio, FSP500) and 1% Penicillin-Streptomycin (PS) (BasalMedia, S110JV). AM-38 (YS3265C) cell was purchased from Yaji BioTech (Shanghai, China) and cultured in Eagle’s Minimum Essential Medium (EMEM) (Yaji, EM101) supplemented with 20% FBS and 1% PS. All cells were maintained at 37 °C with 5% CO₂ in an CO₂ incubator (ESCO Lifesciences, CCL-170B-8), and were passaged every 2–3 days. For AM-38 cells, which exhibit weak adherence, all culture dishes and plates were pre-coated with Poly-D-lysine (Sangon Biotech, E607014) at 0.1 mg/mL overnight at 37 °C, followed by three washes with PBS prior to cell seeding for routine maintenance and all experimental procedures. Each cell line was authenticated by short tandem repeat (STR) profiling and routinely screened to confirm the absence of mycoplasma contamination.

Lentivirus production and cell transfection

Lentiviral particles for PTK2B knockdown were generated by transfecting HEK293T cells with pLKO.1-shRNA-2 A-PURO, psPAX2 and pMD2.G at a ratio of 4:3:1 with Lipo8000 Transfection Reagent (Beyotime, C0533). Two pieces of shRNA targeting PTK2B and the negative control shRNA were constructed by Tsingke Biotech (Beijing, China) with sequences as follows. sh-PTK2B-1: CGTATCCTCAAGGTCTGCTTC, sh-PTK2B-2: ATGGACATGGCAGGCCGATTT, sh-NC: CGTGACACGTTCGGAGAACC. psPAX2 and pMD2.G were gifts from Dr. Jing Wang.

Briefly, HEK293T cells at 60% confluence were transfected with specific plasmids (shRNA, psPAX2 and pMD2.G) at the specified ratio. Six hours post-transfection, the old medium was replaced with viral harvest medium (DMEM supplemented with 5% FBS). After 48 h of transfection, viral supernatant was collected and concentrated using the Universal Virus Concentration Kit (Beyotime, C2901M) according to the manufacturer’s protocol. For lentivirus infection, virus was added when the confluence of DBTRG-05MG cells reach about 60% with 8 µg/ml polybrene (Beyotime, C0351) for 48 h, and then selected with 2 µg/ml puromycin (Beyotime, ST551) for 7 days.

The PTK2B overexpression plasmid (Hanheng Biotech, pHBLP001813-plasmid) was constructed using the pcDNA3.1-CMV-MCS-3flag-EF1-ZsGreen-T2A-Puro vector, encoding the human PTK2B cDNA corresponding to transcript variant NM_004103 (NCBI Reference Sequence). Transfection was performed using Lipo8000 Transfection Reagent.

Reverse transcription quantitative PCR (RT-qPCR)

Total RNA was extracted from fly brain lobes or cultured cells using TRIzol reagent (Ambion, 340312). Following measurement of RNA concentration and purity using NanoDrop 2000 (Thermo Fisher Scientific), cDNA was synthesized by RNA reverse transcription according to the manufacturer’s instructions using ABScript Neo RT master mix (ABclonal Technology, RK20433). Subsequently, real-time PCR was performed on a LineGene9600 system using SYBR qPCR master mix (Vazyme, Q711-02). Relative mRNA expression levels were calculated using the 2^−ΔΔCt method and normalized to rp49 (fly) or GAPDH (cell). Primers used in this study are listed below. rp49: forward: GCTAAGCTGTCGCACAAA, reverse: TCCGGTGGGCAGCATGTG. Fak: forward: GGAGACCGTTTTCCATGTGAT, reverse: AGTGCTTCTAGCCAGCCAAAT. dRaf: forward: GAGGAAAACTGGAATATTCTGGCG, reverse: CTCGGTGTCTTCACGTTGAGTGTC. GAPDH: forward: ACAACTTTGGTATCGTGGAAGG, reverse: GCCATCACGCCACAGTTTC. PTK2B: forward: CGGTACATTGAGGACGAGGA, reverse: TTCTCCAGCCAGAAGAAGGG.

Protein extraction and western blotting

Total proteins were extracted from fly brain lobes or cultured cells using RIPA lysis buffer (Beyotime, P0013) supplemented with protease and phosphatase inhibitor cocktail (Beyotime, P1046). Protein concentrations were quantified using a BCA protein assay kit (Beyotime, P0010). After denaturation with loading buffer (Beyotime, P0015), an equal amount of the proteins was separated by 8% or 12% SDS-PAGE and transferred onto 0.2 μm PVDF membranes (Millipore, ISEQ00010) using Power Supply (Tanon, EPS-300) and Mini Blotting Electrophoresis Cell (Tanon, VE-186). Next, the membranes were blocked with 5% non-fat milk dissolved in 1x TBST for 2 h at RT, and then incubated with primary antibodies overnight at 4 °C. After washing, membranes were probed with HRP-conjugated secondary antibodies (Abclonal, AS003, AS014, AS025) for 1.5 h at RT. Protein bands were visualized using ECL substrate (Millipore, WBKLS0500) and imaged on a ClinX Chemiscope 3000 mini system. Relative protein expressions were quantified by ImageJ using results from 3 distinct tests.

Immunofluorescence staining

For Drosophila, late 3rd instar larval brains were dissected in ice-cold Schneider’s Drosophila Medium (Sigma-Aldrich, S9895) and fixed with 4% Paraformaldehyde (PFA, Hushi, 10010061) for 15 min at RT and washed three times with PBST (PBS supplemented with 0.1% Triton X-100 (Sangon Biotech, A600198)). For cells, cells on crawling slides were fixed for 10 min with 4% PFA at RT and washed three times with ice-cold PBS, then added 0.1% Tween-20 (Hushi, 30189328) for 5 min to permeabilize the cells and washed three times with PBS. All samples were blocked by 1% BSA (Solarbio, A8020) and then incubated with primary antibodies at 4 °C overnight, followed by washes and incubation with secondary antibodies (Jackson, 115-165-003, 115-175-146, 111-175-144 and 115-095-003) for 2 h at RT. Finally, the fly samples or cell slides were covered with Antifade mounting medium with DAPI (Beyotime, P0131) and imaged using an OLYMPUS FV1000 confocal laser scanning biological microscope.

For the quantification of fly immunostaining, the diameter and area of late 3rd instar larval brains were measured in the companion software FV10-ASW 4.2 Viewer from OLYMPUS FV1000 confocal, and the number of glia cell and mitotic glia cell were counted using Imaris x64 9.0.1.

Antibodies used in this study

PTK2B (67141-1-Ig, 1:1000 for IHC), GAPDH (10494-1-AP,1:5000), GM130 (66662-1-Ig,1:5000 for WB, 1:500 for IF), GADD34 (10449-1-AP, 1:2000), ATF6 (24169-1-AP, 1:2000), ATF4 (10835-1-AP, 1:500), TFE3 (14480-1-AP, 1:1000 for WB, 1:200 for IF), LC3 (14600-1-AP,1:1000), p-mTOR (67778-1-Ig, 1:2500), mTOR (66888-1-Ig, 1:5000), Beclin1 (11306-1-AP, 1:2000), ATG5 (10181-2-AP, 1:2000), P62 (18420-1-AP, 1:5000), LAMP2 (66301-1-Ig, 1:2000), GPX4 (67763-1-Ig, 1:800 for IF), BAX (50599-2-Ig, 1:2000) and Paxillin (10029-1-Ig, 1:2500) were purchased from Proteintech (Wuhan, China). PTK2B (ab32571,1:1000 for WB), HistoneH3 (ab1791, 1:5000), p-PERK (ab192591, 1:1000), pBRAF (ab124794, 1:1000) and BRAF^V600E (ab228461, 1:1000) were purchased from Abcam (Cambridge, United Kingdom). p-IRE1α (HA721980, 1:1000), IRE1α (ER1902-90, 1:2000), GPX4(ET1706-45, 1:2500 for WB), Casepase3 (ET1608-64, 1:1000) and pMEK1/2 (ET1609-50, 1:1000) were purchased from HuaBio (Hangzhou, China). FAK (3285T, 1:1000), PERK (3192T,1:1000), MEK1/2 (8727 S, 1:1000), ERK1/2 (4695 S, 1:2000), p-Paxillin (2541 S, 1:1000), p-PTK2B (3291 S, 1:1000) were purchased from Cell Signaling Technology (Massachusetts, United states). Repo (8D12, 1:50) was purchased from Developmental Studies Hybridoma Bank (Iowa, United states). PH3 (Ser10) (H0412, 1:1000) was purchased from Sigma-Aldrich (Missouri, United states). BRAF (sc-5284, 1:1000) was purchased from Santa Cruz (Texas, United states). pERK1/2 (T40072M, 1:1000) was purchased from Abmart (Shanghai, China). dRaf antibody was generated by Dr. Shanshan Xie of our lab [37].

dFak antibody was generated in this study according to the published protocol [38]. Briefly, cDNA encoding amino acids 1039–1254 of Drosophila Fak was cloned into a pET28a vector. The resulting antigen was expressed and purified from E. coli, then used to immunize New Zealand White rabbits through repeated injections. Finally, polyclonal antibodies were subsequently purified from the harvested serum.

CCK-8 assay

CCK-8 assay was performed to evaluate cell viability and proliferation of DBTRG-05MG after PTK2B knockdown or inhibitors action. For cell viability, 10,000 DBTRG-05MG cells were seeded into 96-well plates per well for 24 h to reach about 60% confluence. PTK2B knockdown lentivirus or inhibitors were then added and incubated for a further 48 h before conducting the CCK-8 assay. For cell proliferation, DBTRG-05MG cells were seeded in 96-well plates at 4000 cells per well following pretreatment with lentiviruses or inhibitors, and CCK-8 assays were performed at 24-hour intervals. 10 µl CCK-8 solution (GLPbio, GK10001) was added to each well and incubated for 2 h at 37 °C. The absorbance density (OD) at 450 nm was then measured using a micro-plate reader (BioTek, Synergy H1). Each treatment was performed with at least six replicates.

Cell colony formation and EdU incorporation assays

Cell colony formation and EdU assays were used to evaluate cell proliferation of DBTRG-05MG. As for colony formation experiment, DBTRG-05MG cells were pre-infected with lentivirus and then added into 6-well plates at 1000 cells/well. Following 14 days of cell growth, the medium was removed and cells were fixed with 4% PFA for 15 min at RT. After washes with PBS, cells were stained with crystal violet solution (Beyotime, C0121) for 20 min. Colonies were then imaged and quantified by manually counting macroscopically visible colonies (> 0.5 mm in diameter) per well. The experiment was performed with three independent biological replicates.

An EdU cell proliferation kit with AF555 (Beyotime, C0075S) was employed to assess cell proliferation according to manufacturer’s protocol. In brief, lentivirus-pretreated DBTRG-05MG cells were seeded in 24-well dishes with cell crawling slides. Upon reaching approximately 60% confluence, cells were transfected with the PTK2B overexpression plasmid using Lipo8000 Transfection Reagent and incubated for an additional 24 h. Following the above treatments, an equal volume of 2× EdU working solution was added for 2 h at 37 °C, then cells were fixed with 4% PFA for 15 min at RT. After washing with PBS and permeabilization, the click reaction solution was added and incubated for 30 min at RT. Finally, cell slides were covered with Antifade mounting medium with DAPI (Beyotime, P0131) and imaged using an OLYMPUS FV1000 confocal laser scanning biological microscope.

Transmission Electron Microscope (TEM)

The golgi apparatus, endoplasmic reticulum, autophagosomes, and mitochondria of our cells were visualized using a Hitachi H-7650 transmission electron microscope (TEM) according to the following process as reported [39]. First, all samples were sequentially fixed overnight at 4 °C in 2.5% glutaraldehyde (Hushi, 30092436) followed by 2-hour fixation in 1% osmium tetroxide (OsO₄, SPI-Chem, 02595-AB) at RT, with three 15-minute PBS washes between each step. Subsequently, samples were dehydrated through a graded series of ethanol (30%, 50%, 70%, 80%) and acetone (90%, 95%, 100%), ethanol (100092183) and acetone (40064460) were purchased from Hushi (Shanghai, China). Then, samples were infiltrated and embedded with a mixture of anhydrous acetone and Spurr resin (SPI-Chem, 02680-AB). Ultrathin sections from 70 to 90 nm were cut using a Leica EM UC7 ultratome and stained by uranyl acetate (SPI-Chem, 02624-AB) and alkaline lead citrate (Macklin, L885990) for 5 to 10 min, respectively, and finally observed in Hitachi H-7650 TEM.

GFP-LC3B and mCherry-GFP-LC3B puncta assay

To evaluate the activation of autophagy and the autophagic flux disruption, GFP-LC3B (Beyotime, D2815) and mCherry-GFP-LC3B (Beyotime, D2816) plasmids were used, respectively. DBTRG-05MG cells were pre-infected with sh-NC and sh-PTK2B lentivirus and then seeded in 24-well dishes with cell crawling slides. At approximately 60% confluence, cells were transfected with GFP-LC3B or mCherry-GFP-LC3B plasmids, with the several inhibitors added 1 h prior to transfection where required. After 48 h incubation, cells were washed twice with ice-cold PBS and fixed with 4% PFA for 15 min at RT. Finally, cell slides were covered with Antifade mounting medium with DAPI (Beyotime, P0131) and imaged using an OLYMPUS FV1000 confocal laser scanning biological microscope.

Inhibitors

The following seven inhibitors were used in this study. ER stress inhibitor 4-Phenylbutyric acid (4-PBA, HY-A0281), autophagy initiation-stage inhibitor 3-Methyladenine (3-MA, HY-19312), autophagy late-stage Chloroquine (CQ, HY-17589 A), ferroptosis inhibitor Ferrostatin-1 (Fer-1, HY-100579) and BRAF^V600E inhibitor Encorafenib (Enco, HY-15605) were purchased from MedChemExpress (New Jersey, United States). MEK1/2 inhibitor PD 0325901 (PD, PZ0162) and ERK1/2 inhibitor Ulixertinib (Ulix, 869886-67-9) were purchased from Sigma-Aldrich (St. Louis, United States) and Selleck (Houston, United States), respectively. The working concentrations of these inhibitors were: 4-PBA (2 mM), 3-MA (2 mM), CQ (20 µM), Fer-1 (1 µM), PD (5 µM), Ulix (20 µM), Enco (1 µM). All inhibitors were added to the cell culture medium 1 h prior to lentiviral infection, and cells were harvested for subsequent experiments after 48-hour incubation. Notably, cells treated with Fer-1 must be cultured in light-protected conditions to prevent inhibitor degradation and functional loss.

TUNEL assay

A TUNEL BrightRed Apoptosis Detection Kit (Vazyme, A113-02) was employed to perform the TUNEL assay. In brief, DBTRG-05MG cells were pre-infected with sh-NC and sh-PTK2B lentivirus and then seeded in 24-well dishes with cell crawling slides. At approximately 80% confluence, cells were fixed with 4% PFA for 25 min at RT and washed twice with ice-cold PBS. Cells were then incubated with 1 × Equilibration buffer for 15 min, followed by incubation with TdT working buffer for 60 min at RT. Finally, cell slides were covered with Antifade mounting medium with DAPI (Beyotime, P0131) and imaged using an OLYMPUS FV1000 confocal laser scanning biological microscope.

Flow cytometry analysis of apoptosis

An Annexin V-FITC/PI Apoptosis Detection Kit (Vazyme, A211-02) was used to evaluate apoptosis levels by flow cytometry. In brief, DBTRG-05MG cells were pre-infected with sh-NC and sh-PTK2B lentivirus and then cultured to approximately 80% confluence. Cells were collected after digestion with Trypsin without EDTA (BasalMedia, S330KJ), washed three times with ice-cold PBS, and resuspended in binding buffer. Then, 5 µL of Annexin V-FITC and 10 µL of PI were added to each sample, followed by incubation for 10 min at RT in the dark. Notably, before fluorescence detection, a blank tube (without any staining) was used to adjust the voltages, and the compensation of fluorescence channels was optimized using Annexin V single-stain and PI single-stain tubes, respectively. Finally, stained cells were analyzed using ACEA NovoCyteTM.

Flow cytometry analysis of lipid peroxidation

To measure lipid peroxidation of DBTRG-05MG cells, we used a BODIPY 581/591 C11 (Thermo Fisher, D3861) probe as a lipid peroxide indicator in accordance with the manufacturer’s instructions. Following different treatments including lentivirus infection and inhibitors administration, cells were collected and stained with 5 µM BODIPY 581/591 C11 working solution at 37 °C for 30 min. After 3-minute centrifugation at 4 °C, 600 g, pellets were washed twice with ice-cold PBS, then resuspended for flow cytometry analysis. C11 fluorescence was detected in FITC channel using ACEA NovoCyteTM, and the data analysis was carried out using FlowJo v10.6.2.

FerroOrange staining

To visualize intracellular iron metabolism, we employed fluorescent probe FerroOrange (Maokang, MX4559) to detect intracellular Fe²⁺. DBTRG-05MG cells were seeded into a 20 mm glass bottom cell culture dish (Biosharp, BS-20-GJM) for 24 h. Upon reaching 60% confluence, the lentivirus was infected and cells were cultured for an additional 48 h. Following old medium removal and three washes with PBS, 0.6 µM FerroOrange working solution prepared with serum-free medium was added to the cells. After 20 min incubation at 37 °C, 2 drops of Hoechst 33,342 Ready Flow (Invitrogen) were added for further 10 min. Finally, the cells were imaged without replacing the medium using a FV1000 confocal laser scanning biological microscope (OLYMPUS).

MDA assay

Malondialdehyde (MDA) content detection kit (Solarbio, BC0025) was used to detect the level of lipid peroxidation according to the manufacturer’s protocol. In a nutshell, differently treated cells were collected and resuspended in MDA extraction buffer and lysed by ultrasonication using an ultrasonic cell crusher (SCIENTZ, JY92-IIDN). Then the lysate was centrifuged at 8000 g for 10 min at 4 °C. The resulting supernatant was mixed with the MDA detection reagent and incubated at 100 °C for 1 h. After cooling, the mixture was centrifuged at 10,000 g for 10 min at RT. The supernatant was transferred to a 96-well plate, and absorbance of each sample at 532 nm and 600 nm was measured using a micro-plate reader (BioTek, Synergy H1). Finally, MDA content was calculated and normalized to cell count.

Bioinformatics analysis

The microarray dataset GSE60898 was obtained from the Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/geo/) database, and subsequent analysis was performed using the GEO2R online tool. Probe identifiers were mapped to official gene symbols according to the platform annotation files provided in GEO. Log2 transformation was applied automatically when required. P-values were adjusted for multiple testing using the Benjamini & Hochberg false discovery rate method. Genes with |log2 fold change| ≥ 1 and adjusted p < 0.05 were considered significantly differentially expressed.

For transcriptome analysis, total RNA was isolated from both control and PTK2B-knockdown DBTRG-05MG cells. Five independent biological replicates were prepared for each group. Sequencing was subsequently carried out on the Illumina platform by Novogene (Beijing, China). After quality control, reads mapping to hg38 human genome database and gene expression level quantification, differential gene expression between the two groups was analyzed using the DESeq2 R package (v1.20.0). The resulting P-values were adjusted for multiple testing via the Benjamini–Hochberg procedure to control the false discovery rate, and genes with an adjusted P-value ≤ 0.05 and |log2 fold change| ≥ 1 were considered differentially expressed. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of differentially expressed genes (DEGs) was performed using the clusterProfiler R package.

For proteomic analysis, total cell pellets of control and PTK2B-knockdown groups were collected, with three independent biological replicates prepared for each group. Protein extraction, trypsin digestion and LC-MS/MS analysis were conducted by PTM Bio (Hangzhou, China). After quality control and protein quantitative analysis, differential protein expression between groups was assessed using two-sample Student’s t-tests under the assumption of equal variances. Fold change (FC) was calculated as the mean intensity ratio of sh-PTK2B to NC groups. Significance thresholds were set as follows: up-regulated (p < 0.05 and FC ≥ 1.5), down-regulated (p < 0.05 and FC ≤ 0.67), and not significant otherwise. Golgi-related pathway enrichment analysis was performed on the Gene Ontology (GO) Biological Process (BP) terms using the Gene Set Enrichment Analysis (GSEA) implemented in the clusterProfiler R package (v4.14.6), with the org.Hs.eg.db (v3.20.0) human annotation database. Proteins were ranked by FC, with positive values indicating higher abundance in the PTK2B-knockdown group. The GSEA algorithm calculates an enrichment score (ES) using a running-sum statistic to evaluate the non-random distribution of gene set members at the extremes of the ranked list. Statistical significance was evaluated by permutation testing with a threshold of p < 0.05. The GO database (https://www.geneontology.org/), KEGG database (https://www.genome.jp/kegg/) and FerrDB (http://www.zhounan.org/ferrdb/current/) were used for annotation of ferroptosis-related marker proteins.

All bioinformatics analyses were performed in R (v4.4.3). Data processing were facilitated by the tidyverse packages, including dplyr (v1.1.4), tidyr (v1.3.1), purrr (v1.1.0), forcats (v1.0.0), and stringr (v1.5.1). Visualization of enrichment results was carried out with enrichplot (v1.26.6) and GseaVis (v0.1.1), while general data visualization was performed with ggplot2 (v3.5.2), supplemented by ggrepel (v0.9.6), ggridges (v0.5.7).

Statistical analysis

All data in this study were presented as mean ± SD (standard deviation). Statistical analysis was conducted using GraphPad Prism software. Unpaired t-tests were used for comparisons between two groups. For comparisons among three or more groups, one-way analysis of variance (ANOVA) was employed. P < 0.05 was considered statistically significant for all analyses.

Results

PTK2B/Fak is highly expressed in BRAF^V600E/dRaf^GOF glioma

To identify genes potentially associated with BRAF^V600E glioma, we analyzed the dataset GSE60898, a gene expression profile of 151 pediatric low-grade gliomas. Comparative analysis identified significant higher PTK2B mRNA levels in BRAF^V600E-mutant (MUT) patients compared to BRAF-wild-type (WT) controls (Fig. 1a). We validated the correlation between elevated PTK2B and BRAF^V600E mutation in glioma using immunohistochemistry on paraffin-embedded sections from 9 pLGGs (clinical information in Table 1). The staining intensity was remarkably stronger in BRAF^V600E glioma (MP1-MP5) compared to BRAF wild-type glioma (NP1-NP4) (Fig. 1b).

Fig. 1.

PTK2B/Fak is highly expressed in BRAF^V600E-mutant human glioma/Drosophila dRaf^GOF glioma. a Left: Differential gene expression analysis between BRAF wild-type (WT) and BRAF V600E mutant (MUT) pLGG samples in dataset GSE60898 identified the top 25 genes with the most significant changes in mRNA levels; Right: Comparison of PTK2B expression levels between BRAF WT and BRAF V600E mutant groups. Each point represents expression data from an individual patient. b Immunohistochemistry (IHC) staining of PTK2B for four human glioma samples with wild-type BRAF (NP1-NP4) and five samples with BRAF^V600E mutation (MP1-MP5). c Western blot analysis for PTK2B, p-PTK2B (Tyr402), Paxillin and p-Paxillin of three glioma cell lines DBTRG-05MG, T98G and U251. d Western blot analysis of Fak for Drosophila late 3rd instar larval brains of control flies and dRaf^GOF glioma models. e qPCR analysis of Fak and dRaf for Drosophila late 3rd instar larval brains of control flies and dRaf^GOF glioma models (n = 3). f Immunofluorescence staining for Drosophila late 3rd instar larval brains of control flies and dRaf^GOF glioma models. Anti-Repo was used to label glial nuclei (red: Repo; green: Raf). Scale bar = 100 μm. ** P < 0.01, ***P < 0.001, ****P < 0.0001

Table 1.

Information of nine pediatric glioma samples from the Children’s Hospital, Zhejiang University School of Medicine

Characteristics			Pathological analysis		BRAF V600E mutation status
Sample ID	Age	Gender	Pathological diagnosis	Pathologic stage
NP1	2y	M	Anaplastic Glioma	WHO III	NO
NP2	2y	F	Hair cell astrocytoma	WHO I	NO
NP3	7y	M	Diffuse glioneuronal tumor	WHO I	NO
NP4	3y	F	Mixed neuronal glioma	WHO I	NO
MP1	4y	F	Hair cell astrocytoma	WHO I	YES
MP2	6y	F	Diffuse midline glioma	WHO IV	YES
MP3	15y	M	Hair cell astrocytoma	WHO I	YES
MP4	6y	M	Hair cell astrocytoma	WHO I	YES
MP5	12y	F	Ganglioglioma	WHO I	YES

The information includes Sample ID, age, gender, pathological diagnosis, pathological stage and BRAF V600E mutation status. y: years; M: male; F: female.

We further confirmed this observation across model systems. Our investigation started with three glioma cell lines: DBTRG-05MG, T98G and U251, all derived from adult glioma. The only reported BRAF^V600E‑mutant pediatric low‑grade glioma cell line BT‑40 [40–42] carried additional CDKN2A/B deletion and was not accessible through standard repositories. We decided not to pursue the study in BT-40 with the concern that additional mutation could jeopardize the study.

In cultured glioma cell lines, compared to BRAF wild-type lines T98G and U251, PTK2B expression was substantially elevated in DBTRG-05MG, which harbors a heterozygous BRAF^V600E mutation (Fig. 1c). Moreover, PTK2B kinase activity was also increased in DBTRG-05MG, as evidenced by elevated p-PTK2B (Tyr402) (autophosphorylation/activation marker) and p-Paxillin (downstream substrate). repo (reversed polarity) encodes a glial-specific homeodomain transcription factor in Drosophila, and repo-Gal4 serves as a glia-specific driver line. In the Drosophila glioma model with constitutively active Drosophila Raf (dRaf^GOF) driven by repo-Gal4 [18], the larval brain lobes appeared enlarged and deformed (Fig. 1f). Consistent with the cell lines results, Fak, the Drosophila homolog of human PTK2B, was significantly upregulated at both mRNA and protein levels in dRaf^GOF glioma model (Fig. 1d and e).

Two paralogs in FAK family, PTK2B and PTK2 [43], are found in human, and both paralogs can contribute to cancer progression through distinct and overlapping functions [44]. Our bioinformatic analysis of dataset GSE60898 revealed no change in PTK2 mRNA between BRAF-wild-type and BRAF^V600E gliomas (Fig. S2a). Consistently, PTK2 protein levels showed no significant differences among DBTRG-05MG, T98G and U251 (Fig. S2b). These findings indicate that PTK2 expression is independent of BRAF^V600E status and PTK2 is unlikely mechanistically contributed to BRAF^V600E mutation phenotype. PTK2B is selectively elevated in BRAF^V600E contexts, supporting a PTK2B-specific role in BRAF^V600E glioma progression.

Lack of PTK2B/Fak inhibits BRAF^V600E/dRaf^GOF glioma growth

We next investigated the functional role of PTK2B in BRAF^V600E glioma development. Using two distinct shRNAs, we achieved effective PTK2B knockdown in DBTRG-05MG without obviously affecting PTK2 expression (Fig. 2a and Fig. S3a). This knockdown resulted in a striking decrease in cell viability (Fig. 2b) and significantly inhibited cell proliferation and colony formation capacity (Fig. 2c and d). Similar PTK2B knockdown in another BRAF^V600E-mutant glioma cell line, AM-38, also markedly suppressed cell proliferation (Fig. S3b). Critically, PTK2B knockdown in BRAF wild-type glioma lines (T98G, U251) showed no measurable impact on proliferation (Fig. S3c and S3d), demonstrating its specific essentiality in the BRAF^V600E context.

Fig. 2.

Inhibition of PTK2B/Fak suppresses BRAFV600E/dRafGOF glioma proliferation. a qPCR and Western blot analysis for PTK2B of DBTRG-05MG cells transfectedwith sh-NC and sh-PTK2B (n = 3). b CCK-8 assay for DBTRG-05MG cells transfected with sh-NC and sh-PTK2B (n = 6). c CCK-8 assay of DBTRG-05MGcells for 120 h (n = 6). d Colony formation assay for DBTRG-05MG cells with or without PTK2B knockdown (n = 3). Colonies (cell clusters) were stained withcrystal violet; each colony originates from a single cell seeded at approximate 1,000 cells per well and grown for 14 days. e IF staining for Drosophila late3rd instar larval brains of control, repo-Gal4, Fak−/−, dRafGOF and Fak-knockout in dRafGOF. The areas circled by the white dashed line in the bottom row wereused for statistics on brain lobe diameter and area. (red: Repo; green: Raf ) Scale bar = 50 μm. (Maximum intensity projection of Z-stacks to show overallbrain morphology.) f qPCR analysis for Fak and dRaf of Drosophila late 3rd instar larval brains from five groups (n = 3). g Western blot analysis for Fak of flybrains in various groups. h Statistics on variations of diameters and areas of Drosophila late 3rd instar larval brains, each data point represents one brainlobe. i Representative Confocal sections of fly brain lobes. The colocalization of Repo and PH3 (arrows) in the top row represents the glial cells undergoingdivision. The region between the two arrows in the bottom row represents the blood-brain barrier (BBB) layer (red: Repo; green: Raf; white: PH3). Scalebar = 50 μm. (Single optical section to clearly resolve the BBB layer) (j) Statistics on the number of glia cells from Fig. 2e and number of mitotic glia cellsfrom Fig. 2i. ** P < 0.01, ***P < 0.001, ****P < 0.0001

We validated this tumor-specific dependency in our Drosophila glioma model as well. The w1118 served as the wild type control, and repo-Gal4 alone was employed to exclude potential Gal4-dependent interference. In Drosophila glioma model, glial-specific dRaf overexpression (> 160-fold mRNA upregulation) promoted tumorigenesis (Fig. 2e), while Fak knockout by introducing a frameshift dFak^ko mutant (Fig. S4a and S4b) into the dRaf^GOF background substantially suppressed dRaf transcription and attenuated tumor progression (Fig. 2f). Similarly, both mRNA and protein levels of Fak were significantly elevated in glioma. After Fak knockout, the Fak mRNA returned to baseline and the protein was not detected (Fig. 2f and g).

Immunofluorescence (IF) staining of late 3rd instar larval brain with anti-Repo (glial nuclei) and anti-Raf (cytoplasmic) revealed severe morphological abnormalities in dRaf^GOF glioma, characterized by dramatically enlarged and deformed brain lobes, which was substantially rescued by Fak knockout (Fig. 2e). Quantified data of the brain lobe diameters and sizes were shown in Fig. 2h. Given that constitutive dRaf active drives aberrant proliferation, we hypothesized that glial cells overproliferation underlies these abnormalities. Staining with the mitotic marker PH3 confirmed this: The number of mitotic glial cells (PH3/Repo co-localized cells, white arrows in the top row of Fig. 2i) in the dRaf^GOF model increased almost 2.5-fold, while total glial cell numbers nearly doubled. Upon Fak knockout, both of which were normalized to control levels (Fig. 2j). Furthermore, we investigated the pathological impact on the blood-brain barrier (BBB), mainly functioned by perineurial and sub-perineurial glia in the superficial brain layer [45]. By analyzing single confocal optical sections, we could distinguish these two glial layers from the inner cortex glia and thereby enable direct visualization of BBB structure and thickness. The Confocal image sections (bottom row of Fig. 2i) showed that the glial cell layer, marked between the two white arrows, was considerably thickened in the dRaf^GOF group brain, while its thickness returned to normal after Fak knockout. Given that the BBB primarily consists of perineurial and sub-perineurial glia, the observed alterations in its thickness are likely attributable to dRaf^GOF-driven hyper-proliferation and its rescue by Fak knockout.

All these findings support the conclusion that Fak is essential for the dRaf^GOF glioma proliferation. Notably, no phenotypic differences were observed between dFak^ko and wild-type controls, indicating that Fak acts as a tumor-specific modulator.

Validation of PTK2B/Fak functions in BRAF^V600E/dRaf^GOF glioma

To exclude potential off-target effects of RNAi and genetic background effects, we performed rescue experiments through PTK2B/Fak overexpression. In DBTRG-05MG cells, PTK2B was transiently overexpressed by transfecting the PTK2B overexpression plasmid into either control cells or PTK2B stable knockdown cells. The robust efficiency of this transient overexpression was validated in control cells, resulting in markedly elevated PTK2B mRNA and protein levels (Fig. S5a) as well as enhanced fluorescence intensity (Fig. S5b).

Western blot analysis confirmed that exogenous PTK2B expression fully restored protein levels under PTK2B knockdown conditions (Fig. 3a). Quantified CCK-8 proliferation curves demonstrated that PTK2B overexpression alone exerted negligible effect but almost rescued the impaired proliferation caused by PTK2B knockdown (Fig. 3b). EdU, a thymidine analogue incorporated exclusively during DNA replication, served as a proliferation marker. Similarly, PTK2B knockdown reduced EdU-positive cells to approximately 40% of control levels, while subsequent overexpression of PTK2B largely restored proliferation capacity (Fig. 3c). These results confirmed that PTK2B is pivotal in BRAF^V600E glioma progression and indicated that our earlier PTK2B RNAi data were not due to off-target effect. In addition, consistent with DBTRG-05MG, PTK2B overexpression alone also did not notably affect proliferation in AM-38 cells, implying that the oncogenic function of PTK2B might already at maximal levels under its high basal expression in these BRAF^V600E‑mutant glioma cells (Fig. S5c). In contrast, PTK2B overexpression alone significantly promoted cell proliferation in T98G and U251 cells with low endogenous PTK2B expression, indicating a pro‑proliferative role of PTK2B in BRAF wild‑type glioma cells (Fig. S5d).

Fig. 3.

Overexpression of exogenous PTK2B/Fak reverses the tumor-suppressive phenotypes by knockdown/knockout in BRAF^V600E/dRaf^GOF glioma. a Western blot analysis for PTK2B do DBTRG-05MG cells infected with lentivirus carrying shRNAs targeting PTK2B and was then transfected with a PTK2B overexpression plasmid. b CCK-8 assay of DBTRG-05MG cells for 120 h with PTK2B knockdown and subsequent overexpression (n = 6). c EdU incorporation assay and corresponding quantification in DBTRG-05MG cells with PTK2B knockdown and subsequent overexpression (n = 3). Scale bar = 50 μm. d IF staining for Drosophila late 3rd instar larval brains of control, dRaf^GOF, Fak knockout in dRaf^GOF and Fak overexpression post Fak knockout in dRaf^GOF. The areas circled by the white dashed line were used for statistics on brain lobe diameter and area (red: Repo; green: Raf). Scale bar = 50 μm. e qPCR analysis of Fak and dRaf for Drosophila late 3rd instar larval brains of various groups (n = 3). f Western blot analysis of Fak for various groups’ fly brains. g Representative Confocal sections of fly brain lobes. The colocalization of Repo and PH3 (arrows) in the top row represents dividing glial cells. The region between the two arrows in the bottom row represents the blood-brain barrier (BBB) layer (red: Repo; green: Raf; white: PH3). Scale bar = 50 μm. h Statistics on the diameter of fly brain lobes from Fig. 3d and number of mitotic glia cells from Fig. 3g. ** P < 0.01, ***P < 0.001, ****P < 0.0001

Using a UAS‑Fak line with high overexpression efficiency, which can significantly elevate Fak expression in the wild‑type background (Fig. S5e and S5f) and promote glial proliferation as well as brain lobe growth (Fig. S5g and S5h), we performed genetic crosses and generated a fly line carrying Fak overexpression and dFak^ko in dRaf^GOF glioma background. Successful Fak overexpression in the rescue setting was confirmed by qPCR and Western blot (Fig. 3e and f). As expected, Fak overexpression restored Raf mRNA levels, substantially rescued larval brain lobe morphology and sizes in the Drosophila glioma model (Fig. 3d and h). Likewise, the number of mitotic glial cells and thickness of BBB layer were considerably returned back to normal by Fak overexpression (Fig. 3g and h). Taken together, all these observations highlight the indispensable contribution of Fak to dRaf^GOF glioma development.

PTK2B knockdown induces ER stress in BRAF^V600E glioma

Given the significant anti-tumor effect of PTK2B knockdown, we initiated our mechanistic investigation by determining its subcellular localization in DBTRG-05MG cells. In addition to cytoplasmic localization reported previously [43], IF revealed strong enrichment of the PTK2B protein to the Golgi apparatus, as evidenced by clear co-localization with the Golgi marker GM130 (Fig. 4a). Knockdown of PTK2B disrupted Golgi integrity, causing mild dispersion in GM130 staining (Fig. 4b) and pronounced Golgi swelling under transmission electron microscopy (TEM) (Fig. 4c, white arrows). Beyond structural abnormalities, proteomic analysis further indicated dysregulated Golgi function, characterized by enhanced Golgi-related vesicle transport (Fig. 4d). These findings suggest that the Golgi homeostasis is disturbed by PTK2B knockdown.

Fig. 4.

PTK2B knockdown-induced Golgi dysfunction triggers ER stress in DBTRG-05MG cells. a Confocal images illustrated the co-localization of PTK2B (red) and GM130 (green, marker of Golgi apparatus), and nuclei were stained by DAPI (blue). Scale bar = 20 μm. b IF staining of DAPI (blue), PTK2B (green) and GM130 (red) for DBTRG-05MG cells transfected with sh-NC and sh-PTK2B. Scale bar = 20 μm. c Representative TEM images of DBTRG-05MG cells revealed that PTK2B knockdown induced Golgi swelling (arrows). The images of the bottom row were the magnified views of the boxed areas of the top row. Scale bar = 4 μm (top row) and 0.5 μm (bottom row). d A ridge plot displaying enriched GO terms among differential Golgi-related proteins between PTK2B-knockdown and control groups from proteomic data. The horizontal coordinates represent the enrichment score, the vertical coordinates show the GO terms, and the color corresponds to the P value. e Differential expressed genes (DEGs) between PTK2B-knockdown and control groups were subjected to KEGG pathway analysis. The bubble plot highlighted top 20 enriched pathways, with dot size representing gene count and color gradient indicating enrichment significance. f GSEA of proteomic data between PTK2B knockdown and control DBTRG-05MG cells. The bottom panel displays the ranked list of all proteins based on fold change, ordered from up-regulated genes on the left to down-regulated genes on the right. The middle panel uses vertical black bars to represent the position of each protein; red color indicates upregulation, while blue color denotes downregulation. The top panel depicts the running Enrichment Score (ES) profile, where the score is calculated progressively along the ranked list of proteins. The normalized enrichment score (NES) was 1.66 and p < 0.001, suggesting that ER stress gene set was significantly up-regulated after PTK2B knockdown. g Western blot analysis for ER stress markers of DBTRG-05MG cells with or without PTK2B knockdown. sh-1: sh-PTK2B-1; sh-2: sh-PTK2B-2. h Representative TEM images of DBTRG-05MG cells showed that PTK2B knockdown induced severe ER swelling (arrows). Scale bar = 4 μm.

To identify pathways responding to Golgi disruption and affecting tumor cell proliferation, RNA sequencing (RNA-seq) of PTK2B-knockdown DBTRG-05MG cells and KEGG enrichment analysis of differentially expressed genes (DEGs) were conducted. As illustrated in Fig. 4e, the protein process in ER, autophagy and MAPK signaling pathway were prominently enriched. Notably, ER protein process emerged as the pathway most closely coupled to Golgi abnormalities, owing to the Golgi’s primary role in protein modification and transport [46–48]. The link between Golgi dysfunction and ER protein process was further validated by gene set enrichment analysis (GSEA) of proteomic data, which confirmed marked upregulation of the ER stress pathway (Fig. 4f).

Corroborating the RNA-seq and proteomic analyses, Western blot analyses indicated the activation of all major UPR sensors (IRE1α, PERK, ATF6) and the upregulation of downstream transcription factor ATF4 and GADD34, confirming ER stress upon PTK2B knockdown (Fig. 4g). In addition, TEM provided direct ultrastructural evidence of ER dilation in DBTRG-05MG (Fig. 4h, white arrows). Additional Western blot analysis revealed that PTK2B knockdown also induced ER stress in AM-38, another BRAF^V600E‑mutant glioma cell line, but not in BRAF wild‑type T98G and U251 cells (Fig. S6a~S6c). Cumulatively, these data identify PTK2B as a Golgi-associated regulator in BRAF^V600E glioma cells. PTK2B knockdown disrupted Golgi structure and function, thereby triggering severe ER stress.

ER stress induces autophagic flux disruption following PTK2B knockdown

The enrichment of autophagy in KEGG profiling (Fig. 4e), alongside its known role in glioma progression and crosstalk with ER stress [22, 49], prompted us to characterize autophagic activity in DBTRG-05MG cells. As complete autophagic flux requires initiation, lysosomal fusion and degradation [50], we first assessed autophagy initiation following PTK2B knockdown. Apparently, autophagosomes were readily observed in TEM images of shRNA-treated cells compared to controls (Fig. 5a, white arrows). Immunoblotting showed that PTK2B knockdown markedly elevated the LC3B-II/LC3B-I ratio, a key indicator of autophagosome formation, and upregulated the essential autophagy regulators Beclin1 and ATG5 [51] (Fig. 5b, Fig. S7a). In addition, DBTRG-05MG cells transfected with the GFP-LC3 plasmid showed that PTK2B knockdown markedly increased GFP-LC3 puncta signals, indicating autophagosome accumulation (Fig. 5c, Fig. S8a). All these data suggested the increased autophagic initiation upon PTK2B knockdown.

Fig. 5.

PTK2B knockdown-induced ER stress triggers autophagy flux disruption in DBTRG-05MG cells. a Representative TEM images of DBTRG-05MG cells showed the formation of autophagosome post PTK2B knockdown (arrows). The images of the top and bottom row were the magnified views of the boxed areas of the middle row. Scale bar = 4 μm (middle row) and 0.6 μm (top and bottom row). b Western blot analysis of autophagy markers of DBTRG-05MG cells with or without PTK2B knockdown. Quantification of the LC3B-II/LC3B-I ratio is shown in Fig. S7a. c Representative confocal images of DBTRG-05MG cells and quantification of GFP-LC3 puncta per cell (based on nine randomly selected fields; see Fig. S8a) (green: GFP-LC3; blue: DAPI) Scale bar = 20 μm. d Western blot analysis of TFE3 and p-mTOR for DBTRG-05MG cells with or without PTK2B knockdown. Quantification of p-mTOR protein expression is shown in Fig. S7b. e IF staining of TFE3 in DBTRG-05MG cells with or without PTK2B knockdown (red: TFE3; blue: DAPI). Scale bar = 40 μm. f GSEA of proteomic data between PTK2B knockdown and control DBTRG-05MG cells. NES = 1.22 and p = 0.02, suggesting that the gene set related to autophagy was significantly elevated after PTK2B knockdown. g Western blot analysis for P62 of DBTRG-05MG cells with or without PTK2B knockdown. h Western blot and qPCR analysis for LAMP2 of DBTRG-05MG cells with or without PTK2B knockdown. (n = 3). Quantification of LAMP2 protein expression is shown in Fig. S7b. i Representative confocal images and quantification of orange puncta per cell (based on five randomly selected fields; see Fig. S9a). DBTRG-05MG cells were transfected with mCherry-GFP-LC3 to visualize autophagosome-lysosome fusion following several treatments. (green: GFP-LC3; red: mCherry-LC3; blue: DAPI) Scale bar = 10 μm. j Western blot analysis for ER stress and autophagy markers of DBTRG-05MG cells with 4-PBA (2 mM) and 3-MA (2 mM) and PTK2B knockdown treatments. Each GAPDH lane represents an individual membrane; all experiments within the same treatment group employed same batch of protein extracts. In the left diagram, blue labels/arrows denote key protein changes for ER stress, autophagy initiation, and late-stage disruption; orange labels show inhibitors action sites

Mechanistically, we investigated TFE3, a key transcription factor regulating stress-induced autophagy. Normally sequestered at lysosomal membranes, TFE3 translocates to the nucleus upon activation to initiate autophagy-related gene expression [52]. TFE3 activation can be triggered by ER stress via PERK signaling or through mTORC1 suppression, a master regulator of autophagy that inhibits multiple stages of autophagic flux [53]. Aligned with this paradigm, Western blot analysis confirmed TFE3 upregulation, reduced p-mTOR levels (Fig. 5d, Fig. S7b), and elevated p-PERK (Fig. 4g), while immunofluorescence illustrated pronounced nuclear translocation of TFE3 (Fig. 5e). These results suggest that TFE3 may participate in the autophagic initiation induced by PTK2B knockdown, although its precise role remains to be further validated.

P62/SQSTM1 is a selective autophagy receptor, and its accumulation correlates with failure of autophagic degradation [54]. Both proteomic GSEA (Fig. 5f) and Western blot analysis (Fig. 5g) confirmed marked P62 accumulation, indicating disrupted autophagic flux. Mechanistically, LAMP2 protein, essential for autophagosome-lysosome fusion [55, 56], was dramatically reduced following PTK2B knockdown (Fig. 5h, Fig. S7c). However, qPCR analysis revealed that LAMP2 mRNA levels were only modestly decreased (Fig. 5h), suggesting that the protein loss is not fully explained by transcriptional repression and may involve translational/protein degradation. This autophagosome-lysosome fusion failure was directly visualized using the tandem-fluorescence mCherry-GFP-LC3 system [57]. While successful fusion yields red fluorescence due to pH-sensitive GFP quenching, PTK2B-knockdown cells exhibited predominant orange puncta due to persistent co-localization, indicating fusion blockade. This phenotype matched cells treated with chloroquine (CQ), a fusion inhibitor that prevents lysosomal acidification (Fig. 5i, Fig. S9a). Collectively, these results demonstrate that PTK2B knockdown disrupts autophagic flux in BRAF^V600E glioma cells through defective autophagosome-lysosome fusion. Notably, additional Western blot analyses revealed that PTK2B knockdown also induced autophagy initiation and autophagic flux disruption in AM-38, without obvious alteration of any autophagy-related protein expressions in T98G and U251 cells (Fig. S10a~S10c), indicating that PTK2B-mediated autophagy regulation is specifically dependent on the BRAF^V600E background.

To delineate the relationship between ER stress and autophagy following PTK2B knockdown, we employed 4-PBA (ER stress inhibitor) and 3-MA (autophagy initiation inhibitor). Using the mCherry-GFP-LC3 system, we found that both 4-PBA and 3-MA treatments significantly reduced the orange puncta induced by PTK2B knockdown, suggesting that both inhibitors alleviate autophagic flux disruption (Fig. 5i, Fig. S9a). Furthermore, Western blot analysis revealed that 4-PBA concurrently suppressed ER stress (p-PERK, p-IRE1α, ATF4) and autophagy initiation markers (LC3B-II/LC3B-I ratio, Beclin1), while also reducing P62 accumulation. In contrast, 3-MA effectively inhibited autophagy initiation but failed to alleviate ER stress, instead further elevating p-PERK, p-IRE1α and ATF4 levels beyond those induced by PTK2B knockdown alone due to feedback loop (Fig. 5i). These distinct inhibitor responses demonstrate that ER stress acts upstream of autophagy induction. Based on these results, we conclude that PTK2B knockdown triggers ER stress-induced autophagic flux disruption in BRAF^V600E glioma.

PTK2B knockdown triggers ferroptosis in BRAF^V600E glioma

Although PTK2B knockdown was demonstrated to induce ER stress-mediated autophagic flux disruption in BRAF^V600E glioma cells, this cascade’s direct link to tumor suppression required further investigation. Since dysregulated autophagy often promotes cell death through apoptosis or ferroptosis [28, 58], we first examined apoptosis. Western blot analysis revealed notable downregulation of key apoptosis executioner cleaved caspase-3 and pro-apoptotic factor BAX following PTK2B knockdown, suggesting that apoptosis is not involved in these conditions (Fig. S5a). This was further validated by TUNEL and Annexin V/PI staining assays, which showed no apoptotic cell death upon PTK2B knockdown in DBTRG-05MG cells (Fig. S11b, S11c). Consistently, PTK2B knockdown in another BRAF^V600E glioma cell line, AM-38, failed to increase cleaved caspase-3 levels similarly (Fig. S11d). In contrast, PTK2B knockdown in BRAF wild‑type T98G and U251 cells upregulated cleaved caspase-3 and BAX (Fig. S11d), indicating that the absence of apoptosis is specific to the BRAF^V600E background. We therefore focused on ferroptosis.

TEM revealed characteristic mitochondrial alterations associated with ferroptosis in PTK2B-knockdown cells, including wrinkled morphology, increased membrane electron density and cristae reduction (Fig. 6a). Western blot analysis showed that PTK2B knockdown downregulated GPX4, a key enzyme that eliminates lipid peroxides, and upregulated ACSL4, which promotes lipid peroxidation by incorporating PUFAs into membrane phospholipids [59] (Fig. 6b). Consistently, IF staining confirmed a marked decrease in GPX4 (Fig. 6c). These coordinated changes would promote lipid peroxidation and accelerate ferroptosis. Additional Western blot analysis demonstrated that PTK2B knockdown similarly altered GPX4 and ACSL4 expression in AM-38, but did not affect these ferroptosis markers in T98G and U251 cells (Fig. S12a~S12c).

Fig. 6.

PTK2B knockdown triggers Ferroptosis in DBTRG-05MG cells. a Representative TEM images of DBTRG-05MG cells. PTK2B knockdown resulted in abnormal mitochondrial ultrastructure, characterized by condensation, elevated membrane density, and reduced cristae. The images of the bottom row were the magnified views of the boxed areas of the top row. Scale bar = 4 μm (top row) and 0.6 μm (bottom row). b Western blot analysis of DBTRG-05MG cells demonstrated that PTK2B knockdown significantly decreased GPX4 protein expression and markedly increased ACSL4 levels compared to the control. c Confocal images of GPX4 IF staining in DBTRG-05MG cells (red: GPX4; blue: DAPI). Scale bar = 40 μm. d Confocal images of FerroOrange staining in DBTRG-05MG cells (red: FerroOrange; blue: DAPI). Scale bar = 30 μm. e MDA contents were measured in DBTRG-05MG cells with or without PTK2B knockdown (n = 11). f Lipid ROS in DBTRG-05MG cells was assessed by flow cytometry with the C11-BODIPY dye (n = 3). g Heatmap of all differentially expressed proteins related to ferroptosis (annotated from three databases) between control and PTK2B-knockdown groups, as determined by proteomics. Red and purple indicated upregulation and downregulation, respectively

Subsequently, we assessed levels of Fe²⁺ and lipid peroxidation, two major hallmarks of ferroptosis [31]. PTK2B knockdown induced pronounced intracellular Fe²⁺ accumulation, as supported by FerroOrange staining (Fig. 6d) and elevated ferritin heavy chain 1 (FTH1) level (Fig. S12d). Both MDA (reflecting terminal peroxidation adducts) and C11-BODIPY (indicating early oxidation dynamics) measurements convergently demonstrated increased lipid peroxidation (Fig. 6e and f). Proteomic analysis further confirmed alterations in ferroptosis-related proteins such as PTGS2 (Fig. 6g). Together, these findings demonstrate that PTK2B knockdown in the BRAF^V600E glioma triggers ferroptotic cell death.

PTK2B knockdown-mediated ferroptosis is driven by ER stress-induced autophagic flux disruption

Having shown that knockdown of PTK2B leads to ER stress-mediated autophagic flux disruption, we next sought to explore the interrelationship between this disruption and ferroptosis (Fig. 7a). Western blot analyses demonstrated that both 4-PBA (ER stress inhibitor) and 3-MA (autophagy initiation inhibitor) efficiently rescued PTK2B knockdown-induced GPX4 reduction and ACSL4 upregulation, suggesting both ER stress and autophagy early-stage blockage could attenuate ferroptosis (Fig. 7b and c). Conversely, the ferroptosis inhibitor Ferrostatin-1 (Fer-1) rescued these ferroptosis markers without affecting upstream ER stress or autophagy markers (Fig. 7d), confirming ferroptosis as the terminal event downstream of ER stress-mediated autophagic flux disruption.

Fig. 7.

PTK2B knockdown triggers Ferroptosis through ER stress-induced autophagic flux disruption in DBTRG-05MG cells. a Diagram of key proteins. Blue labels/arrows denote key protein changes for ER stress, autophagy initiation, late-stage autophagic disruption and ferroptosis; orange labels show inhibitors action sites. b-c Western blot analysis of DBTRG-05MG cells. 4-PBA (h) or 3-MA (i) treatment restored the GPX4 downregulation and ACSL4 upregulation caused by PTK2B knockdown. d-e Western blot analysis for ER stress, autophagy and ferroptosis markers of DBTRG-05MG cells with Fer-1 (d) and CQ (e) treatment. Each GAPDH lane represents an individual membrane; all experiments within the same treatment group employed same batch of protein extracts. Quantifications of GPX4 and ASCL4 in Fig. 7b-e are shown in Fig. S7d~S7g. f-g Four inhibitors including 4-PBA, 3-MA, CQ and Fer-1 were added to DBTRG-05MG cells with or without PTK2B knockdown, followed by lipid ROS (n = 5) (f) and MDA (n = 6) (g) content determination. h-i The effects of 4-PBA, 3-MA, CQ and Fer-1 on cell viability (n = 8) (h) and proliferation (n = 6) (i) of DBTRG-05MG cells with or without PTK2B knockdown. ****P < 0.0001

To determine whether autophagic flux disruption directly drives ferroptosis following PTK2B knockdown, we applied CQ to block autophagosome-lysosome fusion (Fig. 7e). CQ alone elevated P62 and LC3B-II/LC3B-I ratio, without altering Beclin1 in control or knockdown cells, confirming specific inhibition of late-stage autophagy. Notably, CQ alone downregulated GPX4, demonstrating that flux disruption directly triggers ferroptosis. Combining CQ with PTK2B knockdown synergistically enhanced ferroptosis, further suppressing GPX4 and elevating ACSL4 beyond individual treatments, as CQ’s complete lysosomal inhibition augmented the partial disruption caused by PTK2B knockdown. Furthermore, CQ did not alleviate PTK2B knockdown-induced ER stress but further increased p-PERK and ATF4, consistent with autophagy functioning downstream of ER stress and suggesting feedback exacerbation upon flux disruption. These results establish autophagic flux disruption as a direct driver of ferroptosis in PTK2B-knockdown glioma.

Consistently, in AM-38 cells, treatments with 4-PBA, 3-MA, and Fer-1 recapitulated the same hierarchical relationship observed in DBTRG-05MG cells: PTK2B knockdown induced-ER stress acts upstream of autophagy and ferroptosis, autophagy lies downstream of ER stress but upstream of ferroptosis, and ferroptosis is the terminal event (Fig. S13a~S13c).

In concert, our findings delineate a PTK2B-regulated ER stress-autophagy-ferroptosis axis in BRAF^V600E glioma. Upon PTK2B knockdown, ER stress-induced autophagic flux disruption drives ferroptosis—the terminal event downstream of this axis. The proposed regulatory axis was further validated by an array of experiments. Lipid peroxidation assays (C11-BODIPY and MDA) in DBTRG-05MG showed that CQ alone slightly enhanced lipid peroxidation, whereas 4-PBA, 3-MA or Fer-1 exhibited minimal or no effect. PTK2B knockdown significantly elevated lipid peroxidation, which was reversed by 4-PBA, 3-MA, or Fer-1. Conversely, CQ further intensified lipid peroxidation in PTK2B-knockdown cells (Fig. 7f and g). CCK-8 assays confirmed the ultimate tumor-suppressive impact of this regulatory axis. While 4-PBA, 3-MA or Fer-1 alone exerted negligible impact, each effectively restored cell viability and proliferation impaired by PTK2B knockdown in both DBTRG-05MG and AM-38 cells (Fig. 7h and i, Fig. S13d and S13e). In contrast, CQ not only reduced viability alone but also further aggravated the anti-tumor effect of PTK2B knockdown in DBTRG-05MG cells (Fig. 7h and i). Collectively, these results demonstrate that PTK2B knockdown triggers ferroptosis through ER stress-induced autophagic flux disruption in BRAF^V600E glioma, culminating in tumor suppression.

An interlocking relationship between PTK2B and MAPK signaling in BRAF^V600E glioma

Given the constitutive MAPK activation by BRAF^V600E mutation [60] and our KEGG findings of MAPK signaling pathway enrichment (Fig. 4e), we therefore investigated PTK2B knockdown-mediated modulation of MAPK activity. Compared to BRAF wild-type lines (T98G, U251), the BRAF^V600E-heterozygous DBTRG-05MG cells exhibited MAPK hyperactivation, showing elevated levels of pMEK1/2 and pERK1/2 (Fig. 8a). Surprisingly, PTK2B knockdown further enhanced this activity, markedly increasing levels of BRAF^V600E, pMEK1/2, pERK1/2 and autophosphorylated pBRAF-S729, a well-recognized marker of BRAF activation [61] (Fig. 8b). Conversely, further PTK2B overexpression in DBTRG-05MG cells effectively suppressed pERK1/2 level (Fig. 8c). Similar results were obtained in another BRAF^V600E‑mutant glioma cell line, AM-38 (Fig. S14a). Consistent with these findings, truncated dRaf^GOF and pERK were substantially upregulated in the Drosophila glioma model. Fak knockout further elevated their expression, and this enhancement was suppressed by Fak overexpression (Fig. 8d). In striking contrast, PTK2B exerted opposite effects in BRAF wild‑type T98G and U251 cells: knockdown reduced pERK1/2, pMEK1/2 and pBRAF levels, whereas overexpression increased them (Fig. S14b and S14c), suggesting a correlation with the pro‑proliferative role of PTK2B observed in these cells (Fig. S5b). Similarly, Fak overexpression in wild‑type flies activated MAPK and promoted glial proliferation (Fig. S5f–S5h). Based on these results, we conclude that PTK2B is a key negative regulator of the MAPK pathway specifically in BRAF^V600E glioma cells.

Fig. 8.

Highly expressed PTK2B and hyperactive MAPK signaling synergistically maintain tumor growth through an interlocking mechanism. a Western blot analysis for MAPK signaling factors of three glioma cell lines DBTRG-05MG, T98G and U251. b Western blot analysis for MAPK signaling factors of DBTRG-05MG cells with or without PTK2B knockdown. c Western blot analysis for of DBTRG-05MG cells with or without PTK2B overexpression. d Western blot analysis for MAPK signaling of Drosophila late 3rd instar larval brains. e Western blot analysis for pMEK1/2, pERK1/2 and PTK2B of DBTRG-05MG cells treated with PD and Ulix. In the left schematic, blue labels denote key molecules of MAPK signaling pathway; orange labels show inhibitors action sites. f-g CCK-8 assays were performed to assess the effects of PD, Ulix and PTK2B knockdown on cell viability (n = 6) (f) and proliferation (n = 6) (g) in DBTRG-05MG cells. h-i CCK-8 assays were performed to assess the effects of Enco, PD and PTK2B knockdown on cell viability (n = 6) (f) and proliferation (n = 6) (g) in DBTRG-05MG cells. j Western blot analysis for ER stress, autophagy, ferroptosis and apoptosis markers of DBTRG-05MG cells treated with PD and Ulix. In the left schematic, blue labels/arrows denote key protein changes for autophagy initiation, autophagic late-stage disruption and ferroptosis. ****P < 0.0001

To examine whether MAPK signaling reciprocally regulates PTK2B, we inhibited the pathway using MEK1/2 inhibitor PD0325901 (PD) and ERK1/2 inhibitor Ulixertinib (Ulix). Western blot assay indicated that PD suppressed MEK1/2 expression and abolished ERK1/2 phosphorylation, while Ulix directly inhibited ERK1/2 expression (Fig. 8e). Notably, due to a feedback loop [62], both inhibitors led to increased phosphorylation of their direct targets (pMEK1/2 with PD and pERK1/2 with Ulix), although the kinase activities of MEK1/2 and ERK1/2 were blocked by the respective inhibitors. At the same time, MAPK inhibition substantially upregulated PTK2B expression, suggesting that MAPK also acts as a negative regulator of PTK2B expression (Fig. 8e). Collectively, these results demonstrated an interlocking regulatory mechanism between PTK2B and MAPK signaling pathway in BRAF^V600E glioma, where loss of either one triggers compensatory upregulation of the other.

Given this compensatory mechanism, we hypothesized that co-inhibition of both pathways would yield superior anti-tumor effects. Indeed, while PD or Ulix alone dramatically reduced cell viability and proliferation of DBTRG-05MG (PD: ~45%, Ulix: ~50%, Fig. 8f and g), their combination with PTK2B knockdown synergistically exacerbated cell death and proliferation suppression (~ 80%, Fig. 8f and g). This potent synergy demonstrates that the PTK2B-MAPK reciprocal compensatory mechanism not only confers a survival advantage to glioma cells but also underscores the necessity of dual-pathway targeting for effective therapeutic intervention.

To further explore the therapeutic potential of PTK2B in BRAF^V600E glioma, we evaluated Encorafenib, a selective BRAF^V600E inhibitor. In both DBTRG-05MG and AM-38 cells, Encorafenib monotherapy or PTK2B knockdown alone significantly suppressed cell viability and proliferation, and their combination yielded a markedly enhanced inhibitory effect, also suggesting a synergistic effect (Fig. 8h and i, S14d and S14e). Given that combined BRAF/MEK inhibition is a standard clinical regimen for certain tumors, we further compared conventional dual inhibition (Encorafenib + PD0325901) with the addition of PTK2B knockdown. While dual inhibition considerably inhibited cell viability and proliferation, the addition of PTK2B knockdown further potentiated this effect, resulting in the most pronounced suppression (Fig. 8h and i, S14d and S14e). Collectively, these findings suggest that PTK2B may contribute to resistance to targeted therapy, and that combining PTK2B targeting with existing regimens could help overcome such resistance.

Having established the interlocked mechanism, we investigated whether MAPK inhibition also induces ferroptosis and, if so, whether it shares the same downstream pathway as PTK2B knockdown. Western blot analysis revealed that MAPK inhibition triggered autophagy initiation (elevated LC3B-II, Beclin-1 and ATG5; reduced p-mTOR) and disrupted autophagic flux (P62 accumulation). Additionally, elevated ACSL4 and reduced GPX4 demonstrated ferroptosis induction (Fig. 8j). Unlike PTK2B knockdown, it did not induce ER stress, as evidenced by unchanged levels of GADD34, ATF4, p-PERK, p-IRE1 and ATF6 (Fig. 8j). Taken together, these findings indicate that MAPK inhibition triggers ferroptosis through autophagic flux disruption, a converging point with PTK2B knockdown-induced cell death. In BRAF^V600E glioma, the co-existing highly expressed PTK2B and hyperactivated MAPK signaling cooperatively sustain tumor progression. Their dynamically negative feedback regulation converges on autophagic flux disruption-induced ferroptosis.

Discussion

BRAF ^V600E defines a distinct subset of gliomas characterized by constitutive MAPK pathway activation that drives tumor proliferation [1, 3, 63]. However, acquired and adaptive drug resistance limits the efficacy of current BRAF/MEK combination therapies [9, 64, 65]. PTK2B, a Ca²⁺-dependent FAK-family kinase with more restricted expression than PTK2, is involved in MAPK signaling and has been implicated to several malignancies, yet its function in BRAF^V600E glioma remains unclear [13, 66]. In this study, we establish PTK2B as a critical regulator in BRAF^V600E glioma, demonstrating that it mechanistically connects ER stress, autophagic flux disruption, and ferroptosis. We further reveal the reciprocal negative feedback regulatory relationship between PTK2B and MAPK signaling. Inhibiting either PTK2B or MAPK signaling alone induces ferroptosis, while dual inhibition achieves synergistic cell death, highlighting the therapeutic potential of combination strategy (Fig. 9).

Fig. 9.

Schematic diagram of the interlocking mechanism between PTK2B and MAPK signaling in BRAF^V600E glioma. Interlocked PTK2B and MAPK signaling sustain growth of BRAF^V600E glioma, yet co-inhibition unleashes synergistic ferroptosis and maximal tumor cell death

High expression of PTK2B has been reported in a range of malignancies such as breast, liver, lung cancers, as well as leukemia and glioma [13], although the relevant regulatory mechanisms driving this phenomenon are poorly understood. A recent study in pancreatic ductal adenocarcinoma (PDAC) suggested that a stiff tumor microenvironment upregulates PTK2B expression [67]. In glioma, our study revealed that this upregulation is specifically linked with BRAF^V600E mutation. A similar mechanism might be involved in this context, a hypothesis that warrants further testing.

In contrast to the specific upregulation of PTK2B, PTK2 expression remained unchanged in BRAF^V600E glioma, indicating its non-essential role in this context. The elevated expression of PTK2B and the anti-tumor effect observed upon its knockdown in our study support its compelling therapeutic potential in BRAF^V600E glioma. Although dual PTK2B/PTK2 inhibitors (e.g., PF-04554878, PF-431396 [68]) exhibit potent anti-tumor effects, their clinical utility may be limited by PTK2-related adverse effects due to its ubiquitous expression [11]. This safety concern is supported by genetic evidence: PTK2 knockout in mice results in embryonic lethality, whereas PTK2B knockout mice remain viable and fertile [69, 70]. Thus, we believe that highly selective PTK2B inhibition may be more therapeutically beneficial in BRAF^V600E glioma. The development of PTK2B-selective inhibitors, which may promise an improved safety profile and efficacy, represents a challenging yet important direction for future drug discovery.

Our study showed the distinct Golgi apparatus enrichment of PTK2B in BRAF^V600E glioma, and similar observations were also reported [71, 72]. This specific localization is functionally significant, as PTK2B knockdown induced obvious morphological and functional abnormalities. Proteomic analysis revealed significant enrichment in vesicle transport pathways upon PTK2B knockdown, aligning with previous evidence of PTK2B’s role in vesicle transport [72], and supporting our hypothesis that PTK2B deficiency compromises Golgi-mediated protein sorting and transport. Consequently, we observed ER swelling and activation of all three UPR branches, indicating severe ER stress. We propose that such ER stress results from the accumulation of unfolded/misfolded proteins due to Golgi-related transport defects [48, 73], establishing a mechanistic link between PTK2B knockdown, Golgi dysfunction, and ER proteostasis disruption in BRAF^V600E glioma.

Our results defined a PTK2B-regulated cell death axis in BRAF^V600E glioma, wherein ER stress drives aberrant autophagy initiation but disrupts autophagic flux, ultimately inducing ferroptosis. While ER stress is known to trigger both autophagy initiation and autophagic flux disruption [74–76], and ferroptosis is often considered as an autophagy-dependent process [77, 78], our findings reveal a unique mechanism. In contrast to established ER stress-ferritinophagy pathways that execute ferroptosis through complete autophagic flux in other studies such as glioblastoma drug resistance [79] and kidney injury [80], our study demonstrated that in BRAF^V600E glioma, ER stress-induced autophagic flux disruption promoted ferroptosis specifically through iron accumulation and lipid peroxidation, independent of ferritin autophagy. This distinct mechanism uncovers a previously underappreciated mode of cell death induction and offers in-depth mechanistic insights into PTK2B-targeted therapy for BRAF^V600E glioma.

Contrary to the conventional view that PTK2B activates MAPK signaling [81–83], our results uncovered a context-dependent negative regulatory function for PTK2B on MAPK pathway in BRAF^V600E glioma. Reduced p-mTOR level upon PTK2B knockdown provides a mechanistic link for MAPK signaling activation (Fig. 5b), given that mTORC1 inhibition can activate MAPK signaling in human cancers [84]. In addition, similar negative regulation was recapitulated in our Drosophila glioma model, wherein knockout of Fak also led to MAPK pathway activation. In Drosophila, previous reports documented analogous inhibitory mechanisms in other tissues [20, 85].

MAPK hyperactivation is a hallmark of BRAF^V600E-driven tumors [60], yet existing BRAF^V600E and MAPK-targeted therapies frequently face drug resistance [9, 65]. Our study identified an important interlocking mechanism between PTK2B and MAPK signaling in BRAF^V600E glioma, which may underly this limitation. While inhibiting either the elevated PTK2B or the hyperactivated MAPK signaling pathway induced ferroptosis via autophagic flux disruption and decreased viability, each intervention triggered compensatory upregulation of the other pathway. This reciprocal compensatory mechanism attenuated glioma cell death, revealing the basis of drug resistance to monotherapy targeting PTK2B or MAPK signaling. Therefore, simultaneous inhibition of PTK2B and MAPK signaling synergistically suppressed tumor growth and exerted maximal anti-tumor effects, highlighting the promising clinical potential of a combination therapy strategy.

Although we could not directly decipher the PTK2B functions in BRAF^V600E‑mutant pediatric low‑grade glioma cells, the adult‑derived glioma cell lines used in this study effectively support our key findings of PTPK2B functions, which were validated only in two BRAF^V600E glioma cell lines (DBTRG‑05MG and AM‑38) but not in BRAF wild‑type lines (T98G and U251). We believe that the observed PTK2B‑mediated cell death axis and its interlocking relationship with MAPK signaling are solely dependent on the BRAF^V600E mutation. Thus, it may provide a solid basis for all BRAF^V600E gliomas, including pediatric low‑grade glioma.

Conclusions

In this study, we identified PTK2B as an actionable therapeutic target for BRAF^V600E glioma. PTK2B was highly expressed in BRAF^V600E glioma patients and cell line, and its knockdown significantly suppressed tumor development. The critical role of PTK2B was further validated in a Drosophila dRaf^GOF glioma model, where its homologue, Fak, exhibited similarly elevated expression and Fak knockout also inhibited tumor growth. We elucidated that PTK2B knockdown exerted a remarkable anti-tumor effect by triggering ferroptosis in BRAF^V600E glioma via ER stress-induced autophagic flux disruption. Most importantly, we demonstrated the interlocking mechanism between highly expressed PTK2B and hyperactive MAPK signaling pathway in BRAF^V600E glioma, helping to explain monotherapy resistance. The combined inhibition of PTK2B and MAPK signaling achieved maximal suppression of glioma growth, highlighting its excellent prospects as a therapeutic strategy.

Authors’ contributions

M.W. conceived the study, performed the experimental work, analyzed the data and wrote the original draft; C.X. and S.X. provided research materials for the experiments and contributed to data analysis; J.J. was responsible for data curation and visualization; P.Z., J.L., and C.W. provided methodological support and resources; Y.X. and X.Y. supervised the project, provided financial support and reviewed the manuscript. All authors contributed to the final approval of the manuscript.

Funding

This study was supported by the Startup Funding of International institutes of medicine, Zhejiang University (Q23019).

Data availability

Raw data of RNA sequencing generated in this study have been deposited in the Sequence Read Archive (SRA) under accession codes PRJNA1335410. Raw data of proteomics generated in this study have been deposited to the ProteomeXchange Consortium ( https://proteomecentral.proteomexchange.org ) via the iProX partner repository [86, 87] with the dataset identifier PXD069243. Publicly available gene expression data (accession: GSE60898) were also analyzed. All other data supporting the findings are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

The experimental and specimen collection procedures were reviewed and approved by the Research Ethics Board at the Children’s Hospital, Zhejiang University School of Medicine (Ethical Approval No.: 2022-IRB-181). Authors have adhered to the principles of the Declaration of Helsinki.

Consent for publication

All authors approved and consented the manuscript for publication.

Competing interests

The authors declare no competing interests.