Generation of two induced pluripotent stem cell lines from dilated cardiomyopathy patients with TTN mutations

Abstract

Titin (TTN) encodes the largest protein in the human body and is essential for sarcomere assembly and muscle mechanosensation. Truncating TTN mutations are a leading cause of dilated cardiomyopathy (DCM). Here, we generated two induced pluripotent stem cell (iPSC) lines from female DCM patients, each carrying a heterozygous nonsense point mutation that produces a truncated titin protein. Both lines were reprogrammed from peripheral blood mononuclear cells (PBMCs) and characterized for expression of undifferentiated human iPSC state markers, tri-lineage differentiation capacity, and genomic integrity by copy-number analysis. These lines provide a patient-derived platform for investigating the mechanobiological basis of titin-truncation DCM in vitro.

1. Resource table

Unique stem cell lines identifier	1) SCVIi170-A; 2) SCVIi171-A
Alternative name(s) of stem cell lines	1) SCVI3138 (SCVIi170-A); 2) SCVI2254 (SCVIi171-A)
Institution	Stanford Cardiovascular Institute, Stanford, CA, USA
Contact information of distributor	Joseph C. Wu, joewu@stanford.edu
Type of cell lines	iPSC
Origin	Human
Additional origin info required for human ESC or iPSC	Age: 34 (SCVIi170-A), 54 (SCVIi171-A). Sex: Female. Ethnicity if known: Not Hispanic or Latino.
Cell Source	PBMCs
Clonality	Clonal
Method of reprogramming	Sendai virus vectors (POU5F1, SOX2, KLF4, MYC)
Genetic Modification	YES
Type of Genetic Modification	Hereditary
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	RT-qPCR
Associated disease	Dilated cardiomyopathy (DCM)
Gene/locus	1) SCVIi170-A: c.77157G > A, p. Trp25719*; 2) SCVIi171-A: c.84819G > A, p. Trp28273*
Date archived/stock date	1) 04/20/2023 (SCVIi170-A); 2) 10/14/ 2019 (SCVIi171-A)
Cell line repository/bank	1) SCVIi170-A: https://hpscreg.eu/cell-line/SCVIi170-A; 2) SCVIi171-A: https://hpscreg.eu/cell-line/SCVIi171-A
Ethical approval	The generation of the lines was approved by the Administrative Panel on Human Subjects Research at Stanford University under IRB #29904 and #64753.

2. Resource utility

Truncating TTN variants are among the most common genetic drivers of dilated cardiomyopathy (DCM), yet patient-specific models remain scarce. We report two iPSC lines harboring distinct nonsense mutations (p.Trp25719* and p.Trp28273*), offering a platform to interrogate how titin truncation disrupts cardiomyocyte structure and function and to screen candidate interventions.

3. Resource details

Titin, encoded by the TTN gene, is the largest polypeptide in the human body. It sets passive stiffness and serves as a molecular template for sarcomere assembly. Truncating variants in TTN are the most frequently identified genetic cause of DCM (Huang et al., 2023), in which the left ventricle dilates and loses systolic performance. DCM is estimated to affect approximately 1 in 250 people and is the major contributor to heart failure (Heymans et al., 2023). For these truncating alleles, disease arises from a combination of reduced full-length titin and toxicity of the truncated titin protein, which may integrate into the sarcomere or accumulate as intracellular aggregates (Fomin et al., 2021; McAfee et al., 2021). Because disease severity varies widely among carriers of the same gene, human cardiomyocyte models that retain each patient's endogenous allele and genetic background are useful for elucidating genotype-to-phenotype relationships and for preclinical evaluation of candidate therapeutics.

In this study, we derived two iPSC lines, SCVIi170-A and SCVIi171-A, from the PBMCs of two unrelated patients with clinically diagnosed DCM. SCVIi170-A carries TTN c.77157G > A (p.Trp25719*) and SCVIi171-A carries TTN c.84819G > A (p.Trp28273*), numbered against the inferred complete TTN transcript NM_001267550.2 (Table 1). Reprogramming used non-integrating Sendai-virus vectors, and clonal lines were established for characterization. The lines grew as flat, sharply bordered colonies typical of human iPSCs (Fig. 1A; scale bars, 500 μm). RT-qPCR confirmed NANOG and SOX2 expression in both lines, in contrast to the iPSC-derived cardiomyocytes (iPSC-CMs) as a negative control and SCVIi273-A as a positive reference (Fig. 1B). Immunostaining showed colocalization of undifferentiated iPSC state markers SOX2, NANOG, and OCT3/4 throughout both cultures (Fig. 1C; scale bars, 100 μm). On directed differentiation, each line yielded all three germ layers, identified by OTX2 and PAX6 (ectoderm), SOX17 and FOXA2 (endoderm), and BRACHYURY and TBX6 (mesoderm) (Fig. 1D; scale bars, 100 μm). Sanger sequencing resolved each line's substitution against a wild-type reference, confirming c.77157G > A in SCVIi170-A and c.84819G > A in SCVIi171-A (Fig. 1E). Copy-number profiles from low-pass whole-genome sequencing were balanced across every chromosome, with no segmental gains or losses (Fig. 1F). The Sendai genome, quantifiable at passage 13, fell below detection by passage 28 in SCVIi170-A and passage 30 in SCVIi171-A (Fig. 1G). Both lines were negative for mycoplasma (Fig. 1H), and STR profiles were concordant between each line and its parental PBMCs (Supplementary Data). Together, these genotype-defined lines expand the resources available for studying TTN-driven DCM in patient-specific cardiomyocytes.

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography bright field	Visual record of the line: normal	Fig. 1 panel A
Phenotype	Qualitative analysis: Immunofluorescence	Positive expression of undifferentiated hPSC state markers: OCT3/4, NANOG, SOX2.	Fig. 1 panel C
	Quantitative analysis: RT-qPCR	NANOG and SOX2 are expressed in both established iPSC lines, the control iPSC line, and absent in iPSC-derived cardiomyocyte (iPSC-CM)	Fig. 1 panel B
Genotype	Whole genome sequencing (WGS)	1) SCVIi170-A: 46,XX 2) SCVIi171-A: 46,XX (Low-pass WGS-based copy-number assessment of genomic integrity)	Fig. 1 panel F
Identity	Microsatellite PCR (mPCR) STR analysis	N/A Tested 16 loci, match well between iPSC and PBMC	N/A Submitted to the journal
Mutation analysis (IF APPLICABLE)	Sequencing	Heterozygous mutation (in all lines)	Fig. 1 panel E
	Southern blot or WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Mycoplasma testing by luminescence: Negative	Fig. 1 panel H
Differentiation potential	Directed differentiation	Positive immunofluorescence staining of three germ layer markers	Fig. 1 panel D
List of recommended germ layer markers	Expression of these markers has to be demonstrated at mRNA (RT-PCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer	Ectoderm: PAX6, OTX2; Endoderm: SOX17, FOXA2; Mesoderm: BRACHYURY, TBX6.	Fig. 1 panel D
Donor screening (OPTIONAL)	HIV 1 + 2, Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping HLA tissue typing	N/A N/A	N/A N/A

Fig. 1.

Characterization of TTN mutation iPSC lines SCVli170-A and SCVli171-A.

4. Materials and methods

4.1. Reprogramming

iPSCs were established as previously described (Liu et al., 2025). Peripheral blood mononuclear cells (PBMCs) were recovered from whole blood by Percoll density gradient centrifugation (Cat #17089109, GE Healthcare) and rinsed three times in PBS (Cat #14190144, Thermo Fisher Scientific). The recovered cells were expanded in StemPro-34 SFM (Cat #10639011, Thermo Fisher Scientific) supplemented with 100 ng/mL stem cell factor (Cat #300–07, Peprotech), 100 ng/mL FLT3 ligand (Cat #PHC9414, Thermo Fisher Scientific), 20 ng/mL IL-3 (Cat #200–03, Peprotech), 20 ng/mL IL-6 (Cat #PHC0063, Thermo Fisher Scientific), and 20 ng/mL erythropoietin (Cat #PHC9631, Thermo Fisher Scientific). Reprogramming was carried out with the CytoTune-iPSC 2.0 Sendai Reprogramming Kit (Cat #A16517, Thermo Fisher Scientific) per the manufacturer's protocol. Transduced cells were transferred onto plates pre-coated with Matrigel (0.2% v/v in DMEM/F12; Cat #356231, Corning) and maintained in StemPro-34 medium with daily medium renewal. On day 7 post-transduction, the medium was transitioned to StemMACS iPS-Brew XF (Cat #130–104–368, Miltenyi Biotec) plus iPS-Brew supplement XF (Cat #130–107–087, Miltenyi Biotec) to promote colony emergence. Colonies displaying characteristic iPSC morphology arose between days 10 and 15, after which they were manually isolated, propagated, and cryopreserved.

4.2. Cell culture

iPSCs were cultured in StemMACS iPSC-Brew XF and iPSC-Brew supplement according to the manufacturer's instructions. Cells were maintained at 37 °C under 5% CO₂ and 20% O₂. At ~ 80% confluency, they were passaged onto Matrigel-coated plates at a 1:6 ratio using 0.5 mM EDTA (Cat #15575–038, Invitrogen) for 4 min. 10 μM Y-27632 (Cat #S1049, Selleck) was supplemented for 24 h after passaging.

4.3. Trilineage differentiation

iPSC pluripotency was validated through differentiation into ectoderm, mesoderm, and endoderm at passage 20. For ectoderm differentiation, cells were treated with the Human Pluripotent Stem Cell Functional Identification Kit (Cat #SC027B, R&D Systems). For mesoderm, cells were differentiated with RPMI media (Cat #11875–085, Gibco) supplemented with 6 μM CHIR-99021 (Cat #S2924, Selleck) and B27 minus insulin (Cat #A18956–01, Gibco). For endoderm, cells were induced with STEMdiff endoderm basal medium (Cat #05233, Stemcell Technologies) supplemented with 100 ng/mL Activin A (Cat #A2422, Selleck) and 3 μM CHIR-99021 on day 1, after which 100 ng/mL Activin A alone was given on days 2 and 3.

4.4. Immunofluorescence

Immunofluorescence was adapted from a previously described method (Liu et al., 2023). Cells were fixed in 4% paraformaldehyde for 10 min and then permeabilized with 0.2% Triton X-100 (Cat #X100, Sigma-Aldrich) for 10 min at room temperature (RT). DPBS (Cat #14190144, Thermo Fisher Scientific) containing 2% BSA (Cat #A9418, Sigma-Aldrich) was used to block non-specific binding for 1 h at RT. Samples were subsequently incubated with primary antibodies diluted in blocking buffer overnight at 4 °C. Following three DPBS rinses, cells were incubated with secondary antibodies for 1 h at RT. Nuclei were counterstained with DAPI (1:2000; Cat #D1306, Thermo Fisher Scientific) for 10 min. (Table 2).

Table 2.

Reagents details.

Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Undifferentiated hPSC state marker	Mouse IgG1κ Anti-Sox2	1:200	Santa Cruz Biotechnology Cat #sc-365823	AB_10842165
Undifferentiated hPSC state marker	Rabbit Anti-Nanog	1:200	Proteintech, Cat #14295-1-AP	AB_1607719
Undifferentiated hPSC state marker	Mouse IgG2bκ Anti-Oct-3/4	1:200	Santa Cruz Biotechnology, Cat #sc-5279	AB_628051
Ectoderm marker	Rabbit Anti-Pax6	1:250	Thermo Fisher Scientific, Cat #42-6600	AB_2533534
Ectoderm marker	Goat Anti-Otx2	1:250	R&D Systems, Cat #963273	AB_2157172
Mesoderm marker	Rabbit Anti-Tbx6	1:250	Thermo Fisher Scientific, Cat #PA5-35102	AB_2552412
Mesoderm marker	Goat Anti-Brachyury	1:250	R&D Systems Cat #963427	AB_2200235
Endoderm marker	Rabbit Anti-Foxa2	1:250	Thermo Fisher Scientific Cat #701698	AB_2576439
Endoderm marker	Goat Anti-Sox17	1:250	R&D Systems, Cat #963121	AB_355060
Conjugated Secondary antibody	Alexa Fluor 555 Goat Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific, Cat #A-21428	AB_141784
Conjugated Secondary antibody	Alexa Fluor 488 Goat Anti-Mouse IgG1	1:500	Thermo Fisher Scientific, Cat #A-21121	AB_2535764
Conjugated Secondary antibody	Alexa Fluor 647 Goat Anti-Mouse IgG2b	1:500	Thermo Fisher Scientific, Cat #A-21242	AB_2535811
Conjugated Secondary antibody	Alexa Fluor 555 Donkey Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific, Cat #A-31572	AB_162543
Conjugated Secondary antibody	Alexa Fluor 488 Donkey Anti-Goat IgG (H + L)	1:500	Thermo Fisher Scientific, Cat #A-11055	AB_2534102
Primers	Target	Size of band	Forward/Reverse primer (5′-3′)
Genotyping	SCVIi170-A: TTN c.77157G > A (p.Trp25719*)	361 bp	CAGCTCCAAGAAGGTTGCAG/ACCGAGGATCACTTCTCCCC
Genotyping	SCVIi171-A: TTN c.84819G > A (p.Trp28273*)	367 bp	TGAAAGTCTCCGGCCTTGAT/ACTGAGTCAGCAGCATTCCT
Sendai virus sequence (TaqMan assay)	Sendai virus genome	181 bp	Mr04269880_mr
Undifferentiated hPSC state marker (TaqMan Assay)	SOX2	258 bp	Hs04234836_s1
Undifferentiated hPSC state marker (TaqMan Assay)	NANOG	327 bp	Hs02387400_g1
Housekeeping gene (TaqMan Assay)	GAPDH	471 bp	Hs02786624_g1

4.5. RT-qPCR

Total RNA was isolated using the Direct-zol RNA MicroPrep kit (Cat #R2062, Zymo Research) and reverse transcribed with HiScript IV All-in-One Ultra RT SuperMix (Cat #R433–01, Vazyme). RNA quality was verified with a NanoDrop 2000 Spectrophotometer by the A260/A280 ratio. Undifferentiated hPSC state markers and the Sendai virus genome were detected by TaqMan Gene Expression Assays (Table 2) on a Bio-Rad CFX96. For Sendai virus genome detection, RNA was prepared from passages 13 and 28 of SCVIi170-A and passages 13 and 30 of SCVIi171-A. Passage 20 iPSCs were used to detect undifferentiated iPSC state markers.

4.6. Sanger sequencing

iPSCs at passage 20 were used for Sanger sequencing. Genomic regions of interest were amplified with KOD One PCR Master Mix (Cat #KMM-101, Toyobo) using the primer pairs listed in Table 2. PCR products were size-checked by agarose gel electrophoresis, purified with the QIAquick PCR Purification Kit (Cat #28104, Qiagen), and Sanger sequenced by Genewiz.

4.7. Copy number analysis by low-pass whole-genome sequencing (WGS)

2 × 10⁶ cells at passage 20 were sent to Novogene for low-pass WGS. Sequence reads were mapped to the GRCh38 human assembly, and copy number was inferred from read counts tallied in 1 Mb bins genome-wide. As a depth-based approach, the assay detects only copy-number aberrations and is blind to copy-number-neutral events, including balanced translocations, inversions, and copy-neutral loss of heterozygosity. In addition, low-level mosaic abnormalities present in only a minority of cells may not produce a detectable shift in bin coverage. Balanced whole-genome ploidy changes can be masked by genome-wide normalization.

4.8. Short tandem repeat (STR) analysis

Genomic DNA from both lines at passage 20 was isolated with the DNeasy Blood & Tissue Kit (Cat #69504, Qiagen) and quantified with Qubit dsDNA Quantification Assay Kits (Cat #Q32851, Thermo Fisher Scientific). DNA was amplified with the AmpFLSTR Identifiler Plus PCR Amplification Kit (Cat #4427368, Thermo Fisher Scientific) and submitted to Genewiz for fragment analysis on an ABI 3730 Genetic Analyzer (Applied Biosystems).

4.9. Mycoplasma assay

Mycoplasma contamination of iPSCs at passage 20 was assessed with the MycoAlert Detection Kit (Cat #LT07–318, Lonza) according to the manufacturer's instructions.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2026.104065.

Data availability

Data will be made available on request.