Effects of full-fat black soldier fly larvae (Hermetia illucens) meal on growth, gut health, and bone microstructure responses in broiler chickens

Abstract

The objective of this study was to evaluate the effects of graded replacement of soybean meal (SBM) with full-fat black soldier fly larvae (BSFL; Hermetia illucens) meal on growth performance, intestinal morphology, barrier and transporter gene expression, body composition, and femoral bone microstructure in broiler chickens. A total of 360 one-day-old male Cobb 500 broiler chicks were randomly assigned to 6 dietary treatments (n = 6 replicates/treatment, 10 birds/pen) in a 28-day feeding trial: T0 (0% BSFL), T2.5 (2.5%), T5 (5.0%), T7.5 (7.5%), T10 (10.0%), and T12.5 (12.5%) BSFL meal replacing SBM on an isonitrogenous and isocaloric basis, using pre-determined nitrogen-corrected true metabolizable energy (TMEn) and digestible amino acid values. BSFL inclusion did not affect feed intake throughout the trial (P > 0.05). However, birds fed 5% BSFL had the highest final body weight and body weight gain, with a significant quadratic response on day 28 (P < 0.05), whereas the 12.5% group had the lowest. Intestinal morphology followed the similar pattern where the 5% group had the highest villus height-to-crypt depth ratio in the duodenum (P < 0.05), indicating enhanced absorptive capacity at moderate inclusion. However, oxidative status was similar among the treatments with no statistical difference (P > 0.05). Similarly, TJP1 and TJP2 were significantly affected by treatment, whereas JAM-2 and Occludin showed downward linear trends with increasing BSFL inclusion, suggesting intestinal barrier compromise at higher inclusion levels. The large neutral amino acid transporter LAT1 was downregulated at 10–12.5% BSFL, whereas B⁰AT1, SGLT1, and y⁺LAT1 were unaffected. Body fat percentage increased linearly with BSFL inclusion (P < 0.001), and lean tissue percentage decreased correspondingly. Bone mineral density was preserved across all treatments while femoral trabecular microstructure parameters showed significant quadratic responses as BSFL inclusion increased (P < 0.05). In conclusion, replacing SBM with full-fat BSFL meal at 5% optimized broiler growth, intestinal integrity, and bone microstructure, whereas inclusion levels above 10% compromised gut barrier function.

Introduction

Poultry production plays a central role in global food security by supplying affordable, high-quality animal protein to a growing population (Nassar, 2026). Poultry meat currently accounts for approximately 43% of global meat consumption (Whitton et al., 2021), reflecting its widespread acceptance and importance in human diets. Global poultry meat production reached approximately 149.7 million tons in 2024 (FAO, 2024; USDA, 2025) of which chicken meat accounted for the largest share; global chicken meat production alone is projected to reach a record 109.6 million tons in 2026 (USDA, 2025). Looking ahead, the OECD–FAO Agricultural Outlook (2025–2034) projects that global poultry consumption will increase to approximately 173 million tons (ready-to-cook basis) by 2034 (OECD-FAO, 2025). This rapid growth is supported by poultry’s high feed efficiency, making effective nutrition essential for global food security. Soybean meal (SBM) therefore serves as the primary protein source in broiler diets worldwide due to its high crude protein content (approximately 44–48%), balanced amino acid profile, and high digestibility (Bernard, 2016). Its amino acid profile complements cereal grains such as corn and wheat, allowing precise diet formulation for efficient growth in poultry (Cemin et al., 2020). For these reasons, SBM is commonly used as the benchmark when evaluating alternative protein ingredients for poultry diets (Cromwell, 2017). Despite these advantages, increasing reliance on soybean meal presents major economic and sustainability challenges.

Expansion of soybean cultivation has been strongly associated with deforestation in South America, particularly in the Amazon and Cerrado regions (Song et al., 2021; WWF, 2022; Brandão et al., 2025). Soybean production also requires substantial land, water, and fertilizer inputs, contributing to greenhouse gas emissions and long-term environmental pressure (FAO, 2013; Makkar, 2018). In addition, many regions depend heavily on imported soybeans for animal feed. In Europe, the EU and the UK import about 14 million tons of soybeans and 18 million tons of soybean meals, with over 95% used in animal production (IDH, 2018). This reliance raises concerns, links to land-use change in exporting countries, and increases exposure to price volatility and trade disruptions (van Loon et al., 2023; Voora et al., 2024). These challenges are further intensified because soybeans are used for animal feed, human food, and biofuel production at the same time; thus, increased demand in any one sector can quickly strain global supplies and reduce long-term supply stability (Voora et al., 2024; Peng et al., 2025). Together, these economic and environmental pressures underscore the need for alternative protein sources.

Insects have emerged as promising alternative feed ingredients in animal diets due to their high nutritional value and sustainability advantages. Insects can efficiently convert organic by-products and waste streams into protein-rich biomass, aligning well with circular bioeconomy principles (van Huis and Oonincx, 2017; Belhadj Slimen et al., 2023; Gautam et al., 2025). Compared with conventional protein sources, insect production generally requires less land and water and produces lower greenhouse gas emissions per unit of protein (van Huis and Oonincx, 2017; Fu et al., 2025; Gautam et al., 2025). These characteristics make insects attractive candidates for reducing the environmental footprint of animal feed while diversifying protein supply chains.

Among insect species evaluated for poultry nutrition, black soldier fly larvae (BSFL; Hermetia illucens) have received particular attention. BSFL meal is characterized by a high protein content and a favorable amino acid profile that supports broiler growth when properly formulated (de Souza Vilela et al., 2021b; Salahuddin et al., 2024; Su et al., 2025). In the meal evaluated here, methionine, valine, and histidine were present at higher concentrations than in SBM (Table 1). In addition to protein, BSFL contains a substantial lipid proportion that contributes to dietary energy. Lauric acid commonly represents a major component, while myristic, oleic, and linoleic acids are also present, although their proportions vary with rearing substrate and processing (Spranghers et al., 2017; Lu et al., 2022; Su et al., 2025). Lauric acid and other medium-chain fatty acids have been associated with antimicrobial activity and gut health benefits in poultry (Zeitz et al., 2015; Yang et al., 2018, 2019). BSFL also contains chitin from the larval exoskeleton, which can act as a prebiotic fiber and may support gut function and immune responses. In addition, BSFL provide highly available minerals such as calcium and phosphorus that can contribute to bone development (de Souza Vilela et al., 2021b; Salahuddin et al., 2024; Su et al., 2025). Regulatory approval has further supported the practical use of BSFL in poultry nutrition. In the United States, the Food and Drug Administration approved BSFL for poultry feed use in 2018, leading to an official ingredient definition by the Association of American Feed Control Officials (AAFCO, 2021; Dillard et al., 2025). In the European Union, insect-derived processed animal proteins, including BSFL, were authorized for use in poultry diets in 2021 under Commission Regulation (Salahuddin et al., 2024; Meijer et al., 2025).

Table 1.

Analyzed amino acid content and average digestibility (%) of soybean meal (SBM) and black soldier fly larvae (BSFL) meal.

	Soybean Meal (SBM)		Black Soldier Fly Larvae meal (BSFL)
Amino Acid	Content (%)	Digestibility (%)	Content (%)	Digestibility (%)
Alanine	2.050	86.339	2.495	87.538
Arginine	3.375	89.793	2.050	90.996
Aspartic Acid	5.250	89.578	3.685	87.559
Cysteine	0.670	76.979	0.385	66.762
Glutamic Acid	8.600	91.632	4.635	87.895
Glycine	2.005	46.270	2.130	59.804
Histidine	1.240	87.522	1.325	87.213
Isoleucine	2.270	90.716	1.800	88.172
Leucine	3.650	90.282	2.695	87.853
Lysine	3.045	90.341	2.495	88.949
Methionine	0.640	91.234	0.715	90.418
Phenylalanine	2.435	91.269	1.755	86.041
Proline	2.395	89.537	2.175	88.986
Serine	1.960	90.217	1.405	85.608
Threonine	1.815	87.274	1.560	85.192
Tryptophan	0.660	95.186	0.600	95.644
Tyrosine	1.680	91.791	2.450	91.512
Valine	2.430	88.991	2.580	87.975

Despite increasing research interest, the optimal dietary inclusion level of BSFL that maximizes performance and health benefits while maintaining nutrient balance remains unclear. Most existing studies have focused on a limited set of outcomes, and few have simultaneously evaluated growth performance, intestinal morphology, oxidative status, immune-related markers such as cytokine expression, tight junction integrity, and bone parameters across graded inclusion levels of BSFL. We hypothesized that moderate BSFL inclusion would support growth, intestinal head, and bone development, whereas higher inclusion levels would be less beneficial. Therefore, the objective of the present study was to evaluate graded dietary inclusion levels of BSFL in broiler diets to determine an optimal inclusion level based on growth performance, gut health, immune responses, and bone characteristics.

Materials and methods

Ethical approval

All animal procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the University of Georgia, Athens, GA, under Protocol No. A2022 04-029.

Analytical methods for ingredient characterization

The full-fat BSFL was obtained from EnviroFlight, LLC (Maysville, KY, USA). According to the supplier, the larvae were raised on a substrate containing brewer’s grains. After receiving it, the BSFL were ground through a 6-mm screen. Before the experimental diets were formulated, we analyzed soybean meal (SBM) and full-fat black soldier fly larvae (BSFL) meal for proximate composition, amino acid profiles, mineral content, nitrogen-corrected true metabolizable energy (TMEn), and coefficient of true digestibility of amino acids (CTDAA). All proximate analyses (moisture, crude protein, crude fat, crude fiber, and ash) were conducted at the University of Georgia Agricultural and Environmental Laboratories (Athens, GA) following AOAC (2006) procedures. Briefly, moisture was determined by drying 2 g samples at 135°C for 2 h, ash by igniting 2 g at 600°C for 2 h, crude fat via ANKOM™ XT15 extraction with petroleum ether (AOCS Am 5-04), and crude fiber using the ANKOM™ 200/220 Fiber Analyzer (Method A200).

TMEn and CTDAA values were determined in cecectomized Single Comb White Leghorn roosters (10 birds per sample) using the precision-feeding assay described by Dillard et al. (2025) adapted from Sirbald (1976) and Dale and Fuller (1984). After 30 h fasting, roosters were tube-fed 35 g of ingredient, and excreta collected individually for 42 h over stainless steel trays. Basal losses were estimated from 10 unfed controls. Excreta were freeze-dried, ground, and analyzed for gross energy (Parr 6400 Oxygen Bomb Calorimeter), moisture, and crude protein (AOAC, 2006). Amino acid profiles of feeds and excreta were quantified at the University of Missouri Agricultural Experiment Station Chemical Laboratories (Columbia, MO) per (AOAC, 2006) methods. Apparent metabolizable energy was corrected for metabolic plus endogenous losses to obtain TMEn, while CTDAA values corrected basal amino acid excretion.

For mineral analysis, 1.0 g samples were ashed at 550°C for 6 h, digested in 25% HCl (AOAC Method 968.08) (Minerals in Animal Feed and Pet Food – Atomic Absorption Spectrophotometric Method; AOAC, 1996) diluted to 100 mL, and analyzed by ICP-OES (Spectro Arcos FHS16) following USEPA Method 200.7 at the Agricultural and Environmental Services Laboratories. Quality control included AAFCO certified reference materials, analytical duplicates, blanks, and calibration verifications meeting USEPA acceptance criteria. Analytical results are presented in Table 1, Table 2.

Table 2.

Analyzed proximate composition and mineral profile of soybean meal (SBM) and black soldier fly larvae (BSFL) meal on an as-fed basis.

Parameter	SBM	BSFL Meal
Proximate Composition
TMEn (kcal/kg)a	2,387.75	4,490.03
Crude protein (%)	45.40	37.03
Total fat (%)	2.31	35.58
Moisture (%)	12.10	3.85
Dry matter (%)	87.90	96.15
Ash (%)	5.94	5.87
Minerals (%)
Calcium (%)	0.43	0.92
Phosphorus (%)	0.58	0.72
Potassium (%)	2.26	1.16
Magnesium (%)	0.25	0.24
Sulfur (%)	0.25	0.23
Trace Minerals (ppm)
Manganese	33.0	138.0
Iron	74.0	167.0
Zinc	45.0	85.5
Copper	12.0	9.0
Sodium	129.0	1,761.5
Aluminium	11.5	57.0

^aTMEn, nitrogen-corrected true metabolizable energy, determined using precision-fed cecectomized rooster assay.

Experimental design and birds

On d 0, all chicks were weighed individually and distributed by body weight. Birds from each weight category were distributed evenly among 36 pens, with 10 birds per pen, to obtain similar initial weights. The pens were then randomly assigned to six dietary treatments, with six replicate pens per treatment. Following allocation, mean initial body weight was same among treatments (P = 0.999; Table 6). No birds were excluded after allocation, and no mortality occurred during the study. Birds were housed in battery cages under standard management and environmental conditions following Cobb 500 management guidelines (Cobb, 2021). Birds were housed in an environmentally controlled facility. Ambient temperature was recorded daily and adjusted according to bird age and observed comfort, with approximate temperatures of 90–91°F at placement and 88, 81, 75, and 70°F on days 7, 14, 21, and 28, respectively. Relative humidity was maintained below 65%, and an automated ventilation system regulated air circulation and air quality. Chicks received 24L:0D on day 0, 22L:2D on day 1, and 18L:6D from day 2 through day 28. Light intensity was maintained at approximately 2.5 foot-candles. Feed and water were provided ad libitum throughout the 28-day feeding trial, divided into a starter phase (day 0–14) and a grower phase (day 14–28).

Table 6.

Effects of replacing soybean meal with increasing levels of black soldier fly larvae (BSFL) meal on body weight of broiler chickens during 0–28 days of age.

Parametera	Treatment						SEM (n = 6)	P-value
	T0	T2.5	T5	T7.5	T10	T12.5		Mod	Linear	Quad.
Body weight (BW), g
0 d	41	41	41	41	41	41	0.07	0.999	0.857	0.914
14 d	400	369	411	398	403	390	9.18	0.051	0.624	0.515
28 d	1605ab	1600ab	1668a	1609ab	1606ab	1582b	16.69	0.040	0.282	0.023
Body weight gain (BWG), g
0–14 d	360	328	371	357	362	350	9.18	0.051	0.623	0.516
14–28 d	1205	1231	1256	1211	1203	1192	12.89	0.057	0.087	0.014
0–28 d	1565ab	1559ab	1627a	1568ab	1566ab	1542b	16.70	0.041	0.283	0.023
Feed intake (FI), g
0–14 d	476	456	469	480	488	478	7.57	0.087	0.082	0.685
14–28 d	1764	1750	1787	1735	1770	1745	15.06	0.207	0.505	0.664
0–28 d	2240	2206	2256	2215	2258	2223	17.28	0.184	0.841	0.841
Feed conversion ratio (FCR), g/g
0–14 d	1.330	1.406	1.267	1.345	1.348	1.367	0.042	0.355	0.790	0.467
14–28 d	1.465	1.422	1.424	1.433	1.471	1.465	0.017	0.127	0.271	0.051
0–28 d	1.433	1.415	1.387	1.413	1.442	1.442	0.014	0.104	0.219	0.025

^aData represent mean values of six replicates per treatment (n = 6). Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. a–b Means within a row with different superscripts differ significantly (P < 0.05). Mod, P-value from one-way ANOVA testing the overall effect of dietary treatment. Linear and Quad represent P-values from polynomial contrast analysis, indicating the significance of linear and quadratic trends with increasing dietary inclusion level of BSFL meal, respectively. No mortality occurred during the experiment; therefore, FCR was not corrected for mortality.

Dietary treatments

All experimental diets were formulated to be isonitrogenous and isocaloric, meeting or exceeding the nutrient recommendations of the Cobb 500 breeder management guide (Cobb-Vantress, 2022). The control diet contained soybean meal as the primary protein source, whereas soybean meal was progressively replaced with full-fat BSFL meal in the treatment diets at different inclusion levels. The six dietary treatments were as follows: T0 (Control, 0% BSFL), a control diet containing soybean meal only; T2.5 (2.5% BSFL), a diet with 2.5% BSFL meal replacing soybean meal; T5 (5% BSFL), a diet with 5% BSFL meal replacing soybean meal; T7.5 (7.5% BSFL), a diet with 7.5% BSFL meal replacing soybean meal; T10 (10% BSFL), a diet with 10% BSFL meal replacing soybean meal; and T12.5 (12.5% BSFL), a diet with 12.5% BSFL meal replacing soybean meal. All diets were prepared in mash form. Measured TMEn and digestible amino acid values for SBM and BSFL were used to formulate the diets. Because full-fat BSFL supplied both protein and lipid, soybean oil was reduced as BSFL inclusion increased to maintain similar calculated dietary energy. Sand was included as a nonnutritive filler to bring each formulation to 100% after the nutrient specifications had been met. The complete diets were not chemically analyzed; therefore, the nutrient compositions reported in Table 3, Table 4.

Table 3.

Ingredient and calculated nutrient composition of starter diets (0-14 d).

Ingredients (%)	T0	T2.5	T5	T7.5	T10	T12.5
Corn	50.19	50.16	50.13	50.01	49.63	47.89
Soybean Meal	39.07	37.03	34.95	32.77	30.31	28.24
BSFL Meal	0.00	2.50	5.00	7.50	10.00	12.50
Soybean Hulls	4.00	4.00	4.00	4.00	4.00	4.00
Dicalcium Phosphate	2.32	2.27	2.18	2.10	2.07	1.98
Limestone	0.70	0.64	0.60	0.55	0.50	0.45
DL-Methionine	0.40	0.40	0.40	0.40	0.41	0.41
L-Lysine HCl	0.12	0.12	0.12	0.12	0.18	0.18
L-Threonine	0.15	0.15	0.16	0.16	0.16	0.17
Common Salt	0.37	0.36	0.35	0.33	0.32	0.31
aVitamin Premix	0.10	0.10	0.10	0.10	0.10	0.10
bMineral Premix	0.08	0.08	0.08	0.08	0.08	0.08
L-Arginine	0.06	0.06	0.06	0.09	0.14	0.16
Soybean Oil	2.42	1.85	1.18	0.55	0.05	0.01
Filler/Sand	0.01	0.27	0.68	1.22	2.02	3.49
Choline Cl-60%	0.01	0.01	0.01	0.02	0.03	0.03
Total	100.00	100.00	100.00	100.00	100.00	100.00
Calculated Composition
M.E. (Kcal/g)	2.90	2.90	2.90	2.90	2.90	2.90
Crude Protein, %	22.00	22.00	22.00	22.00	22.00	22.00
Calcium, %	0.96	0.96	0.96	0.96	0.96	0.96
Available Phosphorus, %	0.58	0.58	0.58	0.58	0.58	0.58
Sodium, %	0.16	0.16	0.16	0.16	0.16	0.16
Chloride, %	0.25	0.24	0.24	0.24	0.24	0.25
Digestible Lysine, %	1.28	1.26	1.27	1.29	1.28	1.27
Digestible Methionine, %	0.69	0.69	0.70	0.71	0.71	0.69
cTSAA, %	0.95	0.94	0.94	0.94	0.94	0.95
Digestible Threonine, %	0.86	0.86	0.87	0.86	0.86	0.86
Digestible Tryptophan, %	0.27	0.27	0.27	0.27	0.27	0.27
Digestible Arginine, %	1.39	1.37	1.37	1.39	1.38	1.39
Digestible Valine, %	0.98	1.00	1.00	1.00	1.03	0.98
Digestible Isoleucine, %	0.91	0.90	0.90	0.88	0.87	0.91
Digestible Leucine, %	1.77	1.75	1.75	1.70	1.77	1.77

Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels.

^aSupplemented per kg of diet: vitamin A, 3,527 IU; vitamin D3, 1,400 ICU; vitamin E, 19.4 IU; vitamin B12, 0.01 mg; menadione, 1.10 mg; riboflavin, 3.53 mg; d-pantothenic acid, 5.47 mg; thiamine, 0.97 mg; niacin, 20.28 mg; vitamin B6, 1.46 mg; folic acid, 0.57 mg; biotin, 0.08 mg.

^bSupplemented per kg of diet: calcium (Ca), 24 mg; manganese (Mn), 100.5 mg; zinc (Zn), 80.25 mg; magnesium (Mg), 20.1 mg; iron (Fe), 19.73 mg; copper (Cu), 3 mg; iodine (I), 0.75 mg; selenium (Se), 0.3 mg.

^cTSAA = total sulfur amino acids (Methionine + Cysteine).

Table 4.

Ingredient and calculated nutrient composition of Grower diets (14-28 d).

Ingredients (%)	T0		T2.5	T5	T7.5	T10	T12.5
Corn	55.70		54.92	54.88	54.85	54.79	53.03
Soybean Meal		34.03	31.80	29.52	27.28	24.99	22.96
BSFL Meal		0.00	2.50	5.00	7.50	10.00	12.50
Soybean Hulls		4.00	4.00	4.00	4.00	4.00	4.00
Dicalcium Phosphate		1.47	1.44	1.40	1.34	1.30	1.29
Limestone		0.87	0.82	0.78	0.73	0.68	0.63
DL-Methionine		0.38	0.38	0.39	0.39	0.39	0.40
L-Lysine HCl		0.14	0.15	0.16	0.17	0.18	0.18
L-Threonine		0.14	0.14	0.15	0.15	0.15	0.16
Common Salt		0.37	0.36	0.35	0.34	0.32	0.31
aVitamin Premix		0.10	0.10	0.10	0.10	0.10	0.10
bMineral Premix		0.08	0.08	0.08	0.08	0.08	0.08
L-Arginine		0.05	0.07	0.10	0.12	0.15	0.17
Soybean Oil		2.35	1.98	1.33	0.68	0.06	0.01
Filler/Sand		0.01	0.94	1.44	1.94	2.48	3.84
Choline Cl-60%		0.01	0.02	0.02	0.03	0.03	0.04
TiO₂		0.30	0.30	0.30	0.30	0.30	0.30
Total		100.00	100.00	100.00	100.00	100.00	100.00
Calculated Composition
M.E. (Kcal/g)		2.95	2.95	2.95	2.95	2.95	2.95
Crude Protein, %		20.00	20.00	20.00	20.00	20.00	20.01
Calcium, %		0.80	0.80	0.80	0.80	0.80	0.80
Available Phosphorus, %		0.40	0.40	0.40	0.40	0.40	0.40
Sodium, %		0.16	0.16	0.16	0.16	0.16	0.16
Chloride, %		0.25	0.25	0.24	0.24	0.24	0.24
Digestible Lysine, %		1.16	1.16	1.16	1.16	1.16	1.16
Digestible Methionine, %		0.65	0.65	0.66	0.66	0.67	0.68
cTSAA, %		0.88	0.88	0.88	0.88	0.88	0.88
Digestible Threonine, %		0.78	0.78	0.78	0.78	0.78	0.78
Digestible Tryptophan, %		0.24	0.24	0.24	0.24	0.24	0.24
Digestible Arginine, %		1.25	1.25	1.25	1.25	1.25	1.25
Digestible Valine, %		0.88	0.89	0.89	0.90	0.91	0.92
Digestible Isoleucine, %		0.82	0.81	0.80	0.80	0.79	0.78
Digestible Leucine, %		1.66	1.63	1.62	1.60	1.58	1.56

Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels.

^aSupplemented per kg of diet: vitamin A, 3,527 IU; vitamin D3, 1,400 ICU; vitamin E, 19.4 IU; vitamin B12, 0.01 mg; menadione, 1.10 mg; riboflavin, 3.53 mg; d-pantothenic acid, 5.47 mg; thiamine, 0.97 mg; niacin, 20.28 mg; vitamin B6, 1.46 mg; folic acid, 0.57 mg; biotin, 0.08 mg.

^bSupplemented per kg of diet: calcium (Ca), 24 mg; manganese (Mn), 100.5 mg; zinc (Zn), 80.25 mg; magnesium (Mg), 20.1 mg; iron (Fe), 19.73 mg; copper (Cu), 3 mg; iodine (I), 0.75 mg; selenium (Se), 0.3 mg.

^cTSAA = total sulfur amino acids (Methionine + Cysteine).

Growth performance

Health status was recorded daily throughout the experimental period. Live body weight (BW) was measured at the start of the trial for allocation and subsequently on days 7, 14 and 28 on a per-pen basis. Feed intake was recorded over the same intervals to calculate body weight gain (BWG) and feed conversion ratio (FCR). On day 28, one bird per cage was randomly selected and euthanized by manual cervical dislocation following IACUC protocol for sample collection. Jejunal tissue was immediately frozen in liquid nitrogen, transferred to −80°C, and subsequently used for the quantitative PCR analyses of different genes described below.

Intestinal morphology

One bird per pen was euthanized on day 28 for intestinal sampling. Mid-sections of the duodenum, jejunum, and ileum were fixed in 10% neutral-buffered formalin, embedded in paraffin, sectioned (5 µm), and stained with hematoxylin and eosin following (Novotný et al., 2023). Villus height, crypt depth, and villus height to crypt depth ratio (V/C) were measured under a BZ-series microscope (Keyence, Osaka, Japan) (Teng et al., 2023).

Blood, oxidative stress, and immune parameters

Blood samples were collected on day 28 from one bird per pen. Serum was separated by centrifugation (3,000 × g for 15 min at 4°C) and stored at −80°C until further analysis. Superoxide dismutase (SOD) activity was determined using a commercial assay kit (Item No. 706002; Cayman Chemical, Ann Arbor, MI, USA) according to the manufacturer’s instructions. Similarly, Total antioxidant capacity (T-AOC) in serum was quantified using the QuantiChrom™ Antioxidant Assay Kit (BioAssay Systems, Hayward, CA, USA), following the manufacturer’s protocol (Choi et al., 2021).

Gene expression analysis

On day 28, jejunal tissue samples were collected from one bird per pen, immediately frozen in liquid nitrogen and stored at −80°C. Total RNA was extracted using QIAzol lysis reagent (Qiagen, Valencia, CA, USA) after homogenization with a bead beater (Biospec Products, Bartlesville, OK, USA). RNA purity and concentration were verified using Thermo Scientific™ NanoDrop™ Eight Spectrophotometer (Thermo Scientific, Waltham, MA) (260/280 ratio of 1.8–2.0). Then, complementary DNA (cDNA) was synthesized using a reverse transcription kit (Applied Biosystems, Foster City, CA, USA) (Choi et al., 2022a)

Quantitative PCR was performed using SYBR Green Master Mix on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The primer sets used for the analysis of tight junction, mucin, nutrient transporters and inflammatory cytokine genes are listed in Table 5. The qPCR program began with an initial denaturation at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, annealing at the optimized temperature for 20 seconds, and extension at 72°C for 15 seconds. Gene expression levels were normalized to the housekeeping genes β-actin (ACTB) and GAPDH, and relative expression was calculated using the 2^−ΔΔCt method, with the control group T0 (0% BSFL) used as the baseline.

Table 5.

Nucleotide sequences of primers used for mRNA expression analysis of tight junction proteins, mucin, nutrient transporters, and immune-related cytokines in broiler jejunal tissue.

Gene	Forward Primer (5′–3′)	Reverse Primer (5′–3′)	Product size (bp)	Accession number
Tight Junction Proteins
Claudin5 (CLDN5)	ACCATCTGGGAAGGGCTGT	GGATGCAGTTGGTGCACTG	130	NM_204201.2
TJP2 (ZO-2)	GAAAGCAGACCCTGCTCAAC	TGGATGAATGCAAATCCAGA	141	NM_001396726.1
TJP1 (ZO-1)	GAGATTCCGAGGTTTGCGTA	GGACCAAAAATGGTCACAGG	150	XM_015278975.4
Occludin (OCLN)	TACTACCCCTCGGGCACCTA	CTGATCCTTCCCCTTCTCCT	105	NM_205128.1
JAM-2	AAGGATTCTGGGACCTACCG	GTTCCCGTCATTGCAGAGTT	143	NM_001397141.1
Mucin
MUC2	ATGCGATGTTAACACAGACTC	GTGGAGCACAGCAGACTTTG	110	JX284122.1
Nutrient Transporters
y⁺LAT1	TATTGCTGTGGCCATGTCTT	AGCAGGGACTGGTGTGAAAC	145	XM_418326.8
LAT1 (SLC7A5)	CCCGAGAAGGACACCTACCT	ATTGGAGAAGGCGTAGAGCA	113	NM_001030579.3
B⁰AT1 (SLC6A19)	TCTATTGAAGATTCGGGCAC	AATGGTAAGCACAAGGTATGG	153	XM_419056.8
SGLT1	CCATGGGGCTGAATCTGTAT	TCCCACAACCATGATAAACG	128	NM_001397792.1
Cytokines
IL-6	GCTACAGCACAAAGCACCTG	GACTTCAGATTGGCGAGGAG	112	NM_204628.2
IFN-γ	GGCGTGAAGAAGGTGAAAGA	TCCTTTTGAAACTCGGAGGA	133	NM_205149.2
IL-10	GCTGCGCTTCTACACAGATG	CTCCTCTTCTCGCAGGTGAA	150	NM_001004414.4
IL-22	CAGACTCATCGGTCAGCAAA	GGTACCTCTCCTTGGCCTCT	122	NM_001199614.1
Reference Genes
GAPDH	CCTCTCTGGCAAAGTCCAAG	CCGTTCTCAGCCTTGACAGT	126	NM_204305.2
ACTB	GTTGACAATGGCTCCGGTAT	TCTTTCTGGCCCATACCAAC	125	NM_205518.2

CLDN5, claudin 5; TJP2 (ZO-2), tight junction protein 2 (zonula occludens 2); TJP1 (ZO-1), tight junction protein 1 (zonula occludens 1); OCLN, occludin; JAM-2, junctional adhesion molecule 2; MUC2, mucin 2; y⁺LAT1 (SLC7A7), y⁺L amino acid transporter 1 (solute carrier family 7 member 7); LAT1 (SLC7A5), l-type amino acid transporter 1 (solute carrier family 7 member 5); B⁰AT1 (SLC6A19), sodium-dependent neutral amino acid transporter B⁰AT1 (solute carrier family 6 member 19); SGLT1 (SLC5A1), sodium–glucose cotransporter 1; IL-6, interleukin 6; IFN-γ, interferon gamma; IL-10, interleukin 10; IL-22, interleukin 22; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; and ACTB, beta-actin.

Bone and body composition analysis

On day 28, one bird per replicate was euthanized for Dual-Energy X-ray Absorptiometry (DEXA; GE Healthcare, Chicago, IL, USA) analysis following (Goo et al., 2025)The scanning range was 196.6 × 62.0 cm, with settings of 76 kV, 0.15 mA, and 1.8 μGy. Calibration was performed before scanning. Measured parameters included bone mineral density (BMD), bone mineral content (BMC), BMC-to-body weight ratio (BMR%), and fat and lean percentages (Liu et al., 2024; Paneru et al., 2025). Average scan time was ∼26 min per bird.

Microstructural analysis of the femur bone

Femur samples were collected from selected birds on day 28 to evaluate bone microarchitecture using microcomputed tomography (MicroCT). After removing all muscle and soft tissue, the femurs were wrapped in two layers of moistened cheesecloth, placed in 50 mL centrifuge tubes, and stored at −20°C until scanning. Before analysis, the samples were thawed at room temperature for around 6 h. Alignment and flat-field correction tests were performed according to the manufacturer’s guidelines to ensure optimal image calibration (Bruker MicroCT, Billerica, MA, USA). Scanning was performed using a Skyscan X-ray Microtomography system (Model 1275; Bruker MicroCT, Billerica, MA, USA). The X-ray source was operated at 80 kV and 125 μA, with a 0.5 mm aluminum filter to minimize beam-hardening effects. Images were acquired at a pixel size of 25 μm, over a 180° rotation, with a rotation step of 0.6°, and four images captured per rotation. These settings were optimized based on previously established protocols (Sharma et al., 2023; Liu et al., 2024). The two-dimensional projection images were reconstructed into three-dimensional models using N-Recon software (Bruker MicroCT). The reconstructed models were vertically realigned in Data Viewer software to maintain consistent anatomical orientation. The region of interest (ROI) was defined in CTAn software and included the distal metaphysis and diaphysis regions of the femur (approximately 200–300 cross-sections, corresponding to 5–7.5 mm in height). Within each ROI, cortical and trabecular bone compartments were segmented separately following the method described by (Chen and Kim., 2020) to enable detailed structural analysis. To calibrate bone mineral density (BMD), two hydroxyapatite phantoms with known densities (0.25 and 0.75 g/cm³) were scanned under identical settings. This calibration ensured accurate conversion of grayscale values to mineral density. Quantitative morphometric parameters were computed using CTAn software as described by (Bouxsein et al., 2010).

Statistical analysis

All statistical analyses were conducted using JMP Pro software (version 17.2; JMP Statistical Discovery LLC, Cary, NC, USA). Model residuals were tested for normality using the Shapiro–Wilk test before analysis. As the normality assumption was satisfied, the data were analyzed using one-way ANOVA with dietary treatment as the fixed effect. When a significant treatment effect was observed (P < 0.05), means were separated using Tukey’s honestly significant difference (HSD) test. In addition, orthogonal polynomial contrasts were applied to evaluate linear and quadratic responses to increasing levels of BSFL inclusion (0, 2.5, 5.0, 7.5, 10.0, and 12.5%) in the diet. Significance was declared at P < 0.05, and trends (0.05 < P < 0.1) were also presented (Choi et al., 2022b; Gyawali et al., 2026).

Results

Growth performance

The effects of replacing soybean meal with increasing levels of full-fat BSFL meal on broiler growth performance from 0 to 28 days are presented in Table 6. Body weight did not differ significantly among the treatments on day 14 (P = 0.051), but tended to differ among treatments, with birds fed 5% BSFL meal having numerically higher body weight than the other groups. However, by day 28, a significant difference was observed among the treatments (P = 0.040), where birds fed 5% BSFL meal had the highest final body weight, which was significantly higher than those fed 12.5% BSFL meal. In addition, a significant quadratic response was observed on day 28 (P = 0.023). Body weight gain followed a similar pattern during the starter phase (0–14 d), tending to differ among treatments (P = 0.051), with birds fed 5% BSFL meal having numerically higher gain. In the grower phase (14–28 d), BWG did not differ significantly among the treatments (P > 0.05); however, a significant quadratic response was observed (P = 0.014). Overall BWG from day 0 to 28 differed significantly among the treatments (P = 0.041), with birds fed 5% BSFL meal showing the highest total gain, significantly greater than those fed 12.5% BSFL meal, while the remaining treatments were intermediate and also a significant quadratic response was observed (P = 0.023).

Feed intake tended to differ among the treatments during the starter phase (0–14 d; P = 0.087), with birds fed 10% BSFL meal having numerically higher intake, and a tendency for a linear increase was also observed (P = 0.082). Feed intake did not differ significantly among the treatments at any other phase of the study (P > 0.05), and no significant linear or quadratic trends were observed across the 28-day period. Similarly, feed conversion ratio was not significantly affected by BSFL inclusion level in any phase (P > 0.05); however, a significant quadratic response was noted overall period (0–28 d; P = 0.025).

Intestinal morphology

The effects of replacing soybean meal with increasing levels of BSFL meal on intestinal morphology are presented in Table 7. In the duodenum, villus height was not significantly affected by dietary treatment (P = 0.472). However, crypt depth showed a significant difference among the treatments (P = 0.004), with a significant linear increase (P < 0.001) and quadratic response (P = 0.023); birds fed 12.5% BSFL showed the highest crypt depth, whereas those in the 0–5% BSFL groups had comparatively shallower crypts. The villus height-to-crypt depth ratio also differed significantly (P = 0.028) and showed both a linear and quadratic response (P = 0.007 and P = 0.032, respectively), with the highest ratio observed in birds fed 5% BSFL, declining at higher inclusion levels, suggesting enhanced absorptive potential at moderate inclusion levels.

Table 7.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (BSFL) meal on intestinal histomorphology of broiler chickens on day 28.

	Treatment						SEM (n = 6)	P-value
Parametersa	T0	T2.5	T5	T7.5	T10	T12.5		Mod.	Linear	Quad.
Duodenum
Villus Height, V (µm)	2615	2512	2771	2720	2577	2653	97.8	0.472	0.690	0.431
Crypt Depth, C (µm)	271b	253b	265b	280ab	293ab	334a	13.5	0.004	<0.001	0.023
V/C	9.7ab	10.15ab	10.59a	9.7ab	8.9ab	8.4b	0.46	0.028	0.007	0.032
Jejunum
Villus Height, V (µm)	1338.7	1315.1	1469.8	1461.9	1315.3	1338.8	47.5	0.061	0.981	0.033
Crypt Depth, C(µm)	255.9	233.3	254.6	236.6	257.2	282.9	13.93	0.181	0.115	0.072
V/C	5.3	5.8	5.9	6.4	5.3	4.9	0.36	0.081	0.321	0.009
Ileum
Villus Height, V (µm)	838.7	829.8	887.7	842.7	830.9	832.2	34.41	0.834	0.791	0.472
Crypt Depth, C(µm)	221.9	186.3	208.4	203.1	215.9	216	10.62	0.231	0.55	0.152
V/C	3.9	4.6	4.4	4.2	3.9	3.9	0.20	0.081	0.261	0.041

^aData represent mean values of six replicates per treatment (n = 6). Dietary treatments include graded replacement levels of black soldier fly larvae (Hermetia illucens; BSFL) meal. V/C, villus height-to-crypt depth ratio. Villus height and crypt depth are expressed in micrometers (µm). Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. a–b Means within a row with different superscripts differ significantly (P < 0.05). Mod, P-value from one-way ANOVA testing the overall effect of dietary treatment. Linear and Quad represent P-values from polynomial contrast analysis, indicating the significance of linear and quadratic trends with increasing dietary inclusion level of BSFL meal, respectively.

In the jejunum, villus height tended to increase at moderate BSFL inclusion levels (P = 0.061), with a quadratic response observed (P = 0.033), peaking at 5.0–7.5% BSFL before declining at higher levels. Crypt depth was not significantly affected by dietary treatment (P = 0.181). The V/C ratio showed a tendency toward significance (P = 0.081), with a quadratic response (P = 0.009), indicating a slight improvement in mucosal structure at intermediate BSFL levels, particularly at 7.5%, before declining at higher inclusion levels.

In the ileum, no significant differences were observed in villus height (P = 0.834) or crypt depth (P = 0.231). The V/C ratio tended to differ among treatments (P = 0.081), with birds receiving 2.5–7.5% BSFL showing numerically higher ratios compared to the control, and a significant quadratic response was observed (P = 0.041). Overall, moderate inclusion levels, particularly around 5%, were associated with increased villus height and higher V/C ratios, indicating potential improvements in nutrient absorption and intestinal integrity.

Antioxidant status

The effect of replacing soybean meal with BSFL meal on serum antioxidant parameters is summarized in Figure 1. The level of both T-AOC and SOD activity was not affected by dietary treatment (P = 0.664 and P = 0.155, respectively). Similarly, no significant linear response was observed for either parameter with increasing BSFL inclusion (linear P = 0.396 and P = 0.319, respectively). In addition, no significant quadratic response was observed for T-AOC or SOD (quadratic P = 0.192 and P = 0.187, respectively), indicating that antioxidant status was largely maintained across all inclusion levels.

Figure 1.

Effect of dietary black soldier fly larvae (Hermetia illucens; BSFL) meal inclusion on serum antioxidant parameters of broiler chickens on day 28. (A) Total antioxidant capacity (T-AOC); (B) Superoxide dismutase (SOD) activity. Data represent means ± SEM of six replicates per treatment (n = 6). Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal replacing soybean meal at graded levels. P_mod, P-value from one-way ANOVA; P_L and P_Q represent P-values from polynomial contrast analysis for linear and quadratic trends, respectively.

Intestinal tight-junction and mucin-related genes

The effect of BSFL meal replacing soybean meal on the expression of intestinal barrier genes is shown in Figure 2, where dietary BSFL inclusion significantly affected the expression of several intestinal barrier-related genes. TJP1 (ZO-1) and TJP2 (ZO-2) were affected by treatment (P < 0.0001 and 0.007, respectively) and showed linear decreases as BSFL level increased (linear P < 0.0001 and 0.002). However, their expression remained relatively stable from 0 to 5% BSFL, and the main reduction was observed at the higher inclusion level. For TJP1, the 5% BSFL group had the highest expression and lowered in higher dose groups. For TJP2, the 12.5% group showed the lowest expression compared with the 0–5% groups. Similarly, the expression of JAM-2 decreased linearly with increasing BSFL levels (linear P = 0.039), with higher expression at 2.5% and 5% BSFL and lower expression at the highest inclusion level, following the pattern observed for TJP1 and TJP2. Occludin also decreased as BSFL increased (linear P < 0.0001) with lower values at 12.5% compared with the lower inclusion levels. In contrast, CLDN5 did not differ among diets (P = 0.144). Interestingly, Muc-2 was not affected overall (P = 0.28) but showed a slight linear tendency (linear P = 0.07), with numerically higher expression at the higher BSFL levels. Overall, tight-junction–related genes (TJP1, TJP2, Occludin, and JAM-2) were generally stable up to 5% BSFL and decreased at higher inclusion levels, whereas CLDN5 and Muc-2 did not show clear treatment differences.

Figure 2.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (Hermetia illucens; BSFL) meal on intestinal tight junction and mucin-related gene expression in broiler chickens on day 28. Gene expression values are presented as fold change relative to the control group (T0) after normalization to reference genes. CLDN5, claudin-5; TJP2 (ZO-2), tight junction protein 2 (zonula occludens-2); TJP1 (ZO-1), tight junction protein 1 (zonula occludens-1); Occludin, a tight junction integral membrane protein; JAM-2, junctional adhesion molecule-2; Muc-2, mucin-2. Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. Bars represent means ± SEM (n = 6). a–c Means with different superscripts differ significantly (P < 0.05). P_mod, P-value from one-way ANOVA; P_L and P_Q represent P-values from polynomial contrast analysis for linear and quadratic trends, respectively.

Cytokines

The effect of BSFL on cytokine gene expression is shown in Figure 3. There were no significant differences among the treatments, but both IL-6 and IFN-γ showed linear decrease in trend with increasing BSFL levels (linear P = 0.06 and 0.069 respectively). However, there were no notable differences among the treatments for IL-10 and IL-22 (P > 0.05), and no clear linear or quadratic patterns were observed.

Figure 3.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (Hermetia illucens; BSFL) meal on cytokine gene expression in broiler chickens on day 28. Gene expression values are presented as fold change relative to the control group (T0) after normalization to reference genes. IL-6, interleukin-6; IFN-γ, interferon-gamma; IL-10, interleukin-10; IL-22, interleukin-22. Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. Bars represent means ± SEM (n = 6). P_mod, P-value from one-way ANOVA; P_L and P_Q represent P-values from polynomial contrast analysis for linear and quadratic trends, respectively.

Amino-acid and glucose transporter

The effect of BSFL inclusion on amino acid and glucose transporter expression is summarized in Figure 4. LAT1 (SLC7A5) was affected by treatment (P < 0.0001) and showed significant linear and quadratic responses (linear P = 0.0001; quadratic P = 0.0003). LAT1 expression was stable across 0–5% BSFL but declined substantially at 10% and 12.5%, indicating downregulation at higher inclusion levels. In contrast, y⁺LAT1 was not affected (P = 0.126). B⁰AT1 and SGLT1 also did not differ among the treatments, and no clear linear trends were observed. In summary, LAT1 was the only transporter clearly affected by BSFL inclusion, with expression maintained at 0–5% and reduced at higher levels, while y⁺LAT1, B⁰AT1, and SGLT1 remained stable across diets.

Figure 4.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (Hermetia illucens; BSFL) meal on amino acid and glucose transporter gene expression in broiler chickens on day 28. Gene expression values are presented as fold change relative to the control group (T0) after normalization to reference genes. y⁺LAT1, y⁺ l-type amino acid transporter 1; LAT1 (SLC7A5), large neutral amino acid transporter 1 (solute carrier family 7, member 5); B⁰AT1, broad neutral amino acid transporter 1; SGLT1, sodium-glucose linked transporter 1. Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. Bars represent means ± SEM (n = 6). a–c Means with different superscripts differ significantly (P < 0.05). The solid and dashed lines in LAT1 indicate significant linear and quadratic trends, respectively. P_mod, P-value from one-way ANOVA; P_L and P_Q represent P-values from polynomial contrast analysis for linear and quadratic trends, respectively.

Body composition

The effects of replacing soybean meal with increasing levels of BSFL meal on body composition of broiler chickens at 28 days are summarized in Table 8. There were no significant differences among the treatments in bone mineral density (BMD) (P = 0.522), bone mineral content (BMC) (P = 0.131), or bone mineral per body weight (BMR%) (P = 0.210). Total tissue weight tended to differ among treatments (P = 0.061), with the control group (T0) having numerically the highest total tissue weight compared to BSFL-fed birds.

Table 8.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (BSFL) meal on bone mineral density (BMD), bone mineral content (BMC), and body composition of broiler chickens on day 28.

Parametera	Treatment						SEM (n = 6)	P-value
	T0	T2.5	T5	T7.5	T10	T12.5		Mod.	Linear	Quad.
BMD, mg/cm2	196	192	190	189	197	189	3.8	0.522	0.461	0.632
BMC, g	24.7	21.7	21.8	21.6	23.1	21.6	0.94	0.131	0.152	0.138
Tissue, g	1635	1510	1598	1447	1633	1525	44.5	0.061	0.392	0.252
Fat, g	116b	145ab	171a	139ab	167a	174 a	9.23	<0.0001	<0.001	0.271
Lean, g	1519	1365	1427	1308	1466	1351	41.41	0.011	0.067	0.145
Fat %	7.1b	9.6a	10.7a	9.6a	10.2a	11.4a	0.54	0.001	<0.0001	0.091
Lean %	92.9a	90.4b	89.3b	90.4b	89.7b	88.6b	0.53	0.001	<0.001	0.098
BMR, %	1.51	1.44	1.37	1.49	1.41	1.42	0.043	0.21	0.243	0.362

^aData represent mean values of six replicates per treatment (n = 6). Dietary treatments include graded replacement levels of black soldier fly larvae (Hermetia illucens; BSFL) meal. BMD, bone mineral density (mg/cm²); BMC, bone mineral content (g); Fat, total body fat mass (g); Lean, total lean body mass (g); Fat %, percentage of body fat; Lean %, percentage of lean body mass; BMR%, bone mineral content as a percentage of body weight. All parameters were measured using dual-energy X-ray absorptiometry (DEXA). Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. a–b Means within a row with different superscripts differ significantly (P < 0.05). Mod, P-value from one-way ANOVA testing the overall effect of dietary treatment. Linear and Quad represent P-values from polynomial contrast analysis, indicating the significance of linear and quadratic trends with increasing dietary inclusion level of BSFL meal, respectively.

Body fat weight increased significantly with BSFL inclusion (P < 0.0001), showing a clear linear response (P < 0.001), with birds fed BSFL diets having higher fat weight compared with the control group. Similarly, fat percentage increased significantly with BSFL inclusion (P = 0.001), following a significant linear response (P < 0.0001), where birds fed any level of BSFL had significantly higher fat percentage than the control.

In contrast, lean tissue weight differed significantly among treatments (P = 0.011), with a tendency for a linear decrease (P = 0.067) as BSFL inclusion increased, with the control group having numerically the highest lean weight. Lean tissue percentage also decreased significantly with increasing BSFL level (P = 0.001), following a significant linear response (P < 0.001), where the control group had the highest lean percentage compared to BSFL-fed birds.

Femoral bone microstructure and mineral density

Total volume of interest (VOI) microstructure

The inclusion of BSFL meal significantly affected tissue volume (TV; P = 0.009), bone volume fraction (BVR; P = 0.025), tissue surface (TS; P = 0.001), bone surface (BS; P < 0.001), bone surface–to–bone volume ratio (BS/BV; P = 0.001), and bone surface density (BS/TV; P = 0.007) (Table 9). Broilers fed the 5% BSFL diet had notably higher tissue volume, bone surface, and surface density compared with birds fed the control and other BSFL diets (P < 0.05). The same group also showed the highest bone surface–to–bone volume ratio, indicating enhanced trabecular connectivity and surface complexity. Quadratic effects were significant for BVR (P = 0.044), BS/BV (P = 0.008), and BS/TV (P = 0.031), indicating that bone structure improved up to moderate inclusion levels and then plateaued. These results suggest that partial replacement of soybean meal with BSFL meal, particularly at 5%, enhanced femoral trabecular surface properties and microstructural organization.

Table 9.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (BSFL) meal on total volume of interest of femur microstructure on day 28.

Parametera	Treatment						SEM (n = 6)	P-value
	T0	T2.5	T5	T7.5	T10	T12.5		Mod.	Linear	Quad.
TV, mm3	846.5ab	777.9b	918.1a	762.2b	776.3b	795.9 ab	30.53	0.009	0.115	0.827
BV, mm3	353.4	305.7	328	300.3	324.6	313.9	13.04	0.087	0.132	0.116
BVR, %	41.8	39.3ab	35.9b	39.4ab	41.8 a	39.4 ab	1.25	0.025	0.927	0.044
TS, mm2	594.2ab	557.1b	644.3a	556.3b	554.1 b	570.6 b	15.36	0.001	0.105	0.530
BS, mm2	2081.1b	1859.9b	2731.4a	1928.7b	2052.4 b	2001.1 b	131.9	<0.001	0.575	0.086
BS/BV, mm−1	5.89 b	6.07b	8.34a	6.42b	6.35 b	6.43 b	0.39	0.001	0.609	0.008
BS/TV, mm−1	2.45 b	2.38b	2.96a	2.52ab	2.63 ab	2.51 b	0.104	0.007	0.497	0.031

^aData represent mean values of six replicates per treatment (n = 6). Dietary treatments include graded replacement levels of black soldier fly larvae (Hermetia illucens; BSFL) meal. TV, tissue volume (mm³); BV, bone volume (mm³); BVR, bone volume fraction (BV/TV × 100%); TS, tissue surface (mm²); BS, bone surface (mm²); BS/BV, bone surface to bone volume ratio (mm⁻¹); BS/TV, bone surface density (mm⁻¹). All parameters were measured using micro-computed tomography (micro-CT). a–b Means within a row with different superscripts differ significantly (P < 0.05). Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. Mod, P-value from one-way ANOVA testing the overall effect of dietary treatment. Linear and Quad represent P-values from polynomial contrast analysis, indicating the significance of linear and quadratic trends with increasing dietary inclusion level of BSFL meal, respectively.

Trabecular bone microstructure

There were no significant differences in trabecular tissue volume, bone volume, or surface parameters among treatments (Table 11). Quadratic responses were significant for trabecular number (Tb.N; P = 0.010) and structure model index (SMI; P = 0.005). A tendency for a quadratic effect was observed for bone surface (P = 0.064). Meanwhile, the trabecular pattern factor (Tb.Pf) tended to show a linear response (P = 0.093)

Table 11.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (BSFL) meal on femoral trabecular bone microstructure on day 28.

Parametera	Treatment						SEM (n = 6)	P-value
	T0	T2.5	T5	T7.5	T10	T12.5		Mod.	Linear	Quad.
TV, mm3	116.6	133.5	74.2	96.9	166.9	132	39.42	0.654	0.551	0.481
BV, mm3	4.16	3.28	2.95	2.73	5.05	6.06	1.26	0.243	0.153	0.071
BVR, %	3.57	2.45	3.98	2.81	3.03	4.59	1.82	0.112	0.652	0.161
TS, mm2	332.5	316.7	335.7	403.7	497.6	505.8	98.32	0.598	0.081	0.643
BS, mm2	153.7	106.6	108.6	106.8	174.6	196.1	42.22	0.272	0.212	0.064
BS/BV, mm−1	36.9	32.5	36.8	39.1	50.2	32.4	4.44	0.167	0.051	0.532
Tb. N, mm−1	0.568	0.191	0.232	0.257	0.274	0.674	0.221	0.134	0.605	0.010
Tb.Pf, mm−1	20.5	15.5	19.4	18.8	16.1	14.4	2.03	0.238	0.093	0.591
SMI	2.48	2.6	2.78	2.78	2.72	2.41	0.11	0.118	0.961	0.005

^aData represent mean values of six replicates per treatment (n = 6). Dietary treatments include graded replacement levels of black soldier fly larvae (Hermetia illucens; BSFL) meal. TV, tissue volume (mm³); BV, bone volume (mm³); BVR, bone volume fraction (BV/TV × 100%); TS, tissue surface (mm²); BS, bone surface (mm²); BS/BV, bone surface to bone volume ratio (mm⁻¹); Tb.N, trabecular number (mm⁻¹); Tb.Pf, trabecular pattern factor (mm⁻¹); SMI, structure model index. All parameters were measured using micro-computed tomography (micro-CT). Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. Mod, P-value from one-way ANOVA testing the overall effect of dietary treatment. Linear and Quad represent P-values from polynomial contrast analysis, indicating the significance of linear and quadratic trends with increasing dietary inclusion level of BSFL meal, respectively.

Cortical bone microstructure

No significant differences in femoral cortical tissue volume, bone volume, tissue surface, bone surface, or trabecular thickness (Tb.Th) were observed among the treatments (Table 10). Similarly, the number of closed pores (N), volume of closed pores (VCp), and surface area of closed pores (SCp) were similar among the groups (P > 0.05). The inclusion of BSFL meal in place of soybean meal therefore did not affect cortical bone size or porosity. However, a quadratic effect was detected for bone volume fraction (P = 0.032), and a tendency for a quadratic response was also noted for the number of closed pores (P = 0.061). Overall, on day 28 cortical bone structure and pore characteristics remained stable with BSFL replacement up to 12.5%.

Table 10.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (BSFL) meal on femoral cortical bone microstructure on day 28.

Parametera	Treatment						SEM (n = 6)	P-value
	T0	T2.5	T5	T7.5	T10	T12.5		Mod.	Linear	Quad.
TV, mm3	235.4	232.7	219.2	221.1	230.2	224.6	11.3	0.891	0.545	0.472
BV, mm3	228.7	222.0	204.6	210.9	221.2	215.3	11.6	0.641	0.483	0.241
BVR, %	97.2	95.4	93.8	95.4	96.0	95.8	10.4	0.113	0.608	0.032
TS, mm2	988.6	942.3	953.3	923.7	937.7	924.1	28.8	0.625	0.141	0.513
BS, mm2	1036.2	1016.7	1033.5	1003.4	1003.2	985.6	31.4	0.394	0.231	0.842
BS/BV, mm −1	4.56	4.6	5.11	4.73	4.57	4.63	0.70	0.601	0.94	0.282
N	125.2	152.3	178.8	191.5	140.8	153.2	21.6	0.305	0.521	0.061
VCp, mm3	0.079	0.086	0.112	0.123	0.071	0.123	0.021	0.312	0.288	0.662
SCp, mm2	4.56	5.39	6.63	7.25	4.49	6.61	1.05	0.311	0.361	0.335

^aData represent mean values of six replicates per treatment (n = 6). Dietary treatments include graded replacement levels of black soldier fly larvae (Hermetia illucens; BSFL) meal. TV, tissue volume (mm³); BV, bone volume (mm³); BV/TV, bone volume fraction (%); TS, tissue surface (mm²); BS, bone surface (mm²); BS/BV, bone surface to bone volume ratio (mm⁻¹); N, number of cortical closed pores; VCp, total volume of closed pores (mm³); SCp, surface area of closed pores (mm²). All parameters were measured using micro-computed tomography (micro-CT). Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels. a–b Means within a row with different superscripts differ significantly (P < 0.05). Mod, P-value from one-way ANOVA testing the overall effect of dietary treatment. Linear and Quad represent P-values from polynomial contrast analysis, indicating the significance of linear and quadratic trends with increasing dietary inclusion level of BSFL meal, respectively.

Bone mineral density

Bone mineral density of trabecular, cortical, and total femoral regions was not significantly affected by dietary treatments (Table 12). Cortical bone mineral density tended to differ among treatments (P = 0.061), with a tendency for a quadratic response (P = 0.083), suggesting slight variation across inclusion levels. Overall, BSFL inclusion up to 12.5% did not compromise mineral deposition in the femur.

Table 12.

Effect of replacing soybean meal with increasing levels of black soldier fly larvae (BSFL) meal on bone mineral density on day 28.

Parameter	Treatment							SEM (n = 6)	P-value
	T0		T2.5	T5	T7.5	T10	T12.5		Mod.	Linear	Quad.
Trabecular bone, mg/cm3		130.2	166.9	160.4	156.4	149.3	137.4	16.0	0.584	0.878	0.107
Cortical bone, mg/cm3		637.4	647.5	613.2	621.6	648.5	640.1	9.3	0.061	0.749	0.083
Total VOI, mg/cm3		254.8	266.2	231.1	257.1	275.4	257.0	12.0	0.155	0.494	0.533

¹Data represent mean values of six replicates per treatment (n = 6). Dietary treatments include graded replacement levels of black soldier fly larvae (Hermetia illucens; BSFL) meal. Trabecular bone, trabecular bone mineral density (mg/cm³); Cortical bone, cortical bone mineral density (mg/cm³); Total VOI, total bone mineral density within the volume of interest (mg/cm³). VOI, volume of interest. All parameters were measured using micro-computed tomography (micro-CT). Dietary treatments: T0 = 0%, T2.5 = 2.5%, T5 = 5%, T7.5 = 7.5%, T10 = 10%, and T12.5 = 12.5% BSFL meal inclusion, replacing soybean meal at graded levels a–b Means within a row with different superscripts differ significantly (P < 0.05). Mod, P-value from one-way ANOVA testing the overall effect of dietary treatment. Linear and Quad represent P-values from polynomial contrast analysis, indicating the significance of linear and quadratic trends with increasing dietary inclusion level of BSFL meal, respectively.

Discussion

Many studies have evaluated defatted or partially defatted BSFL meal as a soybean meal replacement (Dabbou et al., 2019; Gariglio et al., 2019; Schiavone et al., 2019; Mat et al., 2022). However, a few studies have examined full-fat BSFL meal in broilers. Inclusion levels in these studies ranged from very low (< 3%) to moderate replacement or even complete substitution of soybean meal (de Souza Vilela et al., 2021b; Murawska et al., 2021; Lee et al., 2025). However, the reported results remain inconsistent. In the present study, 5% inclusion resulted in the highest body weight gain, with a clear quadratic response. Growth improved at moderate inclusion and declined toward 12.5%. A similar quadratic pattern was reported by (Mat et al., 2022), where 4% inclusion produced the highest 6-week body weight. Meanwhile, slightly higher optimal inclusion levels (around 10%) were observed in other studies (Dabbou et al., 2019; Schiavone et al., 2019). These differences may be related to the form and nutrient composition of BSFL, rearing substrate, processing conditions, bird strain, and management practices (Spranghers et al., 2017). Chitin may be one factor contributing to this variation. Full-fat BSFL meal has been reported to contain 4.65% chitin (Chu et al., 2020), whereas Alafif et al. (2025) reported values of 6.07–6.42% of DM. Similarly, BSFL reared on brewer’s spent grain contained 4.7% chitin on a DM basis (Eggink et al., 2022). Variation among these values may reflect differences in larval stage and analytical method. Since the same BSFL meal was used in all treatment diets, dietary chitin likely increased as BSFL inclusion increased. At lower levels, chitin may have functional effects, whereas higher levels may reduce protein digestion and nutrient absorption (Murawska et al., 2021; Facey et al., 2023). It may also affect inflammatory or allergic pathways, although evidence for these effects in broilers remains limited (Elieh Ali Komi et al., 2018). Dietary chitin concentration would be expected to increase with BSFL inclusion because the same BSFL ingredient was used across all the treatments. However, chitin was not measured in the BSFL meal or experimental diets, so its actual concentration in each diet is unknown. Therefore, the observed quadratic response cannot be directly attributed to chitin. Future studies should measure chitin in the BSFL ingredient and complete diets and examine its relationship with nutrient digestibility, intestinal responses, and growth performance.

In the current study, intestinal morphology closely reflected growth performance. The peak in body weight gain at 5% coincided with improved villus structure and a higher villus height-to-crypt depth (V/C) ratio. The V/C ratio is considered a key indicator of intestinal health (Rysman et al., 2023). A higher ratio indicates mature enterocytes and efficient nutrient absorption, whereas a lower ratio reflects increased epithelial turnover and reduced absorptive efficiency (Dabbou et al., 2019; Vasilopoulos et al., 2024). The highest V/C ratio in the duodenum was observed at 5% BSFL inclusion in the current study. This finding is consistent with the results from Patel et al. (2025) who reported a quadratic increase in V/C ratio in both the duodenum and jejunum with increasing BSFL inclusion, with intermediate inclusion levels supporting the most favorable intestinal morphology and growth. As inclusion approached 12.5%, deeper crypts and lower V/C ratios were observed in the current study, indicating crypt hyperplasia and increased cell turnover (Ducatelle et al., 2018; Fletcher and John, 2018). At this higher full‑fat BSFL inclusion level, birds also receive substantially more chitin and lauric‑acid–rich fat, and both chitin and excessive insect fat have been associated with reduced nutrient digestibility and altered intestinal function in poultry (Salahuddin et al., 2024; Gautam et al., 2025). Similar findings were reported by Dabbou et al. (2019), where 15% defatted BSFL reduced the V/C ratio. Short villi reduce surface area for nutrient absorption, while deeper crypts increase maintenance energy demand (Ducatelle et al., 2018; Wang et al., 2025); thus, this diverts nutrients toward gut renewal rather than muscle growth (Dabbou et al., 2019; Vasilopoulos et al., 2024; Dillard et al., 2025; Wang et al., 2025). This structural shift might explain the reduced weight gain at higher inclusion levels.

Serum T‑AOC and SOD activity did not differ significantly among the dietary treatments, indicating that replacing SBM with BSFL up to 12.5% did not alter systemic antioxidant status in broilers. Similar findings were observed in some studies where SOD or oxidative status was similar across BSFL supplemented groups (Chen et al., 2025; Reyan Mohassesi et al., 2025). However, several studies have reported that increasing BSFL inclusion can increase antioxidative capacity in quail or broilers, indicating a more pronounced upregulation of antioxidant defenses (Dabbou et al., 2019; Liu et al., 2025). The differences might be due to the differences in inclusion thresholds, basal diet composition, and species-specific physiology. In the present study, the maximum inclusion of 12.5% may have remained below the threshold required to trigger a measurable upregulation of antioxidant enzymes.

Tight junction gene expression were influenced by BSFL inclusion levels in the current study. ZO-1 (TJP1), ZO-2 (TJP2), JAM-2, and OCLN are essential for maintaining epithelial barrier integrity (Hughes, 2005; Yegani and Korver, 2008; Shen et al., 2011). In the present study, expression remained stable up to 5% inclusion but declined significantly at 10–12.5%. Stability of the gene expression at the moderate inclusion (up to 5%) suggests preserved barrier function, whereas reduced expression at higher levels indicates potential barrier compromise (Anas et al., 2026). Chitin is a potential component in BSFL meal contributing to this response. High chitin intake may negatively affect gut morphology and barrier integrity (Murawska et al., 2021; Lee et al., 2022). In contrast, BSFL oil has been reported to upregulate tight junction genes such as ZO-1 and JAM-2, which might be due to its high lauric acid content and anti-inflammatory properties (Anas et al., 2026).

Although no significant treatment effects were observed for inflammatory cytokines, IL-6 and IFN-γ tended to decrease with increasing BSFL inclusion. Limited studies have examined BSFL effects on cytokine expression. However, BSFL oil has been shown to reduce IL-6, IL-18, and TNF-α and increase anti-inflammatory cytokines such as IL-10 (Anas et al., 2026). Lauric acid, a major fatty acid in BSFL, suppresses NF-κB signaling and reduces pro-inflammatory cytokine expression (Richter et al., 2023). Therefore, the downward trend in IL-6 and IFN-γ may reflect beneficial immunomodulatory effects of BSFL. Nevertheless, this was insufficient to prevent tight junction downregulation at higher inclusion levels in the current study. Future studies should use intracellular cytokine staining coupled with flow cytometry to better evaluate the immunomodulatory effects of BSFL.

Among the nutrient transporters, LAT1 (SLC7A5) was the only gene significantly affected in the current study. Expression was stable at 0–5% BSFL supplementation but declined sharply at 10–12.5%. LAT1 is a Na⁺-independent transporter for large neutral amino acids and is linked to intracellular metabolic signaling (Scalise et al., 2018). Intestinal nutrient transporters exhibit adaptive regulation in response to dietary substrate availability (Diamond and Karasov, 1987). Reduced LAT1 expression at higher inclusion levels may reflect altered amino acid availability due to increased chitin intake, which can depress protein digestibility (Lee et al., 2022). Importantly, the expression of B⁰AT1, the principal apical Na⁺‑dependent neutral amino acid transporter (Böhmer et al., 2005), and SGLT1, pivotal for intestinal glucose absorption (Gorboulev et al., 2012) remained unchanged. This indicates that bulk neutral amino acid and glucose absorption capacity was maintained. Thus, BSFL selectively influenced LAT1-mediated transport at higher inclusion levels rather than causing generalized impairment of nutrient uptake.

Overall, these findings demonstrate that moderate inclusion levels of full-fat BSFL meal (around 5%) optimize growth performance, intestinal morphology, barrier gene expression, and nutrient transport function. In contrast, higher inclusion levels (10–12.5%) compromise structural integrity and functional efficiency of the intestine, which may be due to increased chitin contents in the diets. Therefore, identifying and maintaining an optimal inclusion threshold is essential when incorporating full-fat BSFL into broiler diets.

Replacing soybean meal with full-fat BSFL meal up to 12.5% did not affect whole-body BMD, BMC, or BMR% at 28 d, indicating that overall bone mineral deposition was maintained across all diets in the present study. Although no previous study has evaluated detailed bone mineral traits specifically with BSFL meal, similar preservation of bone characteristics has been reported with other insect meals; broilers fed defatted winged termite meal up to 10% showed no compromise in femur morphology or strength compared with soybean-based diets (Kolobe et al., 2026).

Despite the stable bone mineral outcomes, body composition shifted with increasing BSFL inclusion in the current study. Body fat percentage increased linearly, whereas lean tissue percentage decreased, even though diets were isonitrogenous and isocaloric. Similar carcass-level responses have been reported in broilers fed full-fat BSFL, where higher inclusion increased fat content and enriched breast meat with lauric acid and total saturated fatty acids (Daszkiewicz et al., 2022). Similarly, Ahmed et al. (2026) observed increased fat deposition at 12% full-fat BSFL inclusion compared with lower levels. The consistency of this pattern across studies suggests that increasing full-fat BSFL inclusion shifts carcass composition toward higher adiposity and reduced lean mass, independent of apparent dietary energy and protein equivalence. The increased body fat and reduced lean percentage observed in the current study might reflect both the lipid composition of full-fat BSFL meal and the digestibility constraints of its structural components. Full-fat BSFL meal provides an energy-dense fat fraction rich in medium-chain saturated fatty acids, particularly lauric acid (C12:0) (Ewald et al., 2020). Unlike long-chain fatty acids, MCFAs are absorbed directly into the portal circulation without requiring micellar solubilization, enabling rapid delivery and deposition into adipose and intramuscular fat stores (Khatibjoo et al., 2018; Wang et al., 2023; Jadallah and Hammad, 2024). Consistent with this, increasing full-fat BSFL inclusion has been shown to progressively elevate lauric acid and total saturated fatty acid levels in breast intramuscular fat, confirming efficient tissue deposition of these lipids (Kim et al., 2020; Daszkiewicz et al., 2022; Hartinger et al., 2022). At the same time, chitin, an indigestible structural polysaccharide, can reduce ileal digestibility of protein and energy at higher inclusion levels (Razdan and Pettersson, 1994; Rotich et al., 2026). Reduced amino acid availability from impaired protein digestion increases the metabolic cost of gut maintenance and immune function, thereby limiting the substrate available for skeletal muscle accretion. Meanwhile, the readily absorbed lauric acid-rich fat fraction continues to supply energy that is preferentially partitioned into adipose tissue (de Souza Vilela et al., 2021a). Collectively, these interactions show the reason for increase in body fat and decrease in lean tissue at higher full-fat BSFL inclusion levels in the present study. However, because ileal digestibility, tissue lipid partitioning, and lipogenic enzyme activity were not assessed, this interpretation remains speculative and requires further experimental confirmation in the future (Elahi et al., 2022).

At the cortical level, femoral microstructure measured by microCT was largely unaffected. Cortical tissue volume, bone volume, surface area, and pore characteristics did not differ among the treatments, with only slight quadratic variation in cortical bone volume fraction and closed-pore number at 28 d. This stable cortical response aligns with (Kolobe et al., 2026), who reported no adverse effects of termite meal up to 10% on femur traits, although tibia density declined at higher inclusion during the grower phase. The lack of major cortical changes in the present study suggests that balanced dietary calcium and phosphorus, together with comparable growth, supported normal cortical development despite partial soybean replacement.

At the trabecular level, total tissue and bone volume were not affected, but bone volume fraction, trabecular number, and structure model index showed quadratic responses. Although direct femoral micro CT comparisons for BSFL are limited, fermented mealworm larvae meal has improved tibia morphology under certain conditions (Sarıca et al., 2025). Improved trabecular connectivity at moderate BSFL levels may reflect better mineral utilization and gut function, whereas higher inclusion likely increases chitin and less digestible material, reducing nutrient availability for bone formation and producing the quadratic response (Lee et al., 2022). 

Overall, bone mineral density in cortical, trabecular, and total femoral regions remained unchanged, confirming that mineral deposition was preserved across the treatments. However, the micro-CT findings were mixed and did not provide consistent evidence that 5% BSFL improved bone microarchitecture or bone quality. Future studies should extend through a complete commercial grow-out period and include bone mechanical testing to determine the functional significance of these microstructural responses.

Conclusion

In conclusion, full-fat BSFL meal can effectively replace certain portions of soybean meal in broiler diets, but the inclusion level is a critical determinant of outcomes. Inclusion of BSFL meal at 5% produced the most favorable overall response pattern across multiple parameters, including growth performance, intestinal morphology, and gut barrier gene expression. However, the micro-CT findings did not provide consistent evidence that 5% BSFL improved bone microarchitecture or bone quality. When inclusion level was higher than 10%, key tight junction proteins and amino acid transporters declined, suggesting that the gut barrier became less functional at these higher levels. Bone mineral density was not affected at any inclusion level (up to 12.5% BSFL), indicating that skeletal development was maintained despite progressive replacement of soybean meal in the diet. These findings identify 5% BSFL as the most favorable level among those tested but do not establish it as a statistically determined optimum. As the present study evaluated only full-fat BSFL through day 28, future studies should extend the feeding period to 42–45 days in conventional broilers, or longer in slow-growing and extended-production systems, to assess longer-term growth, intestinal, and skeletal responses. Future research should also evaluate changes in the gut microbiome and metabolite profiles to better understand the mechanisms through which BSFL influences broiler health and performance.

Authorship contribution statement

Ishwari Gyawali: Designed and conducted the experiment, collected samples and data, performed the statistical analysis, interpreted the results, and wrote and revised the manuscript. Deependra Paneru: Assisted with the animal experiment, feed mixing, performance measurement, data generation, and sample collection and reviewed the manuscript. Seshidhar Gudidoddi: Assisted with the animal experiment, feed manufacturing, data generation and sample collection and reviewed the manuscript. Hamid Reza Rafieian Naeini: Assisted with the animal experiment, feed mixing, data generation, and sample collection and reviewed the manuscript. Hemanth Reddy Katha: Assisted with the animal experiment, feed mixing, data generation, and sample collection and reviewed the manuscript. Woo Kyun Kim: Conceptualize the study, designed and supervised the experiment, manage overall study, obtained funding, reviewed and edited the manuscript.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request.

Disclosures

There is no conflict of interest.