Occurrence of brachylaimid trematodes, alive and shell-trapped, in sympatric species of terrestrial gastropods in France

Abstract

Following the detection of Brachylaima spp., which are potentially pathogenic for domestic animals and humans, in Cornu aspersum and Cepaea nemoralis at a rural site in France, we investigated trematode distribution among sympatric gastropod species to assess their role in the parasite life cycle. Eight species were investigated (Cepaea nemoralis, Cernuella neglecta, Clausilia bidentata, Cochlicella acuta, Cornu aspersum, Lauria cylindracea, Pomatias elegans, and Theba pisana). Four species were parasitised by trematodes: C. aspersum (prevalence 56%), C. nemoralis (10%), and T. pisana (2%) as second intermediate hosts of Brachylaima spp., and C. neglecta (6%) as new first intermediate host of Pseudoleucochloridium sp. Moreover, we observed for the first time shell-encapsulation of trematodes in a non-helicid species (C. neglecta) and nematodes in a non-stylommatophoran species (P. elegans), suggesting more general anti-parasite defence than previously thought among land snails. Our current and previous results, including molecular data (28S rDNA, COI mtDNA), suggest the occurrence of four Brachylaima species at the site: Brachylaima mesostoma and three unidentified species. Cornu aspersum is the only identified first intermediate host for B. mesostoma and one of the unidentified trematode species also found at a metacercarial stage in C. aspersum and C. nemoralis. Another unidentified species recorded in C. aspersum and C. nemoralis, characterised by small orange metacercariae, may be a new species. The sole metacercaria found in T. pisana may also belong to an undescribed species.

Introduction

Brachylaimiasis, an intestinal parasitosis induced by haematophagous digenean trematodes of the genus Brachylaima Dujardin, 1843, is a potentially fatal infection in domestic vertebrates, with, for example, reports of mortality in pigs and dogs with high parasite burdens [3, 19, 27, 38]. Until now, human brachylaimiasis, causing symptoms such as diarrhoea, abdominal pain, and anorexia, has been described exclusively in Australia and was found to be caused by Brachylaima cribbi Butcher and Grove, 2001 [7–9, 13]. Infection occurs after the consumption of raw or undercooked land snails parasitised by metacercarial larvae, but also after the ingestion of live metacercariae deposited on vegetables and fruits via the snails’ slime and excreta and/or crushed infected snails [7, 8, 11, 13]. Diagnosis of brachylaimiasis is based on the detection of eggs in human faeces, but the search for Brachylaima eggs is not included in standard medical protocols of helminth detection [13, 42, 58], potentially resulting in misdiagnosis and underestimation of infected people worldwide.

Brachylaima cribbi is considered native to Europe because its most commonly recorded hosts are European species introduced to Australia: land snails including Cochlicella sp., Theba pisana, and Cornu aspersum (first and second intermediate hosts), European blackbird Turdus merula and starling Sturnus vulgaris (definitive hosts) [9, 10, 21]. Its host range is, however, more diverse and also includes other birds, mammals, and even lizards, both native and introduced [11, 12, 21]. Beyond Australia and B. cribbi specifically, commercial trade of edible gastropods has been shown to be a potential vector for the intercontinental spread of other Brachylaima species (between Spain and both North and Southern Africa [31]). In Europe, at least 12 species of Brachylaima (including potentially cryptic species) have been recorded, with likely more to be discovered, infecting a wide range of terrestrial gastropods and vertebrates (Table 1). Despite the probable European origin of B. cribbi, its occurrence has not yet been demonstrated in Europe, possibly due to a lack of field investigations.

Table 1.

Intermediate (first and second Hi) and definitive (Hd) hosts of Brachylaima spp. recorded in Europe according to bibliographical data.

Brachylaima species	1st Hi	2nd Hi	Hd	References
Brachylaima arcuatus (Dujardin, 1845)	Unknown	Ambigolimax valentianus, Deroceras invadens, D. reticulatum, Monacha cantiana, Tandonia sowerbyi	Birds (Corvidae, Sylviidae, Turdidae)	[2, 25, 41]
Brachylaima aspersae Segade et al., 2011	Cornu aspersum	Cornu aspersum	Rodents (e.g. Mus sp.)	[35]
Brachylaima erinaceus Blanchard, 1847	Agriolimax reticulatus, Helicella ericetorum, H. variabilis	Agriolimax reticulatus, Helicella ericetorum, H. variabilis	Mammals (badger, cat, dog, hedgehog)	[25, 27]
Brachylaima fulvus Dujardin, 1843	Unknown	Goniodiscus rotundatus, Zonitoides excavatus, Z. nitidus	Sorex sp., Neomys fodiens	[25, 43, 46, 60]
Brachylaima fuscata (Rudolphi, 1819)	Agriolimax agrestis, Cochlicella ventrosa, Cornu aspersum, Helicella profuga, Hygromia cinctella, Theba pisana	Agriolimax agrestis, Ambigolimax valentianus, Cepaea hortensis, Cochlicella ventrosa, Cornu aspersum, Deroceras invadens, Helicella profuga, Hygromia cinctella, Oxychilus cellarius, Theba pisana, Trochulus striolatus	Birds (Accipitridae, Columbidae, Corvidae, Laridae, Passeridae, Phasianidae, Strigidae, Sylviidae, Turdidae)	[2, 24, 36, 41, 72]
Brachylaima llobregatensis González-Moreno and Gracenea, 2006	Cornu aspersum	Cornu aspersum, Otala punctata, Theba pisana	Rodents (Crocidura russula, Mus sp.)	[35]
Brachylaima mascomai Gracenea and González-Moreno, 2002	Pseudotachea splendida	Cornu aspersum, Otala punctata, Pseudotachea splendida, Theba pisana	Rodents (Apodemus sylvaticus, Mus sp., Rattus sp.)	[36]
Brachylaima mesostoma (Rudolphi, 1803)	Cornu aspersum, Cepaea hortensis, C. nemoralis, Xeropicta krynickii	Brephulopsis bidens, B. cylindrica, Cepaea hortensis, C. nemoralis, Cornu aspersum, Eobania vermiculata, Helicopsis filimargo, H. retowskii, Thoanteus gibber, Xeropicta krynickii	Birds (Corvidae, Fringillidae, Phasianidae including Gallus domesticus, Sylviidae, Turdidae)	[2, 32, 41, 66, 73]
Brachylaima nicolli (Wintenberg, 1925)	Unknown	Agriolimax agrestis, Helicella scitula, Oxyphilus cellarius	Birds (Passeridae)	[18]
Brachylaima recurva (Dujardin, 1845)	Cepaea hortensis, Cornu aspersum	Cepaea hortensis, C. nemoralis, Cornu aspersum, Fruticicola fruticum, Helix pomatia, Pomatias elegans	Mammals (Apodemus sylvaticus, Eliomys quercinus, Vulpes vulpes)	[24, 25, 53, 63, 68]
Brachylaima ruminae Mas-Coma and Montoliu, 1986	Rumina decollata	Ferrussacia follicula, Rumina decollata	Rodents (Eliomys sp., Mus sp., Rattus sp.)	[50]
Brachylaima suis Balozet, 1936	Helicidae (Cornu sp., Helix sp., Theba sp.)	Helicidae (Cornu sp., Helix sp., Theba sp.)	Mammals (domestic and wild pigs, rodents)	[3, 19, 27]

Molecular sequences of Brachylaima spp. are rarely available and taxonomic confusion reigns among the family of Brachylaimidae [70].

In recent years, there has been growing global interest in protein sources other than vertebrate meat, and land snails are emerging as an attractive alternative due to their high content of high-quality protein, low fat and cholesterol content, and their supply of essential fatty acids, amino acids, and minerals ([39, 40, 67] for reviews). Commercial snail trade is also on the rise due to the increasing use of snail slime in various areas such as medicine, cosmetics, and biotechnologies ([40, 47, 62] for reviews). France is one of the leading countries worldwide for consumption of land gastropods (C. aspersum, Helix pomatia, and Helix lucorum), with about 17,000 tons ingested per year in alive snails-equivalent, either gathered in the wild or sourced from heliciculture farms [26]. Most snails are imported from 28 foreign countries (mainly Romania, Belgium, and Türkiye) as farms in France produce only about 1,000 tons of snails per year [26].

Despite the diversity of Brachylaima species in Europe and the interactions between their potential snail hosts and humans or domestic animals, we know little about their host spectra and the potential impacts of metacercariae ingestion on vertebrate definitive hosts, or the health consequences in humans. In this context, better characterisation of the diversity of Brachylaima species and the gastropod species that may serve as a reservoir is needed. We previously found Brachylaima spp. infections in studies focused on the common helicid snails C. aspersum and Cepaea nemoralis, in and around a rural village in France [22, 32]. Here, we revisited the same area to investigate the distribution of trematode larvae in the broader shelled gastropod community in order to assess how sympatric land snail species are involved in the life cycle and transmission of Brachylaima.

Materials and methods

Ethics

This study was carried out in compliance with all relevant international and national laws; none of the species considered is formally protected, no ethics committee recommendation nor administrative authorization was needed to sample or study any of the snail or parasite species mentioned here.

Study site, sampling, and measurements

We sampled wild sympatric populations of land snails on September 10–11, 2022, in a private garden in a rural area (northwestern France, Arçais, approx. 46°17′50″ N, 0°41′30″W) where we previously (April 2018) recorded the occurrence of Brachylaima spp. sporocysts and metacercariae in C. aspersum [32]. Brachylaima metacercariae were also found in C. nemoralis from Arçais in May 2019 [22].

We sampled by hand a total of 404 adults belonging to eight gastropod species (C. nemoralis, Clausilia bidentata, Cernuella neglecta, Cochlicella acuta, C. aspersum, Lauria cylindracea, T. pisana, and Pomatias elegans; Table 2). The height and width of the snail shell were measured with a caliper (precision: 0.1 mm). Depending on the species, we identified adult gastropods based on the size of their shell and/or the presence of a differentiated peristome (reflected “lip” around the shell opening or thickened inner rim indicating the cessation of shell growth [59]).

Table 2.

Taxonomy, number (N) and shell size (height and width ± CI, in mm) of adult terrestrial gastropods belonging to eight species sampled in a private garden (Arçais, France) in September 2022 with information on their main diet, microhabitat, vertebrate predators, and lifespan.

	N	Height ± CI	Width ± CI	Diet	Microhabitat*	Vertebrate predators**	Lifespan
				[29]	[29, 71]	[1, 45]	[29]
SubClass-Order: HETEROBRANCHIA – STYLOMMATOPHORA
SuperFam.: Helicoidea
Fam.: Helicidae
Sub.Fam.: Helicinae
Cepaea nemoralis	50	19.02 ± 0.39	24.07 ± 0.34	Living and dead higher plants	Among/under vegetation	Birds (Muscicapidae, Phasianidae, Turdidae); mammals (Erinaceidae, Soricidae, Suidae); reptiles (Anguidae)	2–5 yrs
Cornu aspersum	50	29.39 ± 0.47	29.58 ± 0.58	Living and dead higher plants, saprophagous	Among/under vegetation and surface debris	Birds (Turdidae, Anatidae); mammals (Erinaceidae, Muridae, Soricidae, Talpidae); reptiles (Anguidae)	2 – > 5 yrs
Theba pisana	50	14.26 ± 0.36	18.83 ± 0.30	Living and dead higher plants	Among/under vegetation, climbs on vertical surfaces in hot weather	Birds (Turdidae, Anatidae, Corvidae, Falconidae); mammals (Erinaceidae, Muridae, Soricidae)	1–2 yrs
Fam: Geomitridae
SubFam.: Geomitrinae
Cochlicella acuta	51	15.62 ± 0.42	6.37 ± 2.12	Dead higher plants	Herb layer, among/under vegetation, climbs on vertical surfaces in hot weather	Birds (Corvidae, Falconidae)	1–2 yrs
SubFam.: Helicellinae
Cernuella neglecta	51	9.52 ± 0.22	14.45 ± 0.26	Dead higher plants	Shrubs/bushes/saplings and among/under vegetation on ground, climbs on vertical surfaces in hot weather	Birds (Turdidae); mammals (Muridae)	1–2 yrs
SuperFam.: Clausilioidea
Fam.: Clausiliidae
Sub.Fam.: Clausiliinae
Clausilia bidentata	50	10.50 ± 0.28	2.62 ± 0.12	Living algae, lichens, dead higher plants	In/under timber, among/under surface debris	Birds (Turdidae)	2–5 yrs
SuperFam.: Pupilloidea
Fam: Lauriidae
Lauria cylindracea	50	3.72 ± 0.10	–	Dead higher plants, forest litter	In/under timber, among/under surface debris, under stones	–	1–2 yrs
SubClass-Order: CAENOGASTROPODA – LITTORINOMORPHA
SuperFam.: Littorinoidea
Fam.: Pomatiidae
Pomatias elegans	52	13.69 ± 0.21	9.52 ± 0.19	Dead higher plants, forest litter	Among/under surface debris, dig into the substrate to hibernate and estivate	Mammals (Erinaceidae)	2 – > 5 yrs

*All species are epigean, present on plants and on ground surface.

**Only predators described in Western Europe are considered.

The collected snails were immediately frozen and stored at −20 °C until they were examined. After thawing, we dissected each snail using a binocular stereoscopic microscope with backlighting. After removing the body from the shell, we searched for metazoan parasites in the shell (encysted specimens, see Rae [61] and Gérard et al. [33] for more information) and in various locations (i.e., space between shell and soft body, lung, heart, kidney, body cavity, genital and digestive systems), as in previous studies [22, 32, 33]. We found larval trematodes, nematodes, and parasitic mites (Acari). When present, trematodes (sporocysts, cercariae, and/or metacercariae) were observed under light glass coverslip pressure using bright-field and phase-contrast microscopy, and were counted. We morphologically identified metacercariae of the genus Brachylaima according to Gracenea and González-Moreno [36] and Segade et al. [65]. We performed measurements of metacercariae preserved in 95% ethanol, following Mas-Coma et al. [49], and we also preserved sporocysts and metacercariae in 95% ethanol at −20 °C for DNA sequence analysis (see below).

We described parasitism by prevalence (P%) (number of hosts infected with a particular parasite species/number of examined hosts) and mean intensity (I) (total number of parasites of a particular species found in a sample/number of hosts infected with that parasite) [6].

We report mean values followed by the 95% confidence interval (CI). For prevalence, we calculated CI using the score method [57].

DNA sequencing and identification of trematodes

Three sporocyst samples from C. neglecta and 13 individual metacercariae (seven from C. nemoralis, five from C. aspersum, one from T. pisana) of trematodes, each of them originating from a different snail [except for two C. nemoralis in which two morphologically distinct forms of metacercaria (orange or not) were found], were analysed by molecular identification tools. DNA of each individual parasite (approximately 1 mm³ piece of sporocyst or whole body of a metacercaria) was extracted following Nakao et al. [55]. Samples were lysed in 25 μL of 0.02 N NaOH at 99 °C for 30 min. Unfortunately, insufficient DNA was obtained for the sole metacercaria found in T. pisana, requiring us to remove this sample from further analyses. We amplified fragments for the nuclear 28S ribosomal DNA (rDNA) and mitochondrial COI DNA (mtDNA) genes, respectively as presented in Gérard et al. [32]. The 28S fragment was amplified using the forward primer dig12 (5′–AAGCATATCACTAAGCGG–3′) and the reverse primer 1500R (5′–GCTATCCTGAGGGAAACTTCG–3′) [69]. The COI region was amplified using the forward primer JB3 (5′–TTTTTTGGGCATCCTGAGGTTTAT–3′) and the reverse primer CO1-R trema (5′–CAACAAATCAT GATGCAAAAGG–3′) [52]. Amplification of template DNA was carried out with MyTaq Mix (2X) (Bioline, France), including 5 μM of each primer and between 2 and 5 μL of DNA depending on its concentration. The reaction mixture was made up to a total volume of 25 μL with ultrapure water. The PCR conditions were 98 °C for 10 s, 50 °C for 20 s, and 68 °C for 90 s (40 cycles). We checked amplification products using a 2% agarose gel stained with ethidium bromide. We obtained double-strand sequences with an automated sequencer (Plateforme de séquençage et génotypage OUEST-génopole). Unless we performed several dilutions of DNA extracts to discard contaminants appearing to be abundant in our samples, we obtained overall poor quality sequences, especially for rDNA 28S fragments. We had to shorten them or to discard some from further analysis. Editing and correction of sequences were performed using BioEdit Sequence Alignment Editor software, version 7.7.1. Coding sequences (mtDNA COI) were determined with the on-line tool ORF Finder (NCBI). In the end, we obtained 12 28S sequences and 5 COI sequences useable for parasite identification. The BLAST Analysis Tool from the NCBI was used to examine the similarity between these sequences and the publicly available references.

Results

1) Trematode infections

Among the 404 adult snails collected, 37 were parasitised by larval trematodes (prevalence of 9.2% [CI 6.7–12.4%]), all belonging to the family of Brachylaimidae. These parasites were recorded in four of the eight terrestrial gastropod species, in decreasing order of prevalence: C. aspersum, C. nemoralis, C. neglecta, and T. pisana (Table 3).

Table 3.

Prevalence (P% [CI]) and mean intensity (I ± CI) of larval Brachylaimidae (Spo = sporocysts, Meta = metacercariae) in terrestrial gastropods (all adults) from Arçais in September 2022. Two C. nemoralis individuals had mixed infections with both Bra1 and Bra2 metacercariae in their kidney.

	Pseudoleucochloridium sp.		Brachylaima sp.1 (Bra1)**		Brachylaima sp.2 (Bra2)
Snail species	P% Spo	I Spo (range)	P% Meta	Snail species	P% Spo	I Spo (range)
Cepaea nemoralis	0	0	8.0 [3.2–18.8]	5.00 ± 1.60 (4–6)	6.0 [2.1–16.2]	7.00 ± 11.02 (1–13)
Cornu aspersum	0	0	54.0 [40.4–67.0]	23.41 ± 11.21 (1–117)	2.0 [0.4–10.5]	8
Theba pisana	0	0	2.0 [0.4–10.5]	1	0	0
Cochlicella acuta	0	0	0	0	0	0
Cernuella neglecta	5.9 [2.0–15.9]*	68.33 ± 100.76 (5–100)	0	0	0	0
Clausilia bidentata	0	0	0	0	0	0
Lauria cylindracea	0	0	0	0	0	0
Pomatias elegans	0	0	0	0	0	0

*One unparasitised adult of C. neglecta had two brachylaimid metacercariae encysted into the shell (P% = 2.0 [0.4–10.3]).

**Brachylaima sp.1 metacercariae of C. aspersum and C. nemoralis corresponded to the unidentified Brachylaima sp. in C. aspersum [32].

2) Morphological and genetic identification of trematode larvae

a – Metacercariae of Brachylaima spp. in C. aspersum, C. nemoralis, and T. pisana

The total prevalence of Brachylaima spp. was 56.0% (CI 42.3–68.8%) for C. aspersum, 10.0% (4.3–21.4%) for C. nemoralis, and 2.0% (0.4–10.5%) for T. pisana (a single infected individual), with mean intensities of 22.86 ± 10.84 (range: 1–117 metacercariae), 8.20 ± 5.97 (range: 4–17), and 1 metacercaria, respectively.

Morphological characteristics of metacercariae allowed discrimination of two morphospecies of Brachylaima, named Brachylaima sp.1 (Bra1) and Brachylaima sp.2 (Bra2) below.

Bra1 was the most frequently recorded in our study and found in the kidney of the three helicid species, i.e., 28 C. aspersum, four C. nemoralis, and one T. pisana (Table 3). Metacercariae were morphologically similar across host species, with caeca containing numerous urate concretions from ingested renal epithelium, but the smaller size of the single metacercaria found in T. pisana (total length = 1,330 μm; Fig. 1A) compared to those of C. aspersum and C. nemoralis (2,127 ± 125 μm, range of 1,739–2,430 μm) may be indicative of another Brachylaima species (named Bra1-Tp).

Figure 1.

A, B: Metacercariae of Brachylaima infecting the helicid kidney, with A: the only metacercaria of Bra1-Tp found in one Theba pisana (total length = 1,330 μm, total width = 280 μm; note that caeca contain numerous urate concretions from ingested renal epithelium, also observed for most Bra1 metacercariae in C. aspersum and C. nemoralis), and B: Orange metacercaria Bra2 found in Cepaea nemoralis (total length = 975 μm, total width = 543 μm); C: Branched cercariogenous sporocyst of Pseudoleucochloridium sp. in the digestive gland of Cernuella virgata (general view of the parasitised digestive gland and inserted sporocyst detail); D: Brachylaimidae metacercaria encapsulated in the shell of one uninfected Cernuella virgata; E: Nematode encapsulated in the shell of Pomatias elegans; F: Encysted dipteran larva in the shell of Theba pisana.

Following Moszczynska et al. [54] and Blasco-Costa et al. [5], we considered genetic species identification mainly based on COI comparisons for which query-cover (proportion of alignment between both sequences) was over 90%, E-value (expected number of matches of similar quality that would occur by chance) close to 0 and an Identity (percentage of nucleotides that are identical in the aligned region) of at least 97%. On these criteria, we were able to match the successfully sequenced Bra1 metacercariae (in four C. nemoralis and two C. aspersum individuals) to the same unnamed Brachylaima species we previously characterised from two samples collected in April 2018 (one sporocyst from the same site, and one metacercaria from another [32]; Table 4). Unfortunately, DNA isolation of the single metacercaria found in T. pisana (Bra1-Tp), possibly belonging to a different species, was unsuccessful.

Table 4.

Identification of parasite species using BLAST (NCBI), based on COI mtDNA sequences obtained from metacercariae corresponding to the Bra1 morphotype and collected from the land snails Cepaea nemoralis (four individuals) and Cornu aspersum (two individuals) in September 2022 in Arçais.

Analysed sequence			BLAST results*			GenBank sample
Snail species	Parasite larval stage	Sample ID	query cover (%)	E-value	Identity (%)	Accession number	Parasite species
Cepaea nemoralis
	metacercaria	Cn23	100%	0.0	99.77	MN848408.1**	Brachylaima sp.
			100%	0.0	97.42	MN849923.1**	Brachylaima sp.
	metacercaria	Cn30	100%	0.0	98.38	MN848408.1	Brachylaima sp.
	metacercaria	Cn42	99%	0.0	99.11	MN848408.1	Brachylaima sp.
	metacercaria	Cn45	100%	0.0	99.78	MN848408.1	Brachylaima sp.
			100%	0.0	97.60	MN849923.1	Brachylaima sp.
Cornu aspersum
	metacercaria	Ca5	98%	0.0	99.62	MN848408.1	Brachylaima sp.
	metacercaria	Ca47	100%	5.0−103	100.00	MN849923.1	Brachylaima sp.
			100%	5.0−103	100.00	MN848408.1	Brachylaima sp.

*Only matches for which query-cover >90%, E-value <10⁻⁶ and Identity >97% are considered.

**Sequences from our previous study: please see [32].

Bra2 was rare and only present in three adults of C. nemoralis and one of C. aspersum (Table 3). Among them, mixed infections with Bra1 metacercariae were detected in two C. nemoralis individuals. Bra2 metacercariae were orange and smaller (total length = 815 ± 207 μm, range of 520–1,050 μm; Fig. 1B) than Bra1. COI comparisons with our last sequences of Brachylaima sp. suggest that it belongs to the genus Brachylaima, but probably to a different species (MN848408.1: query cover 70%, E-value 4.0⁻¹⁰⁸, Identity 94.27%; MN849923.1: query cover 66%, E-value 2.0⁻¹⁰⁶, Identity 95.55%).

b – Sporocysts of Pseudoleucochloridium sp. in C. neglecta

Three snails among the 51 adults of C. neglecta were found to be infected with branched cercariogenous sporocysts (Fig. 1C; Table 5). One infected snail had only a few sporocysts in its digestive and genital glands, while the digestive gland of the other two snails was completely invaded by sporocysts. Sporocysts found in the three C. neglecta individuals could not be identified to the species level. However, both genetic markers (COI and 28S) matched with the same samples originating from Pseudoleucochloridium ainohelicis Nakao, Sasaki, Waki & Asakawa, 2019, a Brachylaimidae found in Japan and using the land snail Ainohelix editha as first intermediate host [56] (Table 5). Although the percent of Identity was quite low for the COI sequences (from 83.55 to 85.11%), comparisons with 28S sequences yielded high and similar results for the three samples (query cover 100%, E-value 0.0, Identity between 98.22% and 98.66%), suggesting that they belong to the genus Pseudoleucochloridium Pojmańska, 1959.

Table 5.

Identification of parasite genus using BLAST (NCBI), based on COI mtDNA and 28S rDNA sequences obtained from sporocysts collected from the land snail Cernuella neglecta (three individuals) in September 2022 in Arçais.

Analysed sequence			BLAST results*			GenBank sample
Parasite larval stage	Sample ID	Genetic sequence	Query cover (%)	E-value	Identity (%)	Accession number	Parasite species
Sporocyst	Ce10	COI	82%	6.0−157	83.55	LC455745.1**	Pseudoleucochloridium ainohelicis
		28S	100%	0.0	98.66	LC455740.1**	Pseudoleucochloridium ainohelicis
Sporocyst	Ce21	COI	96%	0.0	84.78	LC455745.1	Pseudoleucochloridium ainohelicis
		28S	100%	0.0	98.66	LC455740.1	Pseudoleucochloridium ainohelicis
Sporocyst	Ce22	COI	75%	2.0−152	85.11	LC455745.1	Pseudoleucochloridium ainohelicis
		28S	100%	0.0	98.22	LC455740.1	Pseudoleucochloridium ainohelicis

*First occurrence from BLAST.

**Sequences from [56].

Interestingly, one uninfected adult of C. neglecta displayed two encapsulated Brachylaimidae metacercariae in its shell, with lengths of 1,388 μm and 1,420 μm, respectively (Fig. 1D).

3) Occurrence of other metazoan parasites: nematodes and mites (including dead shell-encapsulated)

We recorded nematodes in the lung of five helicid individuals: C. aspersum (three), C. nemoralis (one), and T. pisana (one) (Table 6). The three C. aspersum individuals infected by nematodes also harboured Brachylaima metacercariae in their kidney. We also found one mite (Riccardoella sp.) in the lung of one C. nemoralis specimen.

Table 6.

Prevalence (P% [CI]) and mean intensity (I ± CI) of nematodes (“alive” in the lung and “dead” encapsulated in the shell) recorded in land snail species from a private garden (Arçais, France), based on this study, Dahirel et al. [22] and Gérard et al. [32].

Snail species	Nematodes in the lung		Shell-encapsulated Nematodes		References
	P% [CI]	I ± CI (range)	P% [CI]	I ± CI (range)
Cepaea nemoralis
May 2019	15.6 [CI 11.0–21.6]	1.86 ± 0.80 (1–9)	76.7 [CI 70.0–82.3]	11.67 ± 2.55 (1–88)	[22]
Sep 2022	2.0 [CI 0.4–10.5]	1	62.0 [CI 48.2–74.1]	2.87 ± 0.57 (1–14)	This study
Cornu aspersum
Apr 2018	34.8 [CI 29.4–40.6]	3.16 ± 0.71 (1–18)	33.0 [CI 27.7–38.7]	2.66 ± 0.52 (1–16)	[32]
Sep 2022	6.0 [CI 2.1–16.2]	2.33 ± 2.12 (1–3)	62.0 [CI 48.2–74.1]	7.39 ± 2.89 (1–41)	This study
Theba pisana
Sep 2022	2.0 [CI 0.4–10.5]	1	2.0 [CI 0.4–10.5]	1	This study
Pomatias elegans*
Sep 2022	–	–	7.7 [CI 3.0–18.2]	3.75 ± 2.86 (1–6)	This study

*Red-brown nematodes encapsulated in P. elegans.

Moreover, nematodes were frequently found encapsulated (dead) in the shell of the three helicid species, mainly in C. nemoralis (31 individuals) and C. aspersum (31), and were discovered for the first time in the shell of the prosobranch P. elegans (four snails) (Table 6, Fig. 1E). We observed two T. pisana specimens with a dipteran larva encysted in the shell (Fig. 1F).

Discussion

Apart from C. aspersum and C. nemoralis, sympatric terrestrial gastropod species in Arçais were rarely (C. neglecta and T. pisana) or not (C. bidentata, C. acuta, L. cylindracea, and P. elegans) infected by trematodes, nor by other live metazoan parasites such as nematodes and mites (Tables 3 and 6). Regarding trematodes, four out of eight snail species were found to be parasitised by two genera of Brachylaimidae: Pseudoleucochloridium (sporocysts, first intermediate host) in C. neglecta and Brachylaima (metacercariae, second intermediate hosts) in C. aspersum, C. nemoralis, and T. pisana, respectively. Moreover, our results suggest that shell-encapsulation may be a generalist defence response of land snails against natural enemies.

Pseudoleucochloridium sp. / C. neglecta

In Europe, recorded parasites of C. neglecta comprise nematodes such as Neostrongylus linearis (Marotel, 1913) Gebauer, 1932 [64], Phasmarhabditis elegans (Schneider, 1859) [4], and trematodes such as Dicrocoelium dendriticum (Rudolphi, 1819) [30, 48]. There are also records in Australia, where C. neglecta is an introduced invasive species, with documented B. cribbi infections (both sporocysts and metacercariae) [10–12]. The present study is to our knowledge the first record of Pseudoleucochloridium sporocysts parasitizing C. neglecta. As far as is known, only five species have been described from the genus Pseudoleucochloridium, all recorded in the adult stage from shrews in Eurasia [14, 51, 56]. Among them, only P. ainohelicis, a Japanese species using the land snail Ainohelix editha as first intermediate host, has been sequenced [56]. Our results suggest that the sporocysts we found in C. neglecta belong to a closely related but different species from P. ainohelicis. This is all the more probable given the Japanese distribution of P. ainohelicis and the strict specificity of Pseudoleucochloridium spp. for the first intermediate host [51, 56]. In Western Europe (French Pyrenees), Pseudoleucochloridium pericardicum Mas-Coma and Montoliu, 1996 has been recorded in Cepaea hortensis as the specific first intermediate host. The second intermediate host was mainly another land snail, Euomphalia strigella (Hygromiidae), but C. hortensis and C. aspersum may to a lesser extent also play this role; in all cases, metacercariae are specifically located in the pericardium [37, 44, 51]. Three other species of Pseudoleucochloridium have been recorded in Eastern Europe, i.e., Pseudoleucochloridium rotundus Bychowskaja-Pavlovskaja and Kulakova, 1970 in Ukraine, Pseudoleucochloridium soricis (synonym of P. pericardicum according to Mas-Coma & Montoliu [51]) in Poland, and Pseudoleucochloridium skrjabini Shaldibin, 1953 in Mordovia, Russian Federation, but the first intermediate host is unknown as well as most second intermediate hosts [14, 56]. In our study, none of the seven other snail species studied harboured Pseudoleucochloridium sporocysts or metacercariae, not even C. nemoralis. Given the low prevalences in C. neglecta and our relatively limited sample sizes per snail species, we cannot, however, exclude the possibility that these non-detections (especially in C. nemoralis) are a statistical artifact.

Interestingly, we also demonstrated for the first time the encapsulation of two Brachylaimidae metacercariae in the shell of one unparasitised C. neglecta adult. Based on their size (roughly 1,400 μm), these trapped metacercariae possibly belong to one of the Brachylaimidae species found in Arçais such as Brachylaima sp. recorded in T. pisana (Bra1-Tp metacercaria of 1,330 μm). Further research is needed to identify shell-encapsulated brachylaimid metacercariae and the species of Pseudoleucochloridium found in C. neglecta.

Brachylaima spp. / C. aspersum, C. nemoralis, T. pisana

Only three out of the eight sympatric land snail species studied in Arçais were found to be infected by metacercariae of the genus Brachylaima, and may have a role in the transmission of potentially harmful Brachylaima to vertebrate definitive hosts. Those were the three representatives of the Helicidae family (and the Helicinae subfamily) in our sample, namely C. aspersum, C. nemoralis, and T. pisana.

Combining our present and previous [32] results, four species of Brachylaima may occur in Arçais. First, B. mesostoma can use C. aspersum as first intermediate host, an association found by Gérard et al. [32], but not in the present study. Here, we demonstrate that a second species, the unidentified Brachylaima sp. recorded in C. aspersum at a sporocyst stage in Arçais by Gérard et al. [32], which we termed Bra1 here, also uses C. aspersum and C. nemoralis as second intermediate hosts. According to the morphological details, a possible third species of Brachylaima (Bra1-Tp), very similar to but smaller than Bra1, may occur in T. pisana. Finally, we recorded at a metacercarial stage a fourth Brachylaima species (which we termed Bra2), with low (≤ 6%) prevalences in C. nemoralis and C. aspersum. Our assessment that these metacercariae belong to yet another species was based on their distinctive orange colour and relatively small size (mean total length of 815 ± 207 μm, range: 520–1,050 μm).

Cornu aspersum appears to be the only natural first intermediate host in Arçais for B. mesostoma and the unidentified Brachylaima sp. (Bra1) [32], and the main second intermediate host of Brachylaima spp. Based on available parasitological data, six Brachylaima species are known to use C. aspersum at least as a second intermediate host, i.e. five in Europe (Table 1) and one species, B. cribbi, in Australia [9]. The notably large size of Bra1 metacercariae in Arçais (2,127 ± 125 μm, range: 1,739–2,430 μm) suggests that this unidentified Brachylaima species may be different from the other species known to use C. aspersum at least as a second intermediate host, including B. aspersae (644 μm, range: 495–882 μm), B. llobregatensis (1,243 μm, range: 982–1,485 μm), B. mascomai (1,321 μm, range: 604–,1814 μm), and B. cribbi (1,152 μm, range: 625–1,912 μm) ([32] for review). Moreover, the comparison of our DNA sequences with those available in GenBank also suggests that the Bra1 species is different from Brachylaima fuscata (Rudolphi, 1819) Joyeux, Baer & Timon-David, 1932 and B. mesostoma [2, 32]. In contrast to Bra1, the smaller size of Bra2 metacercariae in Arçais is not discriminant when compared to the other Brachylaima spp. recorded in C. aspersum ([32] for review). However, as far as we know, the orange colour of Bra2 metacercariae has never been mentioned for any described Brachylaima species, and may suggest that it is a new species. Unfortunately, DNA sequences of Bra2 orange metacercariae only allowed us to conclude that this species belongs to the genus Brachylaima; investigations are needed to clarify its exact nature.

Apart from C. aspersum, the only other second intermediate hosts of Brachylaima spp. were C. nemoralis and, to a lesser extent, T. pisana. It is notable that these two species are the most closely related to C. aspersum among our sample (Helicinae subfamily). This suggests that the snail features that allow the metacercarial development of closely-related Brachylaima species may be phylogenetically conserved.

Cepaea nemoralis is parasitised at similar prevalences and intensities by metacercariae from both unidentified Bra1 and Bra2 species (Table 3), with two snails harbouring mixed infections in their kidney. Infections with Bra1 metacercariae were previously documented at this site [22]. In other European regions, C. nemoralis was also found to be infected by Brachylaima metacercariae, including B. mesostoma [2, 23, 25, 73]. So far, B. mesostoma is the only Brachylaima species positively identified in C. nemoralis (although several studies identified infections only to the genus level, e.g. [23]). Furthermore, B. mesostoma as sporocysts has previously been demonstrated in C. aspersum in Arçais [32]. Therefore, it is possible that some of the non-sequenced metacercariae in C. nemoralis here also belong to this species.

Theba pisana, in contrast with C. aspersum and C. nemoralis, was only found infected once by brachylaimids in our sample, with a single Brachylaima metacercaria in one adult. This contrasts with previous studies showing that it can be infected, at relatively high prevalence (from 10% to 75% [12, 36]), by both sporocysts and metacercariae from a range of Brachylaimidae species. This includes, in Europe, Postharmostomum commutatum (Dietz, 1858) (syn. Brachylaima commutatus according to Valadão et al. [70]), a poultry fluke for which T. pisana is the single known species as first and second intermediate host, B. fuscata, and B. mascomai [27, 36]. It is also susceptible to experimental infections by B. llobregatensis [40]. Moreover, T. pisana is also described as both first and second intermediate host for B. cribbi in Australia where the snail is considered invasive [13]. The metacercaria found in T. pisana was smaller than the other metacercariae found in Arçais (excluding the orange Bra2). Potential candidate species based on these measurements include B. llobregatensis, B. mascomai, B. mesostoma, or even the pathogen species B. cribbi (see [32] for review). Further studies including DNA sequencing are needed to first confirm that the T. pisana infection was not accidental, and then to identify which Brachylaima metacercariae are associated with T. pisana in France.

Shell-encapsulation by land snails as a general defence against natural enemies

The encapsulation of parasites within the shell is a defence mechanism of land snails that was initially believed to be specific to nematodes [20, 28, 61], but which we previously showed can also be used against trematodes in C. aspersum and C. nemoralis (prevalence of 6.9% and 1.4%, respectively) [33]. The new findings recorded in the present study (i.e., shell-trapped metacercariae and nematodes in C. neglecta and P. elegans, respectively) confirm that land snails are able to kill not only nematodes, but also trematodes by shell encapsulation, and that this ability may be phylogenetically widespread among terrestrial gastropods. Moreover, in addition to shell-trapped parasites in land snails, our discovery of dipteran larvae encased in the shell of T. pisana may suggest that shell-encapsulation is a more generalist defence response than was previously thought against various natural enemies including parasites, parasitoids, and invertebrate predators.

Conclusion

The present study highlights the limited knowledge we have about host-parasite interactions involving terrestrial gastropods, a reflection of the more general knowledge gaps regarding parasite diversity [15, 17]. Importantly, even in western Europe where the malacofauna is very well described, and regarding a parasite family (Brachylaimidae) with potential impacts on vertebrate wildlife, domestic animals and even human health, our observations in a single rural garden may have unearthed undescribed parasite species, and at the very least multiple newly recorded host-parasite interactions.

Many Brachylaima species are only described from their vertebrate hosts [34, 41]; studies tracking trematodes in their environment across their entire life cycle (including faeces samples and how snails interact with them) are needed. Taken together, these would increase our knowledge of ecologically important but neglected interactions and how they may respond to anthropogenic environmental changes [16], provide new models for epidemiological studies in the wild, and help us better understand the risks associated with wild snail consumption.

Cite this article as: Géerard C, Dahirel M, Martin M-C, & Ansart A. 2026. Occurrence of brachylaimid trematodes, alive and shelltrapped, in sympatric species of terrestrial gastropods in France. Parasite 33, 55. https://doi.org/10.1051/parasite/2026052.

Edited by Jean-Lou Justine.

Conflicts of interest

The authors declare that they have no conflicts of interest.