Co-exposure to high temperature and mono(2-ethylhexyl) phthalate inhibits mouse antral follicle growth and estradiol synthesis: phthalate-heat interactions in the ovary

Abstract

Humans are ubiquitously exposed to di(2-ethylhexyl) phthalate (DEHP), which is a phthalate plasticizer used in consumer goods that has been identified as a reproductive toxicant. DEHP toxicity is mediated by mono(2-ethylhexyl) phthalate (MEHP), its bioactive metabolite that has been shown to target ovarian processes, including folliculogenesis and steroidogenesis. Simultaneously, humans are ubiquitously exposed to nonchemical stressors like high temperatures, which have also been shown to impair ovarian function. Given the unavoidable exposure to both increasing heat and DEHP, this study tested the hypothesis that exposure to high temperature will exacerbate the negative effects of MEHP exposure on antral follicle function. Antral follicles from CD-1 mice were cultured for 24 to 96 h with vehicle control (DMSO) or MEHP (0.2 to 20 µg/ml) at a control temperature (CT; 37 °C) or high temperature (HT; 42 °C, 8 h per 24 h) to assess effects on follicle growth and steroidogenesis. Compared with control (CT+DMSO), HT+DMSO and HT+MEHP inhibited the cell cycle and steroidogenic pathway and upregulated follicle-stimulating hormone receptor expression. CT+MEHP, HT+DMSO, and HT+MEHP decreased estradiol levels over time, and HT+DMSO and HT+MEHP also inhibited antral follicle growth compared with CT+DMSO. Therefore, MEHP exposure decreased estradiol levels, whereas HT exposure and HT+MEHP co-exposure decreased estradiol levels and follicle growth by inhibiting the steroidogenic pathway and cell cycle. Further, several significant interactions were identified, providing the first evidence of a phthalate-heat interaction in a mammalian model. Thus, exposure to ubiquitous chemical and nonchemical stressors, like MEHP and HT, disrupt critical ovarian processes and may potentiate ovarian dysfunction when combined.

Di(2-ethylhexyl) phthalate (DEHP) is a plasticizer used in various consumer goods including food and beverage packaging, floor and ceiling tiles, automobile and furniture upholstery, and medical devices (Hannon and Flaws 2015). Due to the extensive use of DEHP and its ability to leach out of these consumer goods, humans are ubiquitously exposed via oral ingestion, dermal contact, and inhalation. Upon absorption, DEHP is rapidly metabolized to its primary monoester metabolite, mono(2-ethylhexyl) phthalate (MEHP). MEHP has been detected in various human matrices including blood, urine, breast milk, and ovarian follicular fluid (Högberg et al. 2008; Kondo et al. 2010; Genuis et al. 2012; Du et al. 2019; Li et al. 2022c, 2023; Wang et al. 2023), and this is concerning because MEHP is a known endocrine-disrupting chemical (EDC). Important for this study, the detection of MEHP in follicular fluid means that MEHP can target the ovary (Du et al. 2016; Wang et al. 2023; Land et al. 2025).

Two processes critical for normal ovarian function are folliculogenesis and steroidogenesis. Folliculogenesis is the growth and maturation of follicles, which serve as the functional units of the ovary. Steroidogenesis is the production of sex steroid hormones from mature follicles known as antral follicles (Hannon and Flaws 2015). Antral follicles consist of the oocyte surrounded by several layers of granulosa cells, a fluid-filled cavity known as the antrum, and 2 outer layers of theca cells. Theca cells produce androgens via luteinizing hormone (LH) signaling, and androgens are converted to estrogens, especially estradiol, by granulosa cells via follicle-stimulating hormone (FSH) signaling (Palermo 2007). Coordination of estradiol and FSH actions leads to maturation of the follicle to the preovulatory stage, where the follicle is capable of ovulation due to increased levels of luteinizing hormone/choriogonadotropin receptor (LHCGR) now contained in granulosa cells (Casarini and Crépieux 2019). These processes are tightly regulated, and any disruptions to folliculogenesis and steroidogenesis can negatively impact female reproductive and nonreproductive health (Craig et al. 2011; Chan and Pek 2026). Interestingly, MEHP has been found to disrupt these critical ovarian processes in human and animal models (Land et al. 2025). In women, increased urinary levels of MEHP were associated with decreased antral follicle count and decreased ovarian reserve, and increased serum levels of MEHP were associated with decreased estradiol levels (Messerlian et al. 2016; Li et al. 2022b; Hu et al. 2024). In mice, studies have shown that MEHP exposure inhibited antral follicle growth, decreased estradiol levels, and induced follicle death, or atresia (Gupta et al. 2010; Wang et al. 2012; Craig et al. 2014; Hannon et al. 2015). Although increasing evidence identifies MEHP as a reproductive toxicant, it is unknown how additional environmental exposures or conditions may interact with and modify its effects on the ovary.

Extreme weather events are increasingly recognized as significant threats to human health and may influence both chemical toxicity and individual susceptibility to chemical stressors like MEHP (Young et al. 2004; Cardoso et al. 2017; Li et al. 2022a). In particular, extreme heat events are projected to increase in frequency and duration, and these events pose severe health risks such as heat exhaustion, heat stroke, exacerbated chronic disease, or death (Anderson et al. 2013; Gibb et al. 2024; Amoatey et al. 2025). Although extreme heat events are unpredictable, even modest increases in ambient temperature have been associated with measurable health impacts, particularly on female reproductive health. For example, a 1 °C increase in average maximum temperature over the 90 d preceding ovarian reserve testing was associated with lower antral follicle count, and each SD increase in mean, maximum, and apparent temperature over 1 mo was associated with higher odds of diminished ovarian reserve in women (Gaskins et al. 2021; Ji et al. 2025). These observations are consistent with the previously mentioned findings for MEHP exposure in women, suggesting that heat and MEHP may have similar effects on the ovary (Messerlian et al. 2016; Li et al. 2022b; Hu et al. 2024).

Importantly, studies have shown that the effects of EDCs, like bifenthrin, ethinylestradiol, and bisphenol A, are temperature-dependent in fish models (DeCourten and Brander 2017; Wu et al. 2022). Further, one study showed that increased temperature exacerbated the effects of levonorgestrel on ovary maturation in zebra fish, and another study showed that increased temperature accelerated the effects of DEHP toxicity in insect larvae via significant induction of endocrine and antioxidant responses (Park and Kwak 2014; Cardoso et al. 2017). However, studies have yet to investigate the effects of combined exposure to high temperatures and phthalates in mammalian models. Recent research has emphasized the importance of considering combined environmental stressors, recognizing that individuals are simultaneously exposed to mixtures of chemical and nonchemical stressors, which may interact to increase the risk of adverse health outcomes (Trowbridge et al. 2026). Given that exposure to MEHP and high temperatures is unavoidable and both have individually been associated with ovarian dysfunction (Gaskins et al. 2021; Ji et al. 2025; Land et al. 2025), investigating their combined effects is critical for understanding environmentally relevant exposure risks. Moreover, evidence that high temperatures can modify toxicity of other EDCs suggests that high temperatures may also modify the reproductive effects of MEHP.

Using a mouse in vitro follicle culture system, the present study is the first to investigate the effects of both individual and combined exposure to high temperature and MEHP on antral follicle growth, steroidogenesis, and survival. Specifically, we tested the hypotheses that: (i) individual and combined exposure to high temperature (HT) and MEHP alters regulators of the cell cycle, steroidogenesis, apoptosis, and oxidative stress response resulting in inhibited antral follicle growth and steroidogenesis, and (ii) exposure to high temperature will exacerbate the negative effects of MEHP exposure on antral follicle function.

Materials and methods

Chemicals

Stock solutions of MEHP at >96.5% purity (Sigma-Aldrich) were prepared with the vehicle, dimethylsulfoxide (DMSO; Sigma-Aldrich) in various concentrations (0.133, 1.33, and 13.33 mg/ml) ensuring a final DMSO concentration of 0.75 µg/ml in culture. Final concentrations of MEHP used in culture were 0.2, 2, and 20 µg/ml. These concentrations were selected based on previous research showing that such concentrations disrupt folliculogenesis (Hannon et al. 2015) and various concentrations inhibit antral follicle growth and steroidogenesis in mice (Gupta et al. 2010; Wang et al. 2012). Studies also show that the 0.2 and 2 µg/ml doses are representative of MEHP concentrations found in follicular fluid of women (Du et al. 2016; Wang et al. 2023). Due to the extensive use of phthalates in medical equipment and building products, there is an increased risk of medical or occupational exposure to higher concentrations of MEHP in certain populations (Petrovičová et al. 2016; Wang and Kannan 2023). The 20 µg/ml concentration was selected to represent this elevated exposure risk and to elucidate mechanisms of MEHP toxicity at increased doses.

Animals

Adult female CD-1 mice (postnatal days 32 to 39) were acquired from Charles River Laboratories and housed in the University of Kentucky’s Division of Laboratory Animal Resources (DLAR). All animal procedures involving animal care, euthanasia, and tissue collection were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Kentucky. All animals were housed in a controlled animal room environment (temperature at 22 °C ± 1 °C and 12L:12D cycles) and were provided food and water ad libitum.

In vitro mouse antral follicle culture

Each culture utilized 2 to 3 mice. Mice were humanely euthanized, and both ovaries were removed for mechanical isolation of early antral follicles (250 to 350 μm) using watchmaker’s forceps. Isolated follicles were transferred into individual wells of a 96-well plate. Treatment groups included DMSO (vehicle control) and MEHP (0.2, 2, and 20 µg/ml) prepared in supplemented α-MEM (Life Technologies). Supplemented α-MEM contained 10 ng/ml insulin, 5.5 ng/ml transferrin, 5.5 ng/ml selenium, 100 units/ml penicillin, 0.1 mg/ml streptomycin (Sigma-Aldrich), 5% fetal bovine serum (Atlanta Biologicals), and 5 international units/ml human recombinant follicle-stimulating hormone (FSH; Scripps Laboratories). Follicles were cultured for 24 to 96 h at either a control temperature (CT; 37 °C) or a high temperature (HT; 42 °C; 8 h/d). The 42 °C temperature was selected due to previous studies showing that mouse core temperatures reach 41 °C to 43 °C in heat stress and heat stroke models and that exposure to 42 °C impaired steroidogenesis in vitro and in vivo (Leon et al. 2005; Li et al. 2016; Miyamoto et al. 2021). Separate incubators were used for the CT and HT treatment groups, in which all HT treatments occurred for 8 h per 24 h period to model daytime, occupational exposure to high temperatures. Therefore, final treatment groups included CT+DMSO, CT+MEHP (0.2, 2, and 20 µg/ml), HT+DMSO, and HT+MEHP (0.2, 2, and 20 µg/ml) with 5 to 10 follicles per treatment per replicate (n = 4 to 9).

Analysis of follicle growth

Follicle growth was measured after plating (0 h) and at each 24 h culture timepoint via perpendicular diameters with an inverted microscope equipped with an eyepiece micrometer. Follicle diameter measurements were averaged per treatment group and are presented as percent change of each treatment group relative to their corresponding 0 h measurements, with 0 h set at 100%.

Analysis of gene expression

Follicles were collected at each timepoint (24, 48, 72, and 96 h) and frozen at −80 °C until quantitative real-time polymerase chain reaction (qPCR) analysis. Follicles were subjected to RNA extraction using the RNeasy Micro Kit (Qiagen, Inc.) according to the manufacturer’s protocol. The maximum amount of cDNA (100 or 200 ng) was reverse transcribed according to the manufacturer’s protocol using the iScript RT kit (Bio-Rad Laboratories, Inc.). All samples were diluted to 1.67 ng/μl for qPCR. The QuantStudio 3 Real-Time PCR System and QuantStudio Design and Analysis Software (Thermo Fisher Scientific) were used according to the manufacturer’s protocol. All qPCR reactions used cDNA, SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Inc) reagents, and forward and reverse primers (Integrated DNA Technologies) (500 pmol/μl). The SsoAdvanced Protocol consisted of a polymerase activation step (95 °C for 30 s), 45 cycles of amplification and quantification (95 °C for 10 s, 60 °C for 10 s, single fluorescence reading), and a melt curve (65 °C to 95 °C heating 0.5 °C per s, continuous fluorescence readings). Specific primer sequences for the genes of interest and reference gene (Actb) can be found in Table 1. Actb was selected as the reference gene as its expression did not significantly differ across time or between treatment groups.

Table 1.

Genes and SYBR primer sequences.

Gene symbol	Gene name	Forward sequence (5′–3′)	Reverse sequences (5′–3′)
Actb	Beta-actin (reference)	GGGCACAGTGTGGGTGAC	CTGGCACCACACCTTCTAC
Ccnd2	Cyclin D2	CCTTTGACGCAGGCTCCCTTCT	ACCCTGGTGCACGCATGCAAA
Cdk4	Cyclin-dependent kinase 4	AGAAACCCTCGCTGAAGCGGCA	TGGGGGTGAACCTCGTAAGGAGA
Ccne1	Cyclin E1	GGTGTCCTCGCTGCTTCTGCTT	CCGGATAACCATGGCGAACGGA
Ccna2	Cyclin A2	GCTCTACTGCCCGGAGGCTGA	TGGCCTACATGTCCTCTGGGGAA
Ccnb1	Cyclin B1	TGCATTCTCTCAGTGCCCTCCACA	AGACAGGAGTGGCGCCTTGGT
Cdkn1a	Cyclin-dependent kinase inhibitor 1A	TTAGGCAGCTCCAGTGGCAACC	ACCCCCACCACCACACACCATA
Star	Steroidogenic acute regulatory protein	CAGGGAGAGGTGGCTATGCA	CCGTGTCTTTTCCAATCCTCTG
Cyp11a1	Cytochrome P450 side-chain cleavage	AGATCCCTTCCCCTGGTGACAATG	CGCATGAGAAGAGTATCGACGCATC
Hsd3b1	3 Beta-hydroxysteroid dehydrogenase 1	CAGGAGAAAGAACTGCAGGAGGTC	GCACACTTGCTTGAACACAGGC
Cyp17a1	Cytochrome P450 steroid 17-alpha-hydroxylase 1	CCAGGACCCAAGTGTGTTCT	CCTGATACGAAGCACTTCTCG
Hsd17b1	17 Beta-hydroxysteroid dehydrogenase 1	ACTGTGCCAGCAAGTTTGCG	AAGCGGTTCGTGGAGAAGTAG
Cyp19a1	Cytochrome P450 aromatase	CATGGTCCCGGAAACTGTGA	GTAGTAGTTGCAGGCACTTC
Fshr	FSH receptor	GCAGATGTGTTCTCCAACCTACC	GGAGAGACTGGATCTTGTGAAAGG
Lhcgr	LH receptor	CTTATACATAACCACCATACCAG	ATCCCAGCCACTGAGTTCATTC
Bad	BCL2-associated agonist of cell death	AAGTCCGATCCCGGAATCC	GCTCACTCGGCTCAAACTCT
Bax	BCL2-associated X protein	GCCTTTTTGCTACAGGGTTTCA	TTCTTGGTGGACGCATCCTG
Bok	BCL2-related ovarian killer protein	CTGCCCCTGGAGGACGCTTG	CCGTCACCACAGGCTCCGAC
Bcl2	B cell leukemia/lymphoma 2	GATAACGGAGGCTGGGATGC	TCACTTGTGGCCCAGGTATG
Bcl2l10	Bcl2-like 10	CGCTACACACACTGACTGGA	CTTTAGGATCCCCTGCCCTG
Casp8	Caspase 8	CGAGAGGAGATGGTGAGAGAGC	CAGGCTCAAGTCATCTTCCAGC
Casp3	Caspase 3	TGGTGATGAAGGGGTCATTTATG	TTCGGCTTTCCAGTCAGACTC
Casp9	Caspase 9	GCCAGATGCTGTCCCCTATC	AGCATTGGCAACCTGGGAAG
Sod1	Superoxide dismutase 1	TTCCGTCCGTCGGCTTCTCGT	CGCACACCGCTTTCATCGCC
Sod2	Superoxide dismutase 2	GCCCAAACCTATCGTGTCCA	AGGGAACCCTAAATGCTGCC
Cat	Catalase	GCAGATACCTGTGAACTGTC	GTAGAATGTCCGCACCTGAG
Gpx1	Glutathione peroxidase 1	CCTCAAGTACGTCCGACCTG	CAATGTCGTTGCGGCACACC

Genes of interest included genes involved in cell cycle regulation (Ccna2, Ccnb1, Ccnd2, Ccne1, Cdk4, and Cdkn1a), ovarian steroidogenesis (Star, Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b1, Cyp19a1, Fshr, and Lhcgr), apoptosis (Bad, Bax, Bok, Bcl2, Bcl2l10, Casp8, Casp3, Casp9), and oxidative stress (Sod1, Sod2, Cat, Gpx1). The QuantStudio 3 Real-Time PCR System quantifies the amount of PCR product bound to SsoAdvanced Universal SYBR Green Supermix via fluorescence. Gene expression data were generated by subtracting the Actb cycle threshold (Ct) value from the gene of interest Ct value, calculating the ΔCt. The ΔΔCt was calculated by subtracting the ΔCt of the CT+DMSO groups from the ΔCt of the treatment groups. The relative fold change was then generated by calculating 2^(−ΔΔCt) per sample. Gene expression data are presented as fold change relative to the CT+DMSO group, which served as the overall control group.

Analysis of sex steroid hormone levels

Media were collected at each timepoint (24, 48, 72, and 96 h) and frozen at −80 °C until measurements of sex steroid hormone levels. Levels of pregnenolone, androstenedione, and estrone were measured following the manufacturer’s protocol using enzyme-linked immunosorbent assay (ELISA) kits (DRG International, Inc.) with sensitivities of 0.05 ng/ml, 0.021 ng/ml, and 8.1 pg/ml, respectively. All samples were run in duplicates and samples were diluted to match the range of the kits as needed. Levels of progesterone, testosterone, and estradiol were measured using Immulite Kits (Siemens Healthcare Diagnostic Products) with sensitivities of 0.2 ng/ml, 15 ng/dl, and 15 pg/ml, respectively. Immulite Kits were tested via an Immulite 1000 used in clinic, which enabled samples to be ran as singlets. Levels of dehydroepiandrosterone (DHEA) were undetectable using ELISA kits (DRG International, Inc.) and were therefore excluded from analysis.

Statistical analysis

GraphPad Prism 10 Software (GraphPad Software, Boston, MA) was used for statistical analyses. All data were analyzed via 2-way ANOVA followed by Dunnett’s post hoc test for differences versus baseline (CT+DMSO). Data with significant interactions were also followed by Tukey’s post hoc tests for differences between groups, including HT+MEHP treatment groups compared with CT+MEHP dose-equivalent groups and HT+MEHP treatment groups compared with HT+DMSO. Statistical significance was assigned at P ≤ 0.05. Final data were expressed as means ± SEMs in line and bar graphs. Asterisks (*) represent statistical significance compared with the CT+DMSO baseline, number signs (#) represent statistical significance of HT+MEHP treatment groups compared with CT+MEHP dose-equivalent groups, and ampersands (&) represent statistical significance of HT+MEHP treatment groups compared with HT+DMSO.

Results

Effects of HT and MEHP exposure on antral follicle growth

Antral follicle growth is essential for maturation to the preovulatory stage and maintenance of normal ovarian function (Hannon and Flaws 2015). A main effect of temperature was found in analysis of antral follicle growth across all timepoints (Fig. 1). Data are presented in a line graph for visualization of growth trends (Fig. 1A) and a bar graph for statistical analysis (Fig. 1B). At 48 h, follicle growth was decreased by HT+MEHP (all doses) compared with CT+DMSO (Fig. 1B). At 72 h, follicle growth was decreased by HT+DMSO and HT+MEHP (all doses) compared with CT+DMSO (Fig. 1B). At 96 h, follicle growth was decreased by HT+DMSO and HT+MEHP (2 to 20 µg/ml) compared with CT+DMSO (Fig. 1B).

Fig. 1.

Effects of HT and MEHP exposure on antral follicle growth. Antral follicles from adult CD-1 mice were cultured with vehicle control (DMSO) or MEHP (0.2 to 20 µg/ml) for 24 to 96 h at a control temperature (CT; 37 °C) or high temperature (HT; 42 °C; 8 h/d). Follicle sizes were measured every 24 h via perpendicular diameters. Data are presented as percent change relative to 0 h in a line graph for visualization of growth trends (A) and a bar graph for statistical analysis (B). Graphs represent means ± SEM from 4 to 9 replicates/group with 5 to 10 follicles/group/replicate. Bar graph asterisks (*) represent statistical significance compared with the CT+DMSO baseline (P ≤ 0.05).

Effects of HT and MEHP exposure on expression of cell cycle regulators

Cyclins (Ccnd2, Ccne1, Ccna2, and Ccnb1) and cyclin-dependent kinases (Cdk4) promote cell cycle progression, whereas cyclin-dependent kinase inhibitors (Cdkn1a) block cell cycle progression (Dutto et al. 2015; Huber et al. 2021). Coordination of these regulators enables granulosa cell proliferation, which results in follicle growth (Hannon and Flaws 2015). Since follicle growth was decreased by HT+MEHP, the mRNA levels of cell cycle regulators were measured in cultured follicles at each timepoint following exposure. A main effect of temperature was found in analysis of Ccnd2 gene expression across all timepoints, and a main effect of MEHP was found at 24 h (Fig. 2A). Ccnd2 mRNA levels were decreased by CT+MEHP (20 µg/ml) and HT+MEHP (all doses) compared with CT+DMSO at 24 h. At 48 h, Ccnd2 mRNA levels were increased by CT+MEHP (0.2 µg/ml) compared with CT+DMSO, and at 72 h, Ccnd2 mRNA levels were decreased by HT+DMSO compared with CT+DMSO (Fig. 2A). A significant interaction was found at 72 h where Cdk4 mRNA levels were decreased by HT+DMSO compared with CT+DMSO, and a main effect of temperature was found in analysis of Cdk4 gene expression at 96 h (Fig. 2B). A main effect of temperature was found in analysis of Ccne1 gene expression at 24, 48, and 96 h, and Ccne1 mRNA levels were decreased by HT+MEHP (0.2 µg/ml) compared with CT+DMSO at 48 and 72 h (Fig. 2C). A main effect of temperature was found in analysis of Ccna2 gene expression at 48 to 96 h, and a main effect of MEHP was also found at 72 h (Fig. 2D). Ccna2 mRNA levels were increased by CT+MEHP (0.2 µg/ml) compared with CT+DMSO at 48 h and by CT+MEHP (2 µg/ml) compared with CT+DMSO at 72 h (Fig. 2D). A main effect of temperature was found in analysis of Ccnb1 gene expression from 48 to 96 h, and Ccnb1 mRNA levels were decreased by HT+DMSO and HT+MEHP (all doses) compared with CT+DMSO at 72 h (Fig. 2E). A main effect of temperature was found in analysis of Cdkn1a gene expression from 24 to 48 h, and Cdkn1a mRNA levels were increased by HT+DMSO and HT+MEHP (all doses) at 24 h and by HT+MEHP (2 to 20 µg/ml) at 48 h, all compared with CT+DMSO (Fig. 2F).

Fig. 2.

Effects of HT and MEHP exposure on expression of cell cycle regulators. Antral follicles from adult CD-1 mice were cultured with vehicle control (DMSO) or MEHP (0.2 to 20 µg/ml) for 24 to 96 h at a control temperature (CT; 37 °C) or high temperature (HT; 42 °C; 8 h/d). Follicles were collected at each timepoint and pooled per treatment group for measurements of mRNA levels of Ccnd2 (A), Cdk4 (B), Ccne1 (C), Ccna2 (D), Ccnb1 (E), and Cdkn1a (F) via qPCR. Data are presented as fold change relative to CT+DMSO at each timepoint. Graphs represent means ± SEM from 4 to 9 replicates/group with 5 to 10 follicles/group/replicate. Asterisks (*) represent statistical significance compared with the CT+DMSO baseline (P ≤ 0.05).

Effects of HT and MEHP exposure on sex steroid hormone levels

As antral follicles mature, they produce estradiol, and, in turn, estradiol enhances follicle growth (Drummond and Findlay 1999). Since follicle growth was inhibited by HT+MEHP, levels of estradiol and estradiol precursors were measured in culture media to determine the effects of exposure on antral follicle steroidogenesis. A main effect of temperature was found in analysis of estrone levels at all timepoints, and a main effect of MEHP was found at 72 to 96 h (Fig. 3A). Estrone levels were decreased by HT+MEHP (2 µg/ml) compared with CT+DMSO at 24 h, HT+DMSO and HT+MEHP (all doses) compared with CT+DMSO at 72 h, and CT+MEHP (2 to 20 µg/ml), HT+DMSO, and HT+MEHP (all doses) compared with CT+DMSO at 96 h (Fig. 3A). A main effect of temperature was found in analysis of estradiol levels at all timepoints, and a main effect of MEHP and a significant interaction between HT and MEHP were also found at 96 h (Fig. 3B). Estradiol levels were decreased by HT+DMSO and HT+MEHP (all doses) compared with CT+DMSO at 72 h and by CT+MEHP (all doses), HT+DMSO, and HT+MEHP (all doses) compared with CT+DMSO at 96 h (Fig. 3B). Main effects of temperature and MEHP were found at various timepoints in analysis of pregnenolone, progesterone, androstenedione, and testosterone levels, but pairwise comparisons between separate treatment groups compared with CT+DMSO did not reach significance (Fig. S1).

Fig. 3.

Effects of HT and MEHP exposure on estrone and estradiol levels. Antral follicles from adult CD-1 mice were cultured with vehicle control (DMSO) or MEHP (0.2 to 20 µg/ml) for 24 to 96 h at a control temperature (CT; 37 °C) or high temperature (HT; 42 °C; 8 h/d). Media were collected at each timepoint and pooled per treatment group to measure levels of estrone (A) and estradiol (B) via ELISA or Immulite, respectively. Graphs represent means ± SEM from 4 to 9 replicates/group with 5 to 10 follicles/group/replicate. Asterisks (*) represent statistical significance compared with the CT+DMSO baseline (P ≤ 0.05).

Effects of HT and MEHP exposure on expression of steroidogenic proteins/enzymes and gonadotropin receptors

Since estradiol levels were decreased by HT and MEHP, the mRNA levels of proteins and enzymes (Star, Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b1, Cyp19a1) and gonadotropin receptors (Fshr and Lhcgr) involved in steroidogenesis (Hannon and Flaws 2015) were measured in cultured follicles at each timepoint following exposure. A main effect of temperature was found in analysis of Cyp11a1 gene expression at 24 and 72 h, and Cyp11a1 mRNA levels were decreased by HT+DMSO and HT+MEHP (all doses) compared with CT+DMSO at 72 h (Fig. 4A). A main effect of temperature was found in analysis of Hsd17b1 gene expression at 24, 48, and 96 h, and Hsd17b1 mRNA levels were decreased by HT+MEHP (all doses) compared with CT+DMSO at 24 h (Fig. 4B). A main effect of temperature was found in analysis of Cyp19a1 gene expression at all timepoints, and Cyp19a1 mRNA levels were decreased by HT+MEHP (all doses) at 24 h, HT+DMSO and HT+MEHP (all doses) at 72 h, and HT+DMSO and HT+MEHP (20 µg/ml) at 96 h, all compared with CT+DMSO (Fig. 4C). A main effect of temperature was found in analysis of Fshr gene expression at all timepoints, and an interaction and main effect of MEHP were also found at 24 h (Fig. 4D). At 24 h, Fshr mRNA levels were increased by HT+DMSO and HT+MEHP (all doses) compared with CT+DMSO and compared with their CT+MEHP dose-equivalent treatment groups. Additionally, Fshr mRNA levels were decreased by HT+MEHP (20 µg/ml) compared with HT+DMSO at 24 h (Fig. 4D). At 72 h, Fshr mRNA levels were decreased by HT+MEHP (20 µg/ml) compared with CT+DMSO (Fig. 4D). Main effects of temperature were found at various timepoints in analysis of Star, Cyp17a1, and Lhcgr gene expression, but pairwise comparisons between separate treatment groups compared with CT+DMSO did not reach significance (Fig. S2). Further, no significant main effects or comparisons were found in analysis of Hsd3b1 gene expression (Fig. S2).

Fig. 4.

Effects of HT and MEHP exposure on steroidogenic enzyme and gonadotropin receptor expression. Antral follicles from adult CD-1 mice were cultured with vehicle control (DMSO) or MEHP (0.2 to 20 µg/ml) for 24 to 96 h at a control temperature (CT; 37 °C) or high temperature (HT; 42 °C; 8 h/d). Follicles were collected at each timepoint and pooled per treatment group for measurements of mRNA levels of Cyp11a1 (A), Hsd17b1 (B), Cyp19a1 (C), and Fshr (D) via qPCR. Data are presented as fold change relative to CT+DMSO at each timepoint. Graphs represent means ± SEM from 4 to 9 replicates/group with 5 to 10 follicles/group/replicate. Asterisks (*) represent statistical significance compared with the CT+DMSO baseline, number signs (#) represent statistical significance of HT+MEHP treatment groups compared with CT+MEHP dose-equivalent groups, and ampersands (&) represent statistical significance compared with HT+DMSO (P ≤ 0.05).

Effects of HT and MEHP exposure on expression of apoptosis and oxidative stress regulators

As antral follicles mature, they must also escape atresia, or natural follicle degeneration (Hannon and Flaws 2015). Follicular atresia occurs primarily via apoptosis, which is regulated by the balance of pro-apoptotic factors and anti-apoptotic factors (Zhang et al. 2025). Apoptosis can also be induced by oxidative stress, which is the imbalance of reactive oxygen species and antioxidant defenses (Liu et al. 2023). The mRNA levels of pro-apoptotic factors (Bad, Bax, Bok, Casp8, Casp3, and Casp9), anti-apoptotic factors (Bcl2 and Bcl2l10), and antioxidant enzymes (Sod1, Sod2, Cat, Gpx1) were measured in cultured follicles at each timepoint to determine if apoptosis and/or oxidative stress are mechanisms by which HT and MEHP inhibit antral follicle growth and estradiol synthesis. A main effect of temperature was found in analysis of Bok gene expression at 24, 48, and 96 h, and Bok mRNA levels were decreased by HT+MEHP (0.2 and 20 µg/ml) compared with CT+DMSO at 24 h (Fig. 5A). A main effect of temperature was found in analysis of Bax gene expression at 96 h and in analysis of Bcl2 gene expression from 72 to 96 h, but pairwise comparisons between separate treatment groups compared with CT+DMSO did not reach significance (Fig. 5B and C). Similarly, a main effect of temperature was found in analysis of the Bax/Bcl2 mRNA ratio from 72 to 96 h, but pairwise comparisons between separate treatment groups compared with CT+DMSO did not reach significance (Fig. 5D). However, a significant interaction was found at 96 h, where the Bax/Bcl2 mRNA ratio was increased by HT+MEHP (0.2 µg/ml) compared with CT+MEHP (0.2 µg/ml) (Fig. 5D). A main effect of temperature was found in analysis of Casp8 gene expression at 48 and 96 h, and Casp8 mRNA levels were decreased by HT+DMSO compared with CT+DMSO at 48 h and by HT+DMSO and HT+MEHP (0.2 and 20 µg/ml) compared with CT+DMSO at 96 h (Fig. 5E). A main effect of temperature was found in analysis of Sod1 gene expression at 24 and 72 h, but pairwise comparisons between separate treatment groups compared with CT+DMSO did not reach significance (Fig. 5F). However, a significant interaction was found at 48 h, where Sod1 mRNA levels were decreased by HT+MEHP (0.2 µg/ml) compared with CT+MEHP (0.2 µg/ml) (Fig. 5F). Main effects of temperature were found at various timepoints in analysis of Bad, Bcl2l10, Casp3, and Casp9 gene expression, but pairwise comparisons between separate treatment groups compared with CT+DMSO did not reach significance (Fig. S3). Further, no significant main effects or comparisons were found in analysis of Sod2, Cat, or Gpx1 gene expression (Fig. S3).

Fig. 5.

Effects of HT and MEHP exposure on expression of apoptosis and oxidative stress regulators. Antral follicles from adult CD-1 mice were cultured with vehicle control (DMSO) or MEHP (0.2 to 20 µg/ml) for 24 to 96 h at a control temperature (CT; 37 °C) or high temperature (HT; 42 °C; 8 h/d). Follicles were collected at each timepoint and pooled per treatment group for measurements of mRNA levels of Bok (A), Bax (B), Bcl2 (C), Bax/Bcl2 (D), Casp8 (E), and Sod1 (F) via qPCR. Data are presented as fold change relative to CT+DMSO at each timepoint. Graphs represent means ± SEM from 4 to 9 replicates/group with 5 to 10 follicles/group/replicate. Asterisks (*) represent statistical significance compared with the CT+DMSO baseline and number signs (#) represent statistical significance of HT+MEHP treatment groups compared with CT+MEHP dose-equivalent groups (P ≤ 0.05).

Discussion

To the best of our knowledge, this study represents the first investigation of combined exposure effects of unavoidable chemical (MEHP) and nonchemical (HT) stressors on ovarian antral follicle growth and steroidogenesis. Our main findings suggest that: (i) HT and MEHP exposure exert significant independent and combined effects on antral follicle function, (ii) HT and MEHP co-exposure results in a greater number of defects than either stressor alone, and (iii) HT and MEHP exert interactive effects. Specifically, MEHP exposure alone decreased estradiol levels, whereas HT exposure alone and HT+MEHP co-exposure inhibited follicle growth and decreased estradiol levels over time. Although disrupted cell cycle progression was consistent across all treatments, HT exposure alone and HT+MEHP co-exposure also inhibited the steroidogenic pathway and upregulated FSH receptor expression, demonstrating differential mechanisms of individual exposures versus co-exposure. Additionally, no corresponding changes in apoptosis or oxidative stress markers were observed, indicating that these pathways may not contribute to the defects in follicle growth and steroidogenesis by HT and MEHP in this study. Further, several significant interactions between HT and MEHP were identified in analysis of endpoints involved in cell cycle regulation, steroidogenesis, oxidative stress, and apoptosis. Overall, the present study establishes a time course of individual and combined toxic effects of HT and MEHP on antral follicle function and demonstrates that HT and MEHP co-exposure resulted in a greater number of disruptions to follicle function than either stressor alone. Further, we identified several significant interactions, suggesting that HT and MEHP effects are context-dependent and may interact to exert antagonistic effects when combined. Thus, exposure to ubiquitous chemical and nonchemical stressors like MEHP and HT disrupt critical ovarian processes and may potentiate ovarian dysfunction when combined. These findings advance the fields of reproductive and environmental toxicology by investigating the mechanisms by which heat and EDC exposures may impair ovarian function and by providing the first evidence, to our knowledge, of a phthalate-heat interaction in a mammalian model.

Our results indicate distinct effects of individual and co-exposure to HT and MEHP on antral follicle growth and cell cycle regulation. There was no significant effect on follicle growth with MEHP exposure alone (CT+MEHP) compared with the overall control (CT+DMSO). However, by 96 h, we observed nonsignificant 10% and 15% decreases in growth at the 2 and 20 μg/ml doses, respectively, which was not observed at the 0.2 μg/ml dose. We hypothesize that this is likely due to the early increases in Ccnd2 and Ccna2 mRNA levels at the lowest dose, perhaps serving as a compensatory response to MEHP toxicity, which was not observed at the higher doses. Although previous studies have shown that MEHP decreases antral follicle growth (Gupta et al. 2010; Wang et al. 2012; Craig et al. 2014), these effects were established at different doses of MEHP (0.1 to 100 μg/ml). As an EDC, MEHP may display nonmonotonic dose responses (Andrade et al. 2006; Ge et al. 2007; Do et al. 2012), which may explain why MEHP at the selected doses under CT conditions did not significantly decrease follicle growth in the present study. However, our findings are consistent with previous studies demonstrating that MEHP dysregulates the cell cycle (Gupta et al. 2010; Wang et al. 2012). With HT exposure alone (HT+DMSO), follicle growth was significantly decreased by 15% at 72 h and 20% at 96 h. This is consistent with the early increases in Cdkn1a mRNA levels and later decreases in mRNA levels of Ccnd2, Cdk4, and Ccnb1. Previous studies have also supported that heat exposure inhibits follicle growth, where diameters of preantral follicles and preovulatory follicles were decreased following heat stress in cattle models (Schüller et al. 2017; Aguiar et al. 2020). Strikingly, HT+MEHP co-exposure in the present study resulted in decreased antral follicle growth at all doses from 48 to 72 h. By 96 h, the 2 higher doses continued to decrease follicle growth, where there was a 30% decrease in growth at the highest dose. The co-exposure-induced decreases in follicle growth are consistent with the early decreases in Ccnd2 mRNA levels and increases in Cdkn1a mRNA levels and later decreases in Ccnb1 mRNA levels. These results suggest that while MEHP exposure alone did not inhibit follicle growth at these concentrations, HT exposure-, and HT+MEHP co-exposure-induced inhibition of the cell cycle as early as 24 h led to inhibited follicle growth over time.

Antral follicle growth is coupled with steroidogenesis, and our results indicated distinct effects of individual and co-exposure to HT and MEHP on antral follicle steroidogenesis. Interestingly, MEHP exposure alone decreased estrone and estradiol levels at 96 h, but no changes in steroidogenic protein or enzyme expression were observed in these CT+MEHP treatment groups. Previous studies have shown that MEHP decreases estradiol levels via inhibitory effects on steroidogenic enzyme expression (Gupta et al. 2010; Hannon et al. 2015). As mentioned above, the discrepancies in steroidogenic enzyme expression between our current findings and the literature may be attributed to the differences in doses used and the nonmonotonic dose responses attributed to EDCs like MEHP (Andrade et al. 2006; Ge et al. 2007; Do et al. 2012). Although our results show no effects of MEHP on steroidogenic enzyme expression, we hypothesize that MEHP may suppress steroidogenic enzyme protein levels and activity, as shown in previous studies (Reinsberg et al. 2009), which will be explored in our future studies. HT exposure alone decreased estrone and estradiol levels at 72 to 96 h, which coincided with decreased mRNA levels of Cyp11a1 and Cyp19a1 at 72 h. These findings are consistent with previous studies that have shown decreased estradiol levels and reduced Cyp19a1 expression in follicular cells with heat stress in mice and large animal models (Bridges et al. 2005; Li et al. 2016). Additionally, HT+MEHP co-exposure decreased estrone and estradiol levels at 72 to 96 h, which coincided with decreased mRNA levels of Hsd17b1 and Cyp19a1 at 24 h and decreased mRNA levels of Cyp11a1 and Cyp19a1 at 72 h. Thus, estradiol production is inhibited at 96 h regardless of individual or co-exposure to HT and MEHP; however, only HT exposure alone and HT+MEHP co-exposure inhibited steroidogenic enzyme expression at earlier timepoints.

FSH signaling via the FSH receptor is essential for both antral follicle growth and estradiol synthesis. Although there were no effects with MEHP exposure alone, HT exposure alone and HT+MEHP co-exposure increased Fshr mRNA levels at 24 h. We hypothesize that this may be an early compensatory response, likely via a follicular response to heat stress. In follicles exposed to HT alone, we speculate that this compensatory response may have partially restored follicular function as defects in cell cycle regulation observed at 24 h were not observed at 48 h and emerged at 72 h along with defects in steroidogenesis and follicle growth. In contrast, follicles co-exposed to HT+MEHP exhibited defects in cell cycle dysregulation and steroidogenesis at 24 h, and cell cycle defects were sustained at 48 h along with inhibited follicle growth. This suggests that the potential compensatory response to heat stress may have been more effective in follicles exposed to HT alone than in follicles co-exposed to HT+MEHP. Therefore, the compensatory mechanism of increased Fshr levels may be insufficient or may be impaired by the presence of MEHP. Further, we hypothesize that this compensatory response may be in response to FSH receptor degradation or downregulation. A previous in vivo study showed that heat exposure decreased FSH receptors on granulosa cells of antral follicles in a rat model (Shimizu et al. 2005). This suggests that since heat exposure may decrease FSH receptor protein levels, the increases in Fshr mRNA levels in our model may serve as a compensatory mechanism in response to HT exposure.

As antral follicles grow and develop to be selected for ovulation, they must also escape atresia, or natural follicle degeneration (Hannon and Flaws 2015). Atresia is regulated by the balance of pro-apoptotic factors and anti-apoptotic factors and can be induced by oxidative stress (Liu et al. 2023; Zhang et al. 2025). Our findings indicate that despite HT- and MEHP-induced defects in follicle growth and estradiol synthesis, there were no observed effects of individual exposure or co-exposure to HT and MEHP that suggested apoptosis or oxidative stress as potential mechanisms for these defects. In fact, we observed decreases in mRNA levels of pro-apoptotic factors Bok and Casp8 with HT exposure alone and HT+MEHP co-exposure at select doses and timepoints and no changes in mRNA levels of antioxidant enzymes with any treatment. Previous studies have shown that MEHP exposure increases or decreases pro-apoptotic gene expression and inhibits expression of antioxidant enzymes in antral follicles (Wang et al. 2012; Craig et al. 2014). These findings were established at MEHP concentrations of 0.1 to 100 μg/ml, which are different than the concentrations used in the present study. These discrepancies further support the nonmonotonic dose response nature of MEHP. Additionally, previous studies also show that heat exposure increases pro-apoptotic and antioxidant enzyme gene expression in granulosa cells of mouse and cattle models (Li et al. 2016; Luo et al. 2016; Alemu et al. 2018). Therefore, our findings of decreased pro-apoptotic gene expression suggest a different cellular response to heat stress in a whole follicle model, which may favor cell survival by not inducing apoptosis- or oxidative stress-mediated follicle death. This is further supported by the potential compensatory increase in Fshr mRNA levels with HT exposure alone and HT+MEHP co-exposure, where these early increases may promote follicle survival. Previous studies have also suggested that heat shock proteins (HSP), which are induced by environmental stressors, may contribute to cellular protection during heat stress. Specifically, HSP70 expression has been shown to be induced in mouse ovaries, antral follicles, and granulosa cells in response to heat stress and is predicted to regulate the heat stress response in the ovary and reduce heat-induced apoptosis in granulosa cells (Ravagnan et al. 2001; Li et al. 2016; Bei et al. 2020). Thus, future studies will investigate whether HSPs play a role in follicle survival using similar exposure paradigms, potentially explaining our findings of impaired follicle function with the absence of apoptosis.

Taken together, our findings show that individual and co-exposure to HT and MEHP impair antral follicle function via inhibited follicle growth and/or disrupted steroidogenesis. Table 2 summarizes the time course of effects of each treatment group compared with overall control (CT+DMSO). Although there is overlap between the MEHP-, HT-, and HT+MEHP-induced defects in follicle function, we observed a greater number of defects with HT exposure alone and HT+MEHP co-exposure than with MEHP exposure alone (Table 2). Notably, we observed more defects with HT+MEHP co-exposure than with HT exposure alone and some overlapping defects that occurred at earlier timepoints with HT+MEHP co-exposure than with HT exposure alone. Thus, while individual and combined effects of HT and MEHP on antral follicle function exhibited some overlap, more cumulative defects were produced with HT+MEHP co-exposure than either stressor alone.

Table 2.

Significant HT and MEHP-induced effects relative to CT+DMSO.

Exposure		24 h	48 h	72 h	96 h	Total number of significant effects
MEHP exposure alone	CT+MEHP 0.2 µg/ml		Ccnd2↑ Ccna2↑		Estradiol↓	3
	CT+MEHP 2 µg/ml			Ccna2↑	Estrone↓ Estradiol↓	3
	CT+MEHP 20 µg/ml	Ccnd2↓			Estrone↓ Estradiol↓	3
HT exposure alone	HT+DMSO	Cdkn1a↑ Fshr↑	Casp8↓	Growth↓ Ccnd2↓ Cdk4↓ Ccnb1↓ Estrone↓ Estradiol↓ Cyp11a1↓ Cyp19a1↓	Growth↓ Estrone↓ Estradiol↓ Cyp19a1↓ Casp8↓	16
HT+MEHP co-exposure	HT+MEHP 0.2 µg/ml	Ccnd2↓ Cdkn1a↑ Hsd17b1↓ Cyp19a1↓ Fshr↑ Bok↓	Growth↓ Ccne1↓	Growth↓ Ccne1↓ Ccnb1↓ Estrone↓ Estradiol↓ Cyp11a1↓ Cyp19a1↓	Estrone↓ Estradiol↓ Casp8↓	18
	HT+MEHP 2 µg/ml	Ccnd2↓ Cdkn1a↑ Estrone↓ Hsd17b1↓ Cyp19a1↓ Fshr↑	Growth↓ Cdkn1a↑	Growth↓ Ccnb1↓ Estrone↓ Estradiol↓ Cyp11a1↓ Cyp19a1↓	Growth↓ Estrone↓ Estradiol↓	17
	HT+MEHP 20 µg/ml	Ccnd2↓ Cdkn1a↑ Hsd17b1↓ Cyp19a1↓ Fshr↑ Bok↓	Growth↓ Cdkn1a↑	Growth↓ Ccnb1↓ Estrone↓ Estradiol↓ Cyp11a1↓ Cyp19a1↓ Fshr↓	Growth↓ Estrone↓ Estradiol↓ Cyp19a1↓ Casp8↓	20

Our findings also suggest that HT and MEHP effects may be interactive. Five significant interactions were discovered between HT and MEHP, suggesting that HT exposure may modulate the effects of MEHP, and conversely, MEHP exposure may modulate the effects of HT. At 24 h, we identified an interaction between HT and MEHP in analysis of Fshr gene expression. Fshr mRNA levels were unchanged by MEHP exposure alone and were significantly increased by HT exposure alone and HT+MEHP co-exposure compared with the overall control and compared with dose equivalents in control temperature conditions (HT+MEHP vs CT+MEHP). However, Fshr mRNA levels were significantly decreased by HT+MEHP at the highest dose compared with HT+DMSO. Thus, MEHP effects were observed in HT conditions, but not in CT conditions, signifying that MEHP effects on Fshr were temperature dependent, and HT effects were observed regardless of MEHP exposure. Further, this interaction suggests an antagonistic effect of MEHP, where the highest dose blunted or attenuated the HT effect. Since this early increase is hypothesized to be compensatory to promote follicle survival, the antagonistic effect of MEHP at the highest dose in HT conditions results in a failure to adequately increase Fshr levels to produce this potential compensatory response. At 48 h, an interaction between HT and MEHP was identified in analysis of Sod1 gene expression. Sod1 mRNA levels were unchanged by MEHP exposure alone, HT exposure alone, and HT+MEHP co-exposure compared with the overall control. However, HT+MEHP at the 0.2 μg/ml dose significantly decreased Sod1 mRNA levels compared with its dose equivalent in control temperature conditions (CT+MEHP), suggesting that the effects of MEHP on Sod1 mRNA levels were temperature dependent. This is supported by the observed opposite directional effects across temperature conditions, where Sod1 mRNA levels were increased by CT+MEHP at the 0.2 μg/ml dose compared with CT+DMSO (nonsignificant), whereas levels were decreased by HT+MEHP at the 0.2 μg/ml dose compared with HT+DMSO (nonsignificant). At 72 h, an interaction between HT and MEHP was discovered in analysis of Cdk4 gene expression. Cdk4 mRNA levels were unchanged by MEHP exposure alone, but the levels were significantly decreased by HT exposure alone compared with the overall control, demonstrating differing individual exposure effects. Additionally, Cdk4 mRNA levels were unchanged by HT+MEHP compared with the overall control and dose equivalents in control temperature conditions. These findings show that HT decreased Cdk4 mRNA levels in vehicle-treated groups but not in MEHP-treated groups, therefore, HT effects on Cdk4 mRNA levels were dependent on the presence of MEHP. It is also possible that the effect of HT is antagonized by MEHP, but this remains to be investigated. At 96 h, a significant interaction between HT and MEHP was identified in analysis of the Bax/Bcl2 mRNA ratio. The Bax/Bcl2 mRNA ratio was unchanged by MEHP exposure alone, HT exposure alone, and HT+MEHP co-exposure compared with the overall control. However, the Bax/Bcl2 ratio was significantly increased by HT+MEHP at the 0.2 μg/ml compared with its dose equivalent in control temperature conditions (CT+MEHP), suggesting that the effects of MEHP on the Bax/Bcl2 mRNA ratio were temperature dependent. This is supported by the observed opposite directional effects across temperature conditions, where the Bax/Bcl2 mRNA ratio was decreased by CT+MEHP at the 0.2 μg/ml dose compared with CT+DMSO (nonsignificant), and the ratio was increased by HT+MEHP at the 0.2 μg/ml dose compared with HT+DMSO (nonsignificant). Lastly, a significant interaction between HT and MEHP was discovered in analysis of estradiol levels at 96 h. Estradiol levels were significantly decreased by MEHP exposure alone, HT exposure alone, and HT+MEHP co-exposure compared with the overall control, demonstrating similar individual and co-exposure effects. Because estradiol levels were significantly decreased by CT+MEHP compared with CT+DMSO, but not by HT+MEHP compared with HT+DMSO, the effect of MEHP was temperature dependent. Similarly, because levels were decreased by HT+DMSO compared with CT+DMSO, but not by HT+MEHP compared with CT+MEHP, the effect of HT was dependent on the presence of MEHP.

Collectively, we identified 5 significant interactions at various timepoints and on endpoints involved in cell cycle regulation, steroidogenesis, oxidative stress, and apoptosis. These interactions establish that HT and MEHP exhibit context-dependent effects and may interact antagonistically but not synergistically. Further, the antagonistic effects of MEHP suggest that HT may induce or increase MEHP toxicity, given the hypothesized blunted compensatory increase in Fshr (as described above). Importantly, these findings provide the first evidence of phthalate interactions with heat in a mammalian model and support the existing literature showing that EDC effects are influenced by concurrent environmental exposures, including elevated heat (Cardoso et al. 2017; DeCourten and Brander 2017; Li et al. 2022a).

Strengths of this study include the use of a well-established in vitro follicle culture system to determine the effects of HT and MEHP on antral follicle function at environmentally relevant doses of MEHP found in follicular fluid of women (Du et al. 2016; Wang et al. 2023). Previous studies investigating individual exposure to HT or MEHP report mixed findings, with evidence both supporting and contradicting those of the present study. Our use of a whole follicle model allows for investigation of treatment effects on the multi-directional communication between all follicular cell types and therefore may not be directly comparable to results derived from granulosa cell models. Additionally, previous studies investigating MEHP exposure utilize wide ranges of MEHP concentrations, and the nonmonotonic dose response characteristic of EDCs complicates comparisons across studies. Similarly, studies investigating heat exposure utilize varying temperatures and durations of exposure. This study utilized a high temperature (42 °C) established in the use of heatstroke and heat stress models in mice (Leon et al. 2005; Li et al. 2016; Miyamoto et al. 2021). Although the 42 °C exposure used in this study represents a severe heat stress condition and 8 h exposure/day modeled daytime, occupational exposure to HT, these conditions were selected to investigate cellular responses to high temperature based on previous in vitro and in vivo studies (Li et al. 2016). This presents as a limitation to this study as this exposure does not directly correspond to human ambient temperature exposure, and a core temperature of 42 °C is rare in humans. However, this study served to not only determine the effects of HT and MEHP on ovarian function, but also to determine whether HT and MEHP effects influence each other. Thus, this study expands on previous literature with combined exposure effects and interactions, providing a foundation for further investigations of HT and MEHP co-exposure. These findings should be interpreted as demonstrating the potential mechanisms by which heat stress may affect ovarian function rather than as a direct replication of heat exposure scenarios in the environment resulting in internal body temperatures reaching 42 °C. Future studies will prioritize experimental paradigms for both individual and combined exposures using human-relevant temperatures, doses, and exposure durations. Another important limitation of the present study includes the mechanistic interpretations relying on transcriptional changes in the expression of genes involved in steroidogenesis, cell cycle regulation, apoptosis, and oxidative stress. Future studies will evaluate protein abundance and enzyme activity to determine whether the observed transcriptional changes translate to functional impairments of each area of interest. Further, while the present study serves as the first investigation of combined phthalate and heat exposure, future studies should investigate the combined effects with phthalate mixtures and other relevant EDCs to better represent the concurrent environmental exposures that are relevant to human exposure risks.

In conclusion, our main findings demonstrate that HT and MEHP exposure exert significant independent and combined effects on antral follicle growth and steroidogenesis. Collectively, our results indicate that MEHP exposure alone dysregulates the cell cycle and inhibits estradiol synthesis, whereas HT exposure alone and HT+MEHP co-exposure inhibit follicle growth via disruption of the cell cycle and inhibit estradiol synthesis via disruption of steroidogenic enzymes. Further, we establish the first evidence that HT exposure may modulate the effects of MEHP, and, conversely, MEHP exposure may modulate the effects of HT. The observed effects of HT and MEHP exposure are of concern because proper follicle development and production of critical sex steroid hormones like estradiol are essential for female fertility, and these processes must remain undisturbed to preserve female reproductive and nonreproductive health (Land et al. 2025). Given that human exposure to HT and MEHP is unavoidable and that our current findings establish that the 2 exposures impair antral follicle function, further studies are needed to determine the combined effects on ovulation, fertility, and the whole body in vivo. Such studies will enable the investigation of interactions between nonchemical and chemical stressors and their effects on human health at large.

Supplementary material

Supplementary material is available at Toxicological Sciences online.

Funding

This work was supported by the National Institute of Environmental Health Sciences (grant numbers R01ES033767 and P30ES026529) and the NIH National Center for Advancing Translational Sciences (grant number UL1TR001998).

Conflicts of interest. The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: P.H. reports financial support was provided by National Institute of Environmental Health Sciences and the NIH National Center for Advancing Translational Sciences. The other authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.