Skip to main content
NCBI home page
Springer logoLink to Springer
. 2026 Jul 6;71(5):639–650. doi: 10.1007/s10526-026-10408-7

Development of a multiplex PCR assay to identify two key alfalfa weevil (Hypera postica) parasitoids, Bathyplectes curculionis and Oomyzus incertus, in western North America

Chulantha P Diyes 1,#, Michelle Reid 1,#, Priyanka Mittapelly 1, Jennifer Holowachuk 2, Julian R Dupuis 3, Héctor A Cárcamo 4, Boyd A Mori 1,✉
PMCID: PMC13633299  PMID: 42829535

Abstract

The alfalfa weevil, Hypera postica Gyllenhal (Coleoptera: Curculionidae), is a major pest of alfalfa hay and seed production in North America. While chemical control methods can be effective, insecticide resistance has become a concern, and they can have negative impacts on non-target species including natural enemies and pollinators. Two European parasitoids, Bathyplectes curculionis Thomson (Hymenoptera: Ichneumonidae) and Oomyzus incertus Ratzeburg (Hymenoptera: Eulophidae), offer a potential alternative biological control strategy, but their prevalence in western Canada remains poorly understood. Traditional detection methods by live larval rearing, can have limited accuracy, particularly for parasitoid eggs and early instars. Here, we developed a novel multiplex PCR assay targeting the 5.8S ribosomal rDNA and ITS2 regions to detect B. curculionis and O. incertus within H. postica larvae. In 2020 and 2021, we assessed the parasitism rate of H. postica larvae from southern Alberta using both conventional live rearing (2021 only) and the multiplex PCR assay (2020–2021). Parasitism prevalence was significantly higher in 2021 (55.7%) compared to 2020 (6.9%), with multiparasitism changing little (10% to 11%). Live rearing predominantly detected B. curculionis, while O. incertus was nearly undetectable, whereas multiplex PCR revealed higher and more balanced parasitism prevalence for both parasitoid species. As susceptibility to parasitoids can differ between H. postica strains, we surveyed H. postica adults in Manitoba, Saskatchewan, and Alberta, and determined all were the western strain. These findings indicate that live rearing underestimates parasitism, confirm the dominance of the western strain in the Canadian prairies, and highlight the importance of molecular tools for host–parasitoid surveillance.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s10526-026-10408-7.

Keywords: Medicago sativa, Parasitism, Integrated pest management, Biological control

Introduction

Alfalfa (Medicago sativa L.) is a major forage crop valued for its high protein, low fiber, and nitrogen-fixing ability, which enhances soil fertility and supports sustainable agriculture. (Orloff 1997; Barnes et al. 1988; Bagavathiannan and Van Acker 2009).North America is the global leader in alfalfa seed production, averaging over 45 million kg annually (Government of Alberta 2026). The USA is the largest producer, with most production occurring in the western states of California, Washington, Idaho, and Montana, followed by Canada, where production is concentrated in the western Prairie provinces of Alberta, Saskatchewan, and Manitoba (Mueller 2008; Pellissier et al. 2017). Together, alfalfa grown for tame hay and seed production, contributes more than US$10 billion and US$250 million to the US and Canadian economies, respectively (USDA-NASS 2012; Gardner and Putnam 2018; Statistics Canada 2022). As a high-value perennial crop grown extensively across temperate regions, alfalfa is vulnerable to a variety of insect pests, underscoring the need for effective, and sustainable pest management strategies including biological control.

The alfalfa weevil, Hypera postica (Gyllenhal) (Coleoptera: Curculionidae), is the most damaging insect pest of alfalfa seed production in North America (Pellissier et al. 2017; Soroka et al. 2020, 2024). In the Northern Great Plains, H. postica is univoltine, with larvae capable of causing extensive feeding damage, reducing shoot growth, delaying maturity, and lowering yields (Pellissier et al. 2017). Three genetically distinct, morphologically similar H. postica strains (eastern, western, and Egyptian) occur in North America, which differ in their life history, reproductive compatibility, and interactions with parasitoids (Erney et al. 1996; Bundy et al. 2005; Soroka et al. 2020). The eastern and Egyptian strain can encapsulate eggs of the parasitoid Bathyplectes curculionis (Thomson) (Hymenoptera: Ichneumonidae), reducing its effectiveness. No significant encapsulation occurs in the western strain (Puttler 1967; Maund and Hsiao 1991). Western H. postica Canadian populations are assumed to be the western strain, but this has not been confirmed (Soroka et al. 2020). Understanding strain identity is therefore critical for integrated pest management, as shifts in strain composition could influence pest population dynamics and biological control success.

Current management in alfalfa seed production fields primarily relies on insecticide applications, which can harm pollinators, disrupt natural enemies, and promote resistance (Pellissier et al. 2017; Mori 2020; Rodbell et al. 2022; Soroka et al. 2024). Biological control offers a sustainable alternative. Predators such as lady beetles (Coleoptera: Coccinellidae) and lacewings (Neuroptera: Chrysopidae) (Ouayogode and Davis 1981; Bohart et al. 1982; Rand 2017), and two introduced European parasitoids B. curculionis, and Oomyzus incertus Ratzeburg (Hymenoptera: Eulophidae) are found in alfalfa seed production fields in western North America (Rand et al. 2018; Soroka et al. 2020; Martínez et al. 2024). In the western USA, B. curculionis is the predominant parasitoid particularly in Montana, North Dakota, and Wyoming (Brewer et al. 1997; Rand 2013), and it is also established in the Canadian Prairies (Soroka et al. 2020). It is typically univoltine in northern regions such as Canada (Soroka et al. 2020) but may produce a partial or complete second generation in more southerly areas of North America (Chamberlin 1926; Radcliffe and Flanders 1998). Females parasitize early instar H. postica larvae (1st-3rd instar) (Duodu and Davis 1974). O. incertus is also established in the Canadian Prairies and has also been recorded in Montana and North Dakota (Rand 2013). It can produce three to four generations annually depending on its geographic location (Radcliffe and Flanders 1998; Soroka et al. 2020) and primarily attacks second- to fourth-instar H. postica larvae (Brunson and Coles 1968; Miller 1970). Both parasitoids can contribute to suppression of H. postica populations, but their abundance and impact in western Canada remains poorly understood.

The task of accurately identifying parasitized H. postica larvae in the field remains a significant challenge. Detection of B. curculionis and O. incertus within H. postica (as eggs and early instar larvae) is particularly difficult due to the absence of noticeable morphological changes in the parasitized larvae compared to unparasitized larvae. Although rearing or host dissection is possible for detecting the level of parasitism of H. postica larvae (Kuhar et al. 2000; Levi‑Mourao et al. 2022), it is time-consuming, labor-intensive, and prone to rearing failures, leading to incomplete or biased data (Papura et al. 2016; Chavalle et al. 2018; Sow et al. 2019). Molecular methods, which involve amplification of species-specific genetic markers, can provide a faster, more accurate, and reliable way to estimate parasitism prevalence than rearing (Gariepy et al. 2005; Traugott et al. 2006; Levi‑Mourao et al. 2022; Floate et al. 2024).

Here, we aimed to: (1) identify the regional strains of H. postica populations across western Canada; (2) develop a multiplex PCR assay targeting the 5.8S ribosomal rRNA gene and ITS2 region for detection of H. postica, B. curculionis, and O. incertus; and (3) apply the assay to determine parasitism prevalence in H. postica larvae collected from southern Alberta. The outcomes of this study may enhance our understanding of parasitism prevalence and show the potential of B. curculionis and O. incertus as biological control agents for managing H. postica across western North America.

Materials and methods

Hypera postica strain survey

Hypera postica larvae were collected from 29 sites across Alberta, Saskatchewan, and Manitoba, Canada between 13 June and 7 July 2017 (Fig. 1a). Sampling sites were opportunistic and included alfalfa seed production fields, hay fields, and alfalfa growing along field crop margins. At each site, one hundred sweeps (180°) were taken with a 38.1 cm diameter sweep net. Samples were transported live to the Saskatoon Research and Development Centre, Agriculture and Agri-Food Canada (AAFC) (Saskatoon, SK, Canada) where they were stored at −25 °C.

Fig. 1.

Fig. 1

Open in a new tab

Collection sites of Hypera postica larvae across western Canada. a Sampling sites from Manitoba, Saskatchewan and Alberta used for strain identification. b Sampling sites in southern Alberta from 2020 (open triangles) and 2021 (open circles), used to assess parasitism rates by Bathyplectes curculionis and Oomyzus incertus

Genomic DNA (gDNA) was extracted from individual larvae using a DNeasy Blood and Tissue Kit (Qiagen, Mississauga, ON, Canada) with an optional RNAse. A treatment following the manufacturers recommendations. Following the methods of Erney et al. (1996), a 300 bp region of the mitochondrial genome (portions of cytochrome B, ND4, and intervening tRNA) was amplified with the primers CB-J-11545 and N1-N-11841 (Simon et al. 1994). This region was chosen for sequencing as it can resolve all three alfalfa weevil strains (Erney et al. 1996). All PCR amplifications were carried out in a 25 µl total volume on a Bio-Rad C1000 thermal cycler (Bio-Rad Laboratories, Mississauga, ON, Canada) and subsequently purified using a QIAquick purification kit (Qiagen, Mississauga, ON) and sequenced on an Applied Biosystems 3720xl capillary sequencer at the National Research Council of Canada Laboratory (Saskatoon, SK, Canada) (as per Mori et al. 2019). The resulting sequences were assembled, aligned, and trimmed using SeqMan Pro v. 13 (DNASTAR, Madison, WI, USA) and compared to the described western haplotype (NCBI Accession U61174) (Erney et al. 1996).

Development of multiplex PCR

Adult parasitoids (B. curculionis and O. incertus) were reared from H. postica larvae collected in Manitoba, Canada in June 2017 (Supplementary Table S1). Larval H. postica were collected from each field randomly with a sweep net, brought back to the laboratory, placed in plastic containers with mesh lined lids, and reared under controlled conditions (22 °C, and a L:D 16:8 photoperiod) on alfalfa foliage until pupation. Initial identification of B. curculionis was based on Soroka et al. (2020) and O. incertus by comparison with AAFC voucher specimens. Adult H. postica specimens were collected from alfalfa seed production fields in southern Alberta. Prior to development of the multiplex PCR assay, morphological identifications were validated by sequencing a fragment of the mitochondrial cytochrome c oxidase subunit I gene (CO1). gDNA was extracted from whole insects (as above), and PCR amplification performed using universal barcode primers LCO1490 and HCO2198 for H. postica (Table 1; Folmer et al. 1994), and the NewParF and NewParR primers for both parasitoid species (Table 1; Santos et al. 2011). Reactions (25 μl) contained ultrapure water, PCR buffer, MgCl2, dNTPs, primers, Taq, and gDNA. Representative PCR amplicons were purified and sequenced (as above), and resulting sequences were compared against NCBI GenBank and BOLD databases for species confirmation. Representative CO1 sequences for H. postica, B. curculionis, and O. incertus have been deposited in NCBI GenBank (Accessions PX098783-PX098794), encompassing all sequence variants observed in this study. Full PCR details are available in the Supplementary Materials.

Table 1.

Oligonucleotide primers used in this study for the amplification of DNA from various species, including expected product sizes and target regions

Use Primer name Molecular marker Nucleotide sequence (5′ → 3′) Product size (bp) Targeted species Reference
Strain identification CB-J-11545 COb ACATGAATTGGAGCTCGACCAGT 350 Hypera postica Simon et al. (1994)
N1-N-11841 ND1 GGTACATTACCTCGGTTTCGTTATGAT
Species identification LCO1490 CO1 GGTCAACAAATCATAAAGATAATTGG 658 Hypera postica Folmer et al. (1994)
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
NewParF CO1 TAAGWTTAATTATTCGRTTAGAATTAARG 580 Bathyplectes curculionis and Santos et al. (2011)
NewParR TAAACTTCWGGATGACCAAAAAATCA Oomyzus incertus
Multiplex PCR assay 5.8SF 5.8S TGTGAACTGCAGGACACATGAAC Variable All three species Erlandson et al. (2017)
DNA44 TCCTCCGCTTATTGATATGC Gariepy et al. (2007)
AW-R ITS2 ACCTGCTCTGAGTCGAAAG 465 Hypera postica This study
Bc-R ITS2 CGCAAACCATTCGGCGTTAT 685 Bathyplectes curculionis This study
Oi-R ITS2 ATGCGTGTGCTCGTACTCTG 265 Oomyzus incertus This study
Open in a new tab

To estimate the parasitism prevalence of H. postica parasitoids, a multiplex PCR assay targeting the nuclear 5.8S ribosomal rRNA gene and ITS2 region was developed, based on the protocols described by Gariepy et al. (2005, 2008). As reference sequences for this region were not available for all species, first a portion of the 5.8S rRNA gene and ITS2 regions of all three species was amplified using the primers DNA44 (Table 1; Gariepy et al. 2007) and 5.8SF (Table 1; Erlandson et al. 2017) as described in Erlandson et al. (2017). Purified amplicons were sequenced (as above) and representative 5.8S-ITS2 sequences for each species have been deposited in NCBI GenBank (Accessions PX127714, PX230754-PX230756).

Three species-specific reverse primers were designed for each targeted insect species based on the resulting consensus 5.8S-ITS2 region sequences: AW-R (H. postica), Bc-R (B. curculionis), and Oi-R (O. incertus) (Table 1). The reverse primers were designed to produce amplicons of distinct sizes when amplified with the forward primer 5.8SF (Table 1; Erlandson et al. 2017), allowing species identification based on fragment length: B. curculionis (685 bp), H. postica (465 bp), and O. incertus (265 bp) (Table 1).

The multiplex PCR mix for each sample contained 9.3 μl ultrapure water, 2.5 μl 10 × PCR buffer (200 mM Tris–HCl pH 8.4, 500 mM KCl), 2 μl MgCl2 (50 mM), 1 μl BSA (1 mg ml−1), 1 μl dNTP mix (10 mM), 5 μl of the forward primer (10 μM), and 1 μl of each of the three species-specific reverse primers (10 μM each, totaling 3 μl of reverse primers), 0.2 μl Taq DNA polymerase (5 U μl−1), and 1.5 μl template DNA, for a total reaction volume of 25.5 μl. PCR amplification was performed under the following conditions: initial denaturation at 94 °C for 3 min; 30 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 1 min; and a final extension at 72 °C for 5 min. Positive controls, one for each species, and no gDNA negative controls were also included in each set of PCRs. Amplicons were subjected to electrophoresis, and banding patterns were visualized on the gel using ultraviolet transillumination. To confirm species-specific amplification, representative PCR amplicons from each species were manually excised from the agarose gel, purified using the QIAquick® PCR & Gel Cleanup Kit (Qiagen, Mississauga, ON, CA), and sequenced (as above).

Assay specificity and limit of detection

Primer specificity was evaluated in two ways. First, the newly designed species-specific reverse primers for the three target species were queried against the nr database using BLAST (Altschul et al. 1990) to assess potential matches to non-target sequences. Second, the cross-reactivity was determined by amplifying DNA from specimens of H. postica, B. curculionis, and O. incertus using their respective reverse primers in combination with 5.8SF to confirm that each primer set exclusively amplified its intended target species. The limit of detection of the multiplex PCR assay was determined with H. postica present as background DNA (5 ng). The initial parasitoid DNA concentration (10 ng μl−1) was serially diluted to 10,000, 10, 0.01, and 1 × 10–6 pg μl−1 (achieving 10 × to 10,000 × dilution). The limit of detection for parasitoids was determined using five technical replicates per dilution and per species.

Regional parasitism prevalence determined by multiplex PCR and live rearing

To determine the field parasitism prevalence of H. postica larvae by B. curculionis and O. incertus, H. postica larvae were collected from eight field sites in 2020 and ten field sites in 2021 as part of a two-year parasitism survey conducted across the alfalfa seed-producing region in southern Alberta during the first week of June to the first week of July (Fig. 1b). The minimum sampling effort in each field was one hundred sweeps (180°) using a standard sweep net. The contents of each sweep were transferred into resealable plastic bags and stored in a refrigerated container before storage at –20 °C. From each locality, up to 100 larvae were collected, and the genomic DNA was individually extracted from 20 H. postica larvae that were selected at random. Lower numbers of alfalfa weevil larvae were collected from three sites (2020, site D = 19; 2021, site N = 19, site P = 8), and all were extracted. The gDNA was then subjected to multiplex PCR screening to determine parasitism prevalence at each locality.

To compare parasitism detection by the multiplex PCR assay and live rearing, a second set of 100 sweeps, following the same sampling technique, was collected from five of the ten field sites mentioned above in 2021 (due to restrictions in place during the COVID-19 pandemic rearing could not take place in 2020) (Fig. 1b). In the laboratory, samples were placed in a growth chamber under controlled conditions (21 °C, a L:D 16:8 photoperiod, 70% RH). Samples were maintained for at least 12 h to acclimatize before being individually transferred into plastic containers for rearing based on the protocol developed by Brewer et al. (1997). From each field, ~ 200 (range 200–202) individuals of third and fourth instar larvae were each placed in separate plastic containers (30 ml, ULINE, Edmonton, AB) lined with a moistened paper towel and a layer of alfalfa foliage. Plastic containers were then sealed with perforated lids and maintained under controlled conditions (as above). The larvae were monitored every three days. Larvae were considered dead if there was no movement in response to external stimuli (e.g., touch). Fresh alfalfa was provided when necessary unless the larvae transformed into cocoons. Prevalence of parasitism was assessed 16 days after the collection. The larvae were categorized as either non-parasitized, in cases where adult weevils, dead larvae, or pupae were observed, or parasitized, if B. curculionis cocoons, B. curculionis adults, or O. incertus adults were found inside the plastic container. Dellinger et al. (2003) noted that O. incertus larvae may transform their host larvae into brittle, mahogany-brown mummies. In the present study, parasitism was not assessed based on color differences or texture to avoid potential errors in interpretation of data. Parasitism prevalence determined by live rearing was compared with multiplex PCR, which was performed on 20 additional randomly selected H. postica larvae from each of the five fields used for live rearing.

Statistical analysis

All statistical analyses were conducted in R v.4.3.1 (R Core Team 2023) as implemented in RStudio v.2024.04.0.735 (Posit Team 2025). Data was manipulated with readr v.2.1.5 (Wickham et al. 2024) and dplyr v.1.1.4 (Wickham et al. 2025), and figures were created with the ggplot2 v.3.5.2 (Wickham 2016) packages.

To determine if regional parasitism prevalence differed between years, generalized linear mixed models (GLMM) with binomial error distributions (logit link function) were fit using the package lme4 (Bates et al. 2015). Separate models were fit for each parasitism outcome (B. curculionis, O. incertus, multiple parasitism (both species detected in the same host), and total), with the number of parasitized and unparasitized larvae as the response, year as a fixed effect, and site included as a random factor to account for non-independence of samples within sites. Model significance was assessed using Type II likelihood ratio tests from the car package (Fox and Weisberg 2018). Estimated marginal means (EMMs) and SE were obtained using the emmeans package (Lenth 2025) and are reported on the response scale.

To compare detection methods (live rearing to the multiplex PCR), an initial generalized linear model (GLM) with binomial error distributions (lme4 package, logit link function) was fit with a detection method × site interaction. As the interaction was not significant (p < 0.05), site was instead specified as a random effect. Separate GLMMs were fit for each parasitism outcome (B. curculionis, O. incertus, and total), with detection method as a fixed effect. Finally, to evaluate whether detection methods differed in their relative ability to detect each parasitoid species, separate GLMMs were fit for each detection method (PCR and live rearing) with species as the fixed effect. For each GLMM the model structure followed the general framework above. Model significance, EMMs and SE were obtained as described above.

Results

Strain survey

Alfalfa weevil larvae (n = 116) collected from three sites in Alberta, 16 in Saskatchewan, and ten in Manitoba were successfully sequenced using the CB-J-11545/N1-N-11841 primers (Fig. 1, Table 1). All weevils were diagnosed as the western strain due to 100% sequence similarity to the original described western haplotype (NCBI Accession U61174) (Erney et al. 1996). Representative sequences from a single alfalfa weevil from Alberta, Saskatchewan, and Manitoba have been deposited in NCBI GenBank (Accessions OQ079992-OQ079994).

Development of multiplex PCR

Morphological species identification matched with molecular identification via CO1 for all species using both NCBI GenBank and BOLD databases. When amplified with the 5.8SF primer, each reverse primer specifically targeted and only amplified the DNA of its intended species (Fig. 2) and no non-target sequences were identified with BLAST. The amplification produced the expected product size for each insect species under the thermocycle conditions described for multiplex PCR (Table 1). The reliable limit of detection for both B. curculionis and O. incertus appeared to be 10 pg μl−1 when 5 ng of H. postica DNA was present in the background (Supplementary Figure S1, S2, respectively).

Fig. 2.

Fig. 2

Open in a new tab

Representative gel image of PCR products from Hypera postica (465 bp, lane 1), Bathyplectes curculionis (685 bp, lane 2), Oomyzus incertus (265 bp, lane 3), and field-collected H. postica larvae collected from southern Alberta (lanes 4–14). An equal volume of PCR product (5 μl) from each reaction was loaded to assess amplification specificity and product size. Banding patterns indicate no parasitism in lanes 9, 12, 14; parasitism by B. curculionis in lanes 5, 7, 10, 13; parasitism by O. incertus in lanes 6, 8, 11; and multiparasitism (both. B. curculionis and O. incertus) in lane 4. Lane 15 contains the no-template control (NTC). PCR was performed using the forward primer 5.8SF (Erlandson et al. 2017) with species-specific reverse primers: AW-R (H. postica), Bc-R (B. curculionis), and Oi-R (O. incertus). Bands on the DNA ladder represent 100 bp increments for size estimation (GeneRuler 100 bp plus, ThermoScientific)

Parasitism prevalence of B. curculionis and O. incertus in H. postica larvae was significantly different between the two years (B. curculionis: χ2 = 9.54, df = 1, p < 0.01; O. incertus: χ2 = 11.88, df = 1, p < 0.001; total parasitism: χ2 = 43.8, df = 1, p < 0.0001) (Fig. 3). In 2020, 6.91 ± 6.96% (mean ± SE) of H. postica larvae were parasitized by either B. curculionis, O. incertus, or both (Supplementary Table S2). In 2021, the overall parasitism prevalence was 55.68 ± 8.60% including single parasitoid species or multiple species (Supplementary Table S2). The mean parasitism prevalence of B. curculionis ranged from 0–40% in 2020 and 0–70% in 2021 (Supplementary Table S2). For O. incertus, mean parasitism ranged from 0–15% in 2020 and 0–80% in 2021 (Supplementary Table S2). There was a marginal significant difference in multiparasitism between the years (χ2 = 3.98, df = 1, p = 0.046; Fig. 3c). Multiparasitism was observed from a single locality in 2020, but in 2021, it was recorded in seven localities (Supplementary Table S2).

Fig. 3.

Fig. 3

Open in a new tab

Estimated marginal means (± SE) from generalized linear mixed models of parasitism prevalence of a Bathyplectes curculionis, b Oomyzus incertus, c multiple parasitism, and d total parasitism in Hypera postica larvae in 2020 and 2021. Points represent observed site-level parasitism. Different letters above bars indicate significant differences among years within each panel (GLMM, p < 0.05)

Parasitism prevalence based on live rearing and multiplex PCR revealed significant differences in parasitism detection, with the multiplex PCR generally indicating higher prevalence of parasitism for O. incertus (χ2 = 99.15, df = 1, p < 0.0001) and total parasitism (χ2 = 43.62, df = 1, p < 0.0001), but not for B. curculionis (χ2 = 1.09, df = 1, p > 0.05) (Supplementary Table S3; Fig. 4). Despite the significantly large discrepancies in parasitism prevalence of O. incertus and B. curculionis between live rearing (χ2 = 105.88, df = 1, p < 0.0001), there was no significant difference in their prevalence when analyzed by PCR (χ2 = 0.09, df = 1, p > 0.05) (Supplementary Table S3).

Fig. 4.

Fig. 4

Open in a new tab

Estimated marginal means (± SE) from generalized linear mixed models of parasitism prevalence of a Bathyplectes curculionis, b Oomyzus incertus, and c total parasitism in Hypera postica larvae by using a multiplex PCR assay and live rearing during the first week of July in 2021. Points represent observed site-level parasitism. Different letters above bars indicate significant differences among years within each panel (GLMM, p < 0.05)

Parasitism prevalence was variable (19.90% to 44.29%) in larvae reared in the laboratory (Supplementary Table S3; Fig. 4). B. curculionis was the predominant parasitoid species, accounting for over 98.53% of parasitized H. postica larvae. The remaining 1.47% were parasitized by O. incertus, which was detected at only three localities, with a mean parasitism prevalence of 0.83 ± 0.25% (range: 0.5–1.5%). The mean parasitism prevalence by B. curculionis was 33.33 ± 5.02% (range: 19.9–43.56%) and was observed at all five sites (Supplementary Table S3). However, multiplex PCR analysis of H. postica larvae from the same localities revealed a broader range of parasitism (Supplementary Table S3). Parasitism by B. curculionis had a mean rate of 38.31 ± 11.85% (range: 5–70%), while O. incertus ranged from 5.2% to 80%, with a mean parasitism rate of 40.05 ± 13.09%. The overall parasitism rate by any parasitoid ranged from 36.84% to 90%, with an average of 69.36 ± 9.48%. Multiple parasitism was detected in four localities, ranging from 5 to 25% (mean: 9.00 ± 4.30%).

Discussion

We developed a molecular assay targeting the 5.8S rDNA-ITS2 region to identify the two main parasitoids, B. curculionis, and O. incertus, of H. postica in western North America (Rand et al. 2018; Soroka et al. 2020). The assays enable simultaneous, rapid, and accurate identification of all species involved. This work expands the parasitoid species of H. postica that can be detected with molecular tools throughout the world (Levi-Mourao et al. 2022).

Parasitism prevalence was assessed in H. postica larvae collected from southern Alberta in early July 2020 and 2021. A large contrast was observed between years. In 2020, overall parasitism was low (ca. 7%), with B. curculionis detected at only three sites (5–40%) and O. incertus largely absent. In 2021, parasitism increased markedly (ca. 56%), with both B. curculionis and O. incertus more frequently detected (30% and 34%, respectively). These trends are consistent with seasonal patterns in adult parasitoid abundance observed by Martínez et al. (2024) at the same sites.

Phenological mismatch likely explains the lower parasitism rate in 2020. In 2020, B. curculionis peaked during the bud stage in early June (mean = 9 adults 100 sweeps−1) and declined during flowering stage in early July (3 adults 100 sweeps−1) and seed stage in early August (1 adult 100 sweeps−1) (Martínez et al. 2024). Oomyzus incertus adults were absent during early July, but present in low numbers during the bud stage (4 adults 100 sweeps−1) and the seed stage (1 adult 100 sweeps−1). These data suggest that the majority of B. curculionis (univoltine) and O. incertus (multivoltine) individuals likely completed their development before sampling in early July. In contrast, adult abundance of both species peaked during the flowering stage in 2021 (3 and 4 adults 100 sweeps−1, respectively) (Martínez et al. 2024), coinciding with our sampling period, and potential contributing to the higher parasitoid prevalence observed. The low incidence of multiparasitism and the absence of significant differences in parasitism prevalence between B. curculionis and O. incertus (based on the molecular assay) in 2021, suggests host availability was not limiting, and interspecific competition was minimal, despite lower abundance of weevil larvae compared to the previous year (Martínez et al. 2024).

Sampling intensity may have further influenced parasitism detection. In 2020, only 20 larvae per locality were screened by PCR, despite high host densities (mean = 1704 larvae 100 sweeps−1; Martínez et al. 2024) which may not have been sufficient to reliably detect parasitism. In 2021, with much lower larval densities (bud stage: mean = 490 larvae 100 sweeps−1; flowering stage: mean = 81 larvae 100 sweeps−1; Martínez et al. 2024), parasitism detection likely increased. These results are consistent with density-dependent dilution effect observed in other host–parasite systems (Krasnov et al. 2007; Buck and Lutterschmidt 2017; Magalhães et al. 2017), where increased host density led to fewer parasitized individuals. Rand (2013) also reported similar host density-dependent dynamics for B. curculionis and O. incertus associated with the western strain of H. postica. At similar host densities and under comparable field conditions, parasitism by B. curculionis decreased with increasing host density, whereas parasitism by O. incertus increased. Moreover, Rand (2013) observed variation in annual B. curculionis parasitism in response to H. postica density. Therefore, long-term studies are needed to determine how H. postica density and field conditions influence the establishment of parasitoids.

Parasitism prevalence also differed significantly between detection methods. Live rearing indicated lower overall parasitism prevalence (mean = 34%) especially for O. incertus which was nearly undetectable. In contrast, multiplex PCR consistently revealed higher (mean = 70%) and more balanced parasitism (mean B. curculionis = 38%, O. incertus = 40%). These results are consistent with previous studies demonstrating greater sensitivity of molecular-based parasitism detection compared to traditional rearing (Gariepy et al. 2005, 2008; Papura et al. 2016; Sow et al. 2019), including Levi-Mourao et al. (2022), who reported higher PCR-based detection of B. curculionis and B. anura parasitizing H. postica in Spain. Although live rearing likely underestimates true parasitism, our 2021 parasitism estimates for B. curculionis (33%) and O. incertus (0.8%) were similar to those reported by Rand (2013) in Montana and North Dakota, USA (mean B. curculionis = 37.2%, O. incertus = 3.5%), regions south of Alberta with similar ecological conditions. Lower detection in live rearing likely results from host or parasitoid mortality during development, which can result from suboptimal laboratory conditions. Nevertheless, live rearing remains valuable for confirming parasitoid emergence and functional impact of parasitism as molecular methods detect genetic material regardless of viability or the life stage of the host and the parasitoids. Rather than treating these two approaches as alternatives, they should be viewed as complementary, collectively providing a more comprehensive assessment of parasitism within host populations. In the present study, incorporating molecular screening of larvae that appeared non-parasitized during live rearing would have further strengthened the estimates by verifying the true absence of parasitism.

Molecular identification confirmed only the western strain of H. postica in specimens collected from Manitoba, Saskatchewan and Alberta. Although the eastern strain has been reported from Montana and North Dakota, including regions bordering southern Manitoba (Bundy et al. 2005), it was not detected in this study across the Canadian Prairie provinces. The absence of the eastern strain may have important implications for H. postica biological control in western Canada, as both this study and Soroka et al. (2020) found B. curculionis to be the dominant parasitoid, which is markedly less effective against the eastern strain (Puttler 1967; Maund and Hsiao 1991). The exclusive presence of the western strain may help explain the relatively high parasitism observed in this region. Given the potential for strain-specific differences in parasitoid susceptibility, continued monitoring of weevil strain distributions in western Canada is warranted, particularly given the ecological similarities with neighbouring areas of the northern Great Plains.

This study provides the first molecular confirmation of H. postica strain identity in Canada and the first PCR-based parasitism prevalence of B. curculionis and O. incertus in H. postica in Alberta. The combined use of rearing and molecular methods revealed variation in parasitism prevalence between years and among sampling sites, shaped by host density and parasitoid phenology. As climate change and host range expansion continue, further research is needed to understand how abiotic factors affect parasitoid success. These insights will be essential for incorporating biological control into an effective integrated pest management program for H. postica in western Canada.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (DOCX 1828 KB) (1.8MB, docx)

Acknowledgements

We thank J. Soroka, Agriculture and Agri-Food Canada, for providing voucher specimens for insect identification. We also thank B. Alexander, J. Narayan, M. Kohlman, S. Daniels, D. Ostermann, S. Meers, and S. Barkley for help with alfalfa weevil collections and B. Davidson and S. Hladun for technical support. Special thanks go to the alfalfa producers across the Canadian Prairies for allowing us to conduct this study in their fields. Funding was provided by the Canadian Agricultural Partnership—AgriScience Program project entitled “Enhancing turf and forage seed production systems in Western Canada” (ASP-017) funded by Agriculture and Agri-Food Canada, the Peace Region Forage Seed Association, Alfalfa Seed Commission Alberta, and Saskatchewan Alfalfa Seed Producers Development Commission to BAM and HAC, with additional support provided by a NSERC Industrial Research Chair (545088) and partner organizations (Alberta Grains, Alberta Canola Producers Commission, Alberta Pulse Growers Commission) as well as an NSERC Discovery Grant (2021-02479) to BAM.

Biographies

Chulantha P. Diyes

is a post-doctoral fellow developing molecular tools to assess predation and parasitism of agricultural pests.

Michelle Reid

Parts of this research comprised the MSc thesis of Michelle Reid focused on monitoring insect diversity and parasitism of the alfalfa weevil in alfalfa seed production fields.

Priyanka Mittapelly

is a laboratory manager with research interests in insect molecular biology pertaining to integrated pest management and insecticide resistance.

Jennifer Holowachuk

is a research technician with Agriculture and Agri-Food Canada who develops molecular tools for use in pest management.

Julian R. Dupuis

is an evolutionary biologist whose research focuses on population genomics and phylogenomics to understand genetic variation and species boundaries.

Héctor A. Cárcamo

leads a research program on insect-plant interactions and integrated pest management in Prairie cropping systems, with an emphasis on economic thresholds and natural enemies.

Boyd A. Mori

leads a research program focused on integrated pest management in field crops, with an emphasis on insect–natural enemy interactions and sustainable pest management strategies.

Funding

Agriculture and Agri-Food Canada, ASP-017, Boyd Mori; Natural Sciences and Engineering Research Council of Canada, 545088, Boyd Mori; 2021-02479, Boyd Mori; Peace Region Forage Seed Association,ASP-017, Boyd Mori; Alfalfa Seed Commission Alberta, ASP-017, Boyd Mori; Saskatchewan Alfalfa Seed Producers Development Commission, ASP-017, Boyd Mori

Declarations

Conflicts of interest

The Authors declare no conflicts of interest or competing interests.

Informed consent

Our research did not involve human participants and did not require informed consent.

Research involving human participants and/or animals

Our research did not involve human participants or animals.

Footnotes

Handling Editor: Dirk Babendreier

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Chulantha P. Diyes and Michelle Reid are Co-first authors.

References

  1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215(3):403–410 [DOI] [PubMed] [Google Scholar]
  2. Bagavathiannan MV, van Acker RC (2009) The biology and ecology of feral alfalfa (Medicago sativa L.) and its implications for novel trait confinement in North America. Crit Rev Plant Sci 28:69–87 [Google Scholar]
  3. Barnes DK, Goplen BP, Baylor JE (1988) Highlights in the USA and Canada. In: Hanson AA, Barnes DK, Hill RR (eds) Alfalfa and alfalfa improvement. American Society of Agronomy Crop Science Society of America Soil Science Society of America, Madison, pp 1–24 [Google Scholar]
  4. Bates D, Mächler M, Bolker B, Walker S (2015) Fitting linear mixed-effects models using lme4. J Stat Softw 67:1–48 [Google Scholar]
  5. Bohart GE, Parker FD, Tepedino VJ (1982) Notes on the biology of Odynerus dilectus, a predator of the alfalfa weevil. Entomophaga 27:23–31 [Google Scholar]
  6. Brewer MJ, Donahue JD, Morrison EJ (1997) Bathyplectes parasitoids (Hymenoptera: Ichneumonidae) of alfalfa weevil, Hypera postica (Coleoptera: Curculionidae) in Wyoming. J Kans Entomol Soc 70:197–202 [Google Scholar]
  7. Brunson MH, Coles LW (1968) The introduction, release, and recovery of parasites of the alfalfa weevil in eastern United States. USDA-ARS Prod Rep 101:1–12 [Google Scholar]
  8. Buck JC, Lutterschmidt WI (2017) Parasite abundance decreases with host density: evidence of the encounter-dilution effect for a parasite with a complex life cycle. Hydrobiologia 784:201–210 [Google Scholar]
  9. Bundy CS, Smith PF, English LM, Sutton D, Hanson S (2005) Strain distribution of alfalfa weevil in an intergrade zone. J Econ Entomol 98:2028–2032 [DOI] [PubMed] [Google Scholar]
  10. Chamberlin TR (1926) The introduction and establishment of the alfalfa weevil parasite, Bathyplectes curculionis (Thoms.), in the United States. J Econ Entomol 19:302–310 [Google Scholar]
  11. Chavalle S, Buhl PN, San Martin G, Hautier L, De Proft M (2018) Parasitism rates and parasitoid complexes of wheat midges. BioControl 63:641–653 [Google Scholar]
  12. Dellinger TA, Youngman RR, Laub CA (2003) Recovery of Oomyzus incertus (Hymenoptera: Eulophidae), a larval parasitoid of Hypera postica (Coleoptera: Curculionidae), in Virginia. J Entomol Sci 38:141–142 [Google Scholar]
  13. Duodu YA, Davis DW (1974) Selection of alfalfa weevil larval instars by, and mortality due to, the parasite Bathyplectes curculionis (Thomson). Environ Entomol 3:549–552
  14. Erlandson MA, Holowachuk J, Sieminska EA, Hummel J, Otani J, Floate KD (2017) Development of a multiplex polymerase chain reaction assay for the identification of common cutworm species (Lepidoptera: Noctuidae) infesting canola in Western Canada. Can Entomol 149(4):540–548 [Google Scholar]
  15. Erney SJ, Pruess KP, Danielson SD, Powers TO (1996) Molecular differentiation of alfalfa weevil strains (Coleoptera: Curculionidae). Ann Entomol Soc Am 89:804–811 [Google Scholar]
  16. Floate K, Wilches-Correal D, Ibarra-Galvis V, Pawluk A, Roy B, Cárcamo H (2024) A comparison of molecular screening versus dissection and rearing methods to estimate parasitism of Lygus nymphs by Peristenus wasps – size matters. Can Entomol 156:e37 [Google Scholar]
  17. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for COI amplification. Mol Mar Biol Biotechnol 3(5):294–299 [PubMed] [Google Scholar]
  18. Fox J, Weisberg S (2018) An R companion to applied regression. 3 edition. Sage, Thousand Oaks, USA
  19. Gardner D, Putnam D (2018) Alfalfa situation in the USA and Canada. In: Proceedings of the second world alfalfa congress, global interaction for alfalfa innovation, Instituto Nacional de Tecnología Agropecuaria (INTA), Córdoba, Argentina.
  20. Gariepy TD, Kuhlmann U, Haye T, Gillott C, Erlandson M (2005) A single-step multiplex PCR assay for the detection of European Peristenus spp., parasitoids of Lygus spp. Biocontrol Sci Technol 15:481–495 [Google Scholar]
  21. Gariepy TD, Kuhlmann U, Gillott C, Erlandson M (2007) Parasitoids, predators and PCR: the use of diagnostic molecular markers in biological control of arthropods. J Appl Entomol 131:225–240 [Google Scholar]
  22. Gariepy T, Kuhlmann U, Gillott C, Erlandson M (2008) A large-scale comparison of conventional and molecular methods for the evaluation of host–parasitoid associations in non-target risk-assessment studies. J Appl Ecol 45:708–715 [Google Scholar]
  23. Government of Alberta (2026) Alfalfa seed marketing in Canada. Alberta Agriculture and Forestry. https://www.alberta.ca/alfalfa-seed-marketing-in-canada
  24. Krasnov BR, Stanko M, Morand S (2007) Host community structure and infestation by ixodid ticks: repeatability, dilution effect and ecological specialization. Oecologia 154:185–194 [DOI] [PubMed] [Google Scholar]
  25. Kuhar TP, Youngman RR, Laub CA (2000) Alfalfa weevil (Coleoptera: Curculionidae) population dynamics and mortality factors in Virginia. Environ Entomol 29:1295–1304 [Google Scholar]
  26. Lenth R (2025) emmeans: Estimated marginal means, aka least-squares means. R package version 1.11.2 https://rvlenth.github.io/emmeans/
  27. Levi-Mourao A, Madeira F, Meseguer R, García A, Pons X (2022) Molecular and morphological identification of the alfalfa weevil larval parasitoids Bathyplectes anura and Bathyplectes curculionis to estimate the rate of parasitism. BioControl 67:319–330 [Google Scholar]
  28. Magalhães L, Freitas R, Dairain A, De Montaudouin X (2017) Can host density attenuate parasitism? J Mar Biol Assoc U K 97(3):497–505 [Google Scholar]
  29. Martínez AFR, Reid M, Frost CM, Cárcamo HA, Mori BA (2024) Seasonal abundance of key alfalfa (Fabaceae) seed production pests and their natural enemies in southern Alberta. Can Entomol 156:e36 [Google Scholar]
  30. Maund CM, Hsiao TH (1991) Differential encapsulation of two Bathyplectes parasitoids among alfalfa weevil strains, Hypera postica (Gyllenhal). Can Entomol 123(1):197–203 [Google Scholar]
  31. Miller MC (1970) Biological control of the alfalfa weevil in Massachusetts. J Econ Entomol 63:440–443 [Google Scholar]
  32. Mori BA (2020) Management of alfalfa weevil in western Canada: insecticides and biological control. Forage Seed News 27:20–21 [Google Scholar]
  33. Mori BA, Andreassen L, Heal JD, Dupuis JR, Soroka JJ, Sinclair BJ (2019) A new species of Contarinia Rondani (Diptera: Cecidomyiidae) that induces flower galls on canola (Brassicaceae) in the Canadian prairies. Can Entomol 151:131–148 [Google Scholar]
  34. Mueller TC (2008) Population genetics of Bathyplectes curculionis in the Great Plains. Environ Entomol 37:1503–1510 [Google Scholar]
  35. Orloff SB (1997) Evaluation of parasitoids for biological control of alfalfa weevil. J Kans Entomol Soc 70:15–22 [Google Scholar]
  36. Ouayogode BV, Davis DW (1981) Feeding by selected predators on alfalfa-weevil larvae. Environ Entomol 10:62–64 [Google Scholar]
  37. Papura D, Rusch A, Roux P, Delbac L, Thiéry D (2016) Early detection and identification of larval parasitoids in Lobesia botrana using PCR-RFLP method. Biol Control 103:95–100 [Google Scholar]
  38. Pellissier ME, Nelson Z, Jabbour R (2017) Ecology and management of the alfalfa weevil in Western U.S. J Integr Pest Manag 8(1):1–7 [Google Scholar]
  39. Posit Team (2025) RStudio: Integrated development environment for R. Posit software, PBC, Boston, MA, USA, http://www.posit.co/
  40. Puttler B (1967) Interrelationship of Hypera postica (Coleoptera: Curculionidae) and Bathyplectes curculionis (Hymenoptera: Ichneumonidae) in the eastern United States with particular reference to encapsulation of the parasite eggs by the weevil larvae. Ann Entomol Soc Am 60(5):1031–1038 [Google Scholar]
  41. Radcliffe EB, Flanders KL (1998) Biological control of alfalfa weevil in North America. Integr Pest Manage Rev 3:225–242 [Google Scholar]
  42. Rand TA (2013) Host density drives spatial variation in parasitism of the alfalfa weevil, Hypera postica, across dryland and irrigated alfalfa cropping systems. Environ Entomol 42(1):116–122 [DOI] [PubMed] [Google Scholar]
  43. Rand TA (2017) Assessing the role of generalist predators in the biological control of alfalfa weevil (Coleoptera: Curculionidae). Can Entomol 149(4):525–533 [Google Scholar]
  44. Rand TA, Pellissier M, Jabbour R, Lundgren JG, Waters DK (2018) Evaluating the establishment success of Microctonus aethiopoides (Hymenoptera: Braconidae), a parasitoid of the alfalfa weevil (Coleoptera: Curculionidae), across the northern Great Plains of North America. Can Entomol 150:274–277 [Google Scholar]
  45. R Core Team (2023) R: A language and environment for statistical computing. Vienna, Austria, https://www.r-project.org
  46. Rodbell EA, Hendrick ML, Grettenberger IM, Wanner KW (2022) Alfalfa-weevil resistance to lambda-cyhalothrin in the Western U.S. J Econ Entomol 115(6):2029–2040 [DOI] [PubMed] [Google Scholar]
  47. Santos AMC, Besnard G, Quicke DL (2011) Applying DNA barcoding for the study of geographical variation in host–parasitoid interactions. Mol Ecol Resour 11:46–59 [DOI] [PubMed] [Google Scholar]
  48. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87(6):651–701 [Google Scholar]
  49. Soroka J, Bennett AMR, Kora C, Schwarzfeld MD (2020) Distribution of alfalfa weevil (Coleoptera: Curculionidae) and its parasitoids on the Canadian Prairies, with a key to described species of Nearctic Bathyplectes (Hymenoptera: Ichneumonidae). Can Entomol 152(5):663–701 [Google Scholar]
  50. Soroka J, Bennett AM, Mori BA (2024) Hypera postica (alfalfa weevil). In: Mason PG, Gillespie DR (eds) Biological control programmes in Canada, 2013–2023. CABI, Wallingford, pp 257–262 [Google Scholar]
  51. Sow A, Brévault T, Benoit L, Chapuis MP, Galan M, Coeur d’Acier A, Delvare G, Sembène M, Haran J (2019) Deciphering host-parasitoid interactions and parasitism rates of crop pests using DNA metabarcoding. Biol Control 9:3646 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Statistics Canada (2022) Census of agriculture. https://www.statcan.gc.ca/en/census/agriculture
  53. Traugott M, Zangerl P, Juen A, Schallhart N, Pfiffner L (2006) Detecting key parasitoids of lepidopteran pests by multiplex PCR. Biol Control 39:39–46 [Google Scholar]
  54. USDA-NASS (2012) 2012 Census of Agriculture. U.S. Department of Agriculture. https://www.nass.usda.gov/agcensus
  55. Wickham H (2016) ggplot2: elegant graphics for data analysis. Springer-Verlag, New York, NY, USA [Google Scholar]
  56. Wickham H, Hester J, Bryan J (2024) Readr: Read rectangular text data. R package version 2.1.5 https://readr.tidyverse.org
  57. Wickham H, François R, Henry L, Müller K, Vaughan D (2025) dplyr: a grammar of data manipulation. R package version 1.1.4 https://github.com/tidyverse/dplyr

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (DOCX 1828 KB) (1.8MB, docx)

Articles from Biocontrol (Dordrecht, Netherlands) are provided here courtesy of Springer

RESOURCES