Skip to main content
NCBI home page
Current Research in Parasitology & Vector-borne Diseases logoLink to Current Research in Parasitology & Vector-borne Diseases
. 2026 Sep 16;10:100437. doi: 10.1016/j.crpvbd.2026.100437

Integrative molecular and serum proteomic insights into subclinical Theileria infection in captive Fea’s muntjac (Muntiacus feae) and red muntjac (Muntiacus vaginalis) in Thailand

Pannawat Supapannachart a, Sittiruk Roytrakul b, Narumon Phaonakrop b, Thewarach Vechmanus c, Umaporn Maikaew d, Pridsana Sreepromma d, Karin Hirankailas e, Supatsorn Panyalert e, Thanapon Chotikaprakal a, Sonthaya Tiawsirisup f, Kritsada Thongmeesee f, Rittidet Kongtawee f, Piyanan Taweethavonsawat f, Gunnaporn Suriyaphol a,g,⁎
PMCID: PMC13633862  PMID: 42830720

Abstract

The Fea’s muntjac (Muntiacus feae) and the northern red muntjac (Muntiacus vaginalis) are Asian cervids maintained in captive conservation programmes in Thailand, yet information on blood-borne pathogens in these species remains limited. This study aimed to investigate Theileria spp. infection in 34 captive muntjacs from four facilities across Thailand using PCR, Sanger sequencing, phylogenetic analysis, and liquid chromatography-tandem mass spectrometry (LC-MS/MS)-based serum proteomics. All animals appeared clinically healthy, and no hemoparasites were observed on blood smears. Nevertheless, Theileria spp. DNA was detected by PCR in every individual, indicating subclinical infection. Babesia spp. were below the detection limit of the PCR assay, while members of the Anaplasmataceae were not detected. Phylogenetic analysis of 15 sequences positioned most isolates among T. capreoli-associated (9/15) or other cervid-associated Theileria lineages (5/15), while one isolate (1/15) was positioned separately; relationships involving the study isolates were generally weakly supported. Serum proteomics identified 414 Theileria-associated proteins consistently detected in both host species. Functional annotation revealed proteins involved in invasion (rhoptry-associated proteins), proteolysis (aspartyl proteases and calpain-like proteins), ubiquitin-mediated regulation, vesicular trafficking, and RNA processing, providing preliminary functional insight into Theileria-associated biological processes during subclinical infection. These findings suggest a potential role of captive muntjacs in parasite maintenance where competent vectors are present and demonstrate the value of integrating molecular detection with proteomic profiling to investigate host-parasite interactions in wildlife.

Keywords: Fea’s muntjac, Northern red muntjac, PCR, Serum proteomics, Subclinical infection, Theileria, Wildlife conservation

Graphical abstract

graphic file with name ga1.webp

Open in a new tab

Highlights

  • •

    Theileria 18S rRNA was detected by PCR in subclinically infected captive Muntiacus feae and M. vaginalis.

  • •

    Most isolates (9/15) were closely associated with Theileria capreoli/T. cf. capreoli; others were cervid-associated.

  • •

    Serum proteomics identified Theileria-associated proteins linked to invasion, proteolysis, and vesicular trafficking.

1. Introduction

The Fea’s muntjac (Muntiacus feae) and the northern red muntjac (Muntiacus vaginalis) are Asian cervids inhabiting Southeast Asian forest ecosystems (Francis, 2019). In Thailand, the captive population of M. feae is critically small (n = 7), making the health and long-term management of each individual essential for species conservation. Although M. feae is currently classified as Data Deficient by the IUCN because of uncertainties regarding its distribution (Timmins et al., 2016a), it is listed as Endangered (EN) in the Thailand National Red List (ONEP, 2020). Recent genomic studies have also improved our understanding of the taxonomy and genetic status of this threatened species, providing an important foundation for future conservation management (Supapannachart et al., 2026a, 2026b). In contrast, M. vaginalis is more abundant and is classified as Least Concern (LC) by the IUCN despite declining population trends (Timmins et al., 2016b). Recent genomic evidence further demonstrated that all captive red muntjacs examined in Thailand belong to the M. vaginalis lineage (Supapannachart et al., 2026a).

In captive breeding facilities in Thailand, M. feae are often maintained in close proximity to M. vaginalis, creating opportunities for the transmission of blood-borne pathogens between species. Blood-borne pathogens, particularly those of the genera Theileria, Anaplasma, and Babesia, represent important health threats to wild and captive cervids (Dantas-Torres et al., 2012; Koonyosying et al., 2022; Calchi et al., 2025). Among these, Theileria spp. are of particular concern due to their widespread occurrence in wild ruminants and their potential for spillover at the wildlife-livestock interface (Morrison et al., 2020; Naveed et al., 2022). Theileria spp. infections can cause severe disease in stressed or immunocompromised hosts, particularly in juvenile cervids, with clinical signs including fever, lethargy, and anemia, and may result in high mortality in severe cases (Yabsley et al., 2005; Gieger et al., 2020). However, most Theileria infections in cervids across North America, Europe, and East Asia remain subclinical, with infected animals potentially contributing to pathogen maintenance over extended periods (Han et al., 2009; Zanet et al., 2014; Cauvin et al., 2019; Remesar et al., 2019; Gieger et al., 2020). Detection of subclinical Theileria spp. infection remains challenging, as conventional blood smear microscopy often lacks the sensitivity required to detect low parasitemia in chronic carriers (Noaman, 2012; Riaz et al., 2023). Consequently, polymerase chain reaction (PCR) targeting the 18S ribosomal RNA gene has become a widely used and highly sensitive method for detecting Theileria spp. infections (Altay et al., 2008). PCR-based approaches have identified multiple Theileria lineages in cervids across East Asia, including the Reeves’ muntjac (Muntiacus reevesi), red deer (Cervus elaphus), and sika deer (Cervus nippon) in China, as well as Chinese water deer (Hydropotes inermis argyropus) in South Korea and sika deer in Japan (Han et al., 2009; Li et al., 2014; Yang et al., 2014; Lee et al., 2019). These findings highlight the widespread distribution of Theileria spp. infections in cervids and their implications for wildlife health and conservation. At Khao Kheow Open Zoo, Thailand, Theileria DNA has been detected in Eld’s deer (Rucervus eldii) and Indochinese serows (Capricornis sumatraensis) (Sanyathitiseree et al., 2008). Subsequent surveillance identified Theileria spp. in multiple ectoparasites, including the ticks Rhipicephalus microplus and Dermacentor auratus, and deer keds (Lipoptena spp.), together with species of Anaplasma and Babesia (Tiawsirisup et al., 2023; Sri-in et al., 2024). Despite these findings, M. feae and M. vaginalis have not been surveyed for Theileria spp. infections in Thailand, representing an important knowledge gap in regional epidemiology and conservation management.

While PCR provides direct molecular evidence of pathogen DNA, it provides limited information on parasite-associated biological processes and host-pathogen interactions (Beltran et al., 2017). In this context, proteomic approaches, particularly liquid chromatography-tandem mass spectrometry (LC-MS/MS), provide a powerful complementary strategy for identifying pathogen-associated proteins expressed during infection and characterizing their biological functions (Lee and Kim, 2022). Additionally, proteomic methodologies have been successfully applied to the investigation of parasite biology, host responses, and biomarker discovery in blood-borne pathogen infections, underscoring the value of serum proteomics for investigating complex host-parasite interactions (Lin et al., 2011; Pumpitakkul et al., 2024). Accordingly, this study aimed to investigate Theileria infection in M. feae and M. vaginalis in Thailand, examine the phylogenetic relationships of the detected Theileria spp. sequences, and characterize parasite-associated proteins using an integrated approach comprising PCR, DNA sequencing, and in-solution serum LC-MS/MS proteomics.

2. Materials and methods

2.1. Animals

A total of 34 adult animals, comprising 7 M. feae and 27 M. vaginalis, were included in this study. The ages of M. feae ranged from 3 years to 9 months to 16 years and 3 months. Although the exact ages of M. vaginalis were unavailable, all were confirmed to be adults based on zoo and wildlife breeding center records. Animals were sampled from four facilities across Thailand: Chiang Mai Zoo (Chiang Mai) and Khao Kheow Open Zoo (Chonburi), both under the Zoological Park Organization of Thailand (ZPOT), as well as Ton Nga Chang Wildlife Breeding Center (Songkhla) and Om Koi Wildlife Breeding Center (Chiang Mai), managed by the Department of National Parks, Wildlife and Plant Conservation (DNP). Detailed information on the individual animals is provided in Supplementary Table S1. All animals were born at their respective facility, except one M. feae (FM4F), which was acquired from an unrecorded outside source prior to the establishment of the current husbandry records. Across all participating facilities, animals received in-feed ivermectin approximately every four months, and long grass and vegetation were cleared weekly to reduce tick and other vector habitats. Sample collection was performed during routine veterinary examinations. None of the animals exhibited clinical signs commonly associated with blood-borne pathogen infections at the time of sampling, including anemia, jaundice, lethargy, or weight loss, which have been reported in clinically affected cervids and other ruminants (Yabsley et al., 2005; Stuen, 2020).

2.2. Sample collection and preparation

Blood samples were collected from jugular or cephalic veins during routine veterinary procedures using EDTA and serum clot activator vacutainer tubes for hematological/molecular analyses and serum preparation, respectively. Serum was obtained by allowing whole blood to clot at room temperature for 30–45 min, followed by centrifugation at 3000× g for 15 min at 4 °C. Complete blood count (CBC) and serum biochemistry were performed at the Vet Central Lab (Nonthaburi, Thailand). Thin blood smears were prepared and microscopically examined for hemopathogens following established protocols (Koonyosying et al., 2022). Reference intervals for hematological and blood chemistry parameters were based on available data for M. vaginalis in the Zoological Information Management System, due to the absence of species-specific reference values for M. feae (ZIMS, 2025).

For molecular analysis, genomic DNA was extracted from 600 μl of whole blood using the Quick-DNA Miniprep Plus Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. DNA concentration and purity were assessed using a Qubit Fluorometer and a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Extracted DNA was stored at −20 °C until PCR amplification. For proteomic analysis, serum was supplemented with Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific) at a 1:50 (v/v) ratio and stored at −20 °C until further analysis.

2.3. Molecular detection of blood-borne pathogens

Molecular detection of blood-borne pathogens was performed in all sampled animals using conventional PCR assays targeting the 18S rRNA gene of Theileria spp. and Babesia spp., and the 23S rRNA gene of members of the family Anaplasmataceae. Primer sequences, target genes, and expected amplicon sizes are summarized in Table 1. PCR assays for Theileria spp. and Babesia spp. were performed following the protocol of Sri-in et al. (2024), whereas detection of Anaplasmataceae followed Alhassan et al. (2021). PCR amplification was carried out using G-Storm (Gene Technologies, Essex, UK) and BIOER (BIOER Technology, Hangzhou, China) thermal cyclers. Previously confirmed pathogen-positive DNA samples were included as positive controls, while nuclease-free water was used as the no-template negative control in each PCR run. PCR products were separated by 1% (w/v) agarose gel electrophoresis in 1× TAE buffer, stained with Prime Juice DNA staining dye (Bio-Helix, New Taipei City, Taiwan), and visualized under ultraviolet illumination using a ChemiDoc imaging system (Bio-Rad Laboratories, Hercules, CA, USA).

Table 1.

PCR primers and target genes used for detection of blood-borne pathogens.

Target taxon Gene Primer Primer sequence (5′–3′) Amplicon size (bp) Reference
Theileria spp. 18S rRNA 989-F AGTTTCTGACCTATCAG 1098 Allsopp et al. (1993)
990-R TTGCCTTAAACTTCCTTG
Babesia spp. 18S rRNA Bab-F GTTTCTGMCCCCATCAGCTTGAC 420–440 Hilpertshauser et al. (2006)
Bab-R CAAGACAAAAAGCTGCTTGAAAC
Anaplasmataceae 23S rRNA A-23sF2 TCGATGGGAATCAGGTTAATATTCCTG 830 Alhassan et al. (2021)
A-23sR2 TTGTACTATAAAAGCTGATTTCCG
Open in a new tab

2.4. Sequencing and phylogenetic analysis

PCR products showing clear bands of the expected size were excised from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Purified PCR products were subjected to Sanger sequencing (ATCG, Pathum Thani, Thailand). Consensus nucleotide sequences were generated from forward and reverse Sanger sequencing reads using CodonCode Aligner version 13 (CodonCode Corporation, Centerville, MA, USA). Sequence orientation was verified by BLASTn comparison with homologous sequences in GenBank, and reverse-complement sequences were generated when necessary to ensure that all sequences were oriented in the 5′–3′ direction (Altschul et al., 1990). Reference sequences of Theileria spp. were retrieved from GenBank, and Babesia capreoli (GenBank: FJ944828.1) was included as the outgroup. The study and reference sequences were aligned using the ClustalW algorithm implemented in MEGA 12 (Kumar et al., 2024). The alignment was visually inspected, and poorly aligned and incompletely covered regions at the 5′- and 3′-ends were manually trimmed using CodonCode Aligner, resulting in a final alignment of 492 bp. The best-fit nucleotide substitution model was determined using the maximum-likelihood model selection procedure in MEGA 12. Phylogenetic relationships were reconstructed using the maximum-likelihood method under the Tamura 3-parameter model with gamma-distributed rate variation and a proportion of invariant sites (T92+G+I). The robustness of the tree topology was assessed using 1000 bootstrap replicates. The phylogenetic tree was rooted with B. capreoli as the outgroup.

2.5. In-solution serum protein digestion and LC-MS/MS analysis

Protein samples (5 μg per sample) were reduced with dithiothreitol (DTT), alkylated with iodoacetamide (IAA), and digested with sequencing-grade modified trypsin (Promega, Madison, WI, USA) in 10 mM ammonium bicarbonate using a standard in-solution digestion protocol. The resulting peptides were acidified with 0.1% formic acid and stored at −20 °C until LC-MS/MS analysis. Peptides (1 μl) were analyzed using an Ultimate 3000 Nano/Capillary LC system (Thermo Fisher Scientific) coupled to a ZenoTOF 7600 mass spectrometer (SCIEX, Marlborough, MA, USA). Peptides were separated on a C18 reverse-phase analytical column using a 5–55% acetonitrile gradient over 30 min at a flow rate of 0.30 μl/min. Mass spectrometry was performed in positive ion mode using data-dependent acquisition (Top 50). Each sample was analyzed in technical triplicate.

2.6. Data processing, statistical analysis, and bioinformatics

Raw LC-MS/MS data were processed using MaxQuant with the integrated Andromeda search engine (Tyanova et al., 2016). MS/MS spectra were searched against the UniProt Theileria database (taxon ID: 5874) with trypsin specified as the proteolytic enzyme. A maximum of two missed cleavages was allowed, and the precursor mass tolerance was set to 20 ppm. Carbamidomethylation of cysteine residues was defined as a fixed modification, whereas methionine oxidation and protein N-terminal acetylation were specified as variable modifications. Matching between runs was enabled to improve peptide and protein identification across samples. Protein identification was filtered at a false discovery rate (FDR) of 1% using a reverse-sequence decoy strategy, with a maximum of five modifications permitted per peptide. All other parameters were maintained at their default settings.

Label-free protein abundance was assessed using log2-transformed peptide ion intensities. Proteins lacking functional annotation in the reference database were excluded from further analysis. To ensure reliable protein detection, proteins were retained only if they were identified in at least 50% of individuals within each host group (i.e. ≥ 4/7 for M. feae and ≥ 15/27 for M. vaginalis), and only proteins detected in both host species were retained for subsequent analyses (Lazar et al., 2016; Tyanova et al., 2016). Missing values were treated as zero values during ranking analyses. To identify highly abundant proteins, the mean log2 intensity for each protein was calculated across all samples from both M. feae and M. vaginalis. Proteins were then ranked according to mean log2 intensity, number of supporting peptides, and sequence coverage. The top 20 proteins were selected for further characterization. Data processing and ranking were performed using custom scripts in R (v.4.3.0). Functional annotation was conducted using the eggNOG database to assign proteins to Clusters of Orthologous Groups (COG) functional categories and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways (Cantalapiedra et al., 2021). Gene Ontology (GO) annotations retrieved from UniProtKB/Swiss-Prot were used to further characterize the biological functions of the identified proteins. Functional and pathway distributions were visualized using bar plots generated with the ggplot2 package in R (v.4.3.0).

To explore functional relationships among the identified Theileria spp. proteins, protein-protein interaction (PPI) network analysis was performed on the top 20 abundant proteins. Because the identified proteins originated from multiple Theileria species, each protein was mapped to its closest ortholog in Theileria parva for STRING-based PPI analysis using the UniProt similarity search function. Proteins without identifiable orthologs were excluded from downstream analyses. The resulting T. parva ortholog identifiers were analyzed using the STRING database (v.12.0; taxonomy ID: 5875) using a minimum interaction confidence score of 0.400 and all interaction sources enabled (Szklarczyk et al., 2023).

3. Results

3.1. Hematological profiles

The hematological and blood chemistry profiles of all 34 muntjacs were determined (Supplementary Table S2). Most hematological and blood chemistry values were within the reference intervals for M. vaginalis, and no hemopathogens were detected by thin blood smear examination.

3.2. Molecular detection of blood-borne pathogens

PCR targeting the 18S rRNA gene detected Theileria spp. DNA in all examined animals (34/34), whereas Babesia spp. were below the detection limit of the PCR assay, and Anaplasmataceae were not detected in any of the examined animals. Representative PCR results are shown in Supplementary Fig. S1.

3.3. Sequencing and phylogenetic analysis

Of the Theileria-positive samples, 19 with PCR products of sufficient quality and quantity were subjected to Sanger sequencing, of which 15 yielded reliable sequences and were therefore included in the phylogenetic analysis. MJ19M was excluded because conflicting forward/reverse sequencing signals were consistent with a suspected mixed infection, whereas FM4F, MJ15F, and MJ32F were excluded because insufficient sequence coverage or forward/reverse read overlap prevented the generation of reliable consensus sequences. A total of 15 Theileria sequences, including one isolate from M. feae and 14 isolates from M. vaginalis, were submitted to the GenBank database under the accession numbers PZ295588-PZ295602. Additionally, the positive control amplicons from the Babesia spp. and Anaplasmataceae PCR assays were sequenced and showed the highest similarity to Babesia vogeli (99.28%) and Anaplasma platys (100%), respectively, supporting the specificity and performance of the corresponding assays.

Maximum-likelihood phylogenetic analysis of the partial 18S rRNA sequences revealed genetic heterogeneity among the Theileria spp. sequences obtained in this study (Fig. 1). Nine isolates (MJ23M, MJ29F, MJ27F, MJ37F, FM6M, MJ21M, MJ31F, MJ38F, and MJ22M) were positioned among Theileria cf. capreoli and T. capreoli reference sequences. Five isolates (MJ18F, MJ28M, MJ33F, MJ16F, and MJ24F) were positioned among other cervid-associated Theileria lineages. MJ17M was positioned separately from the other study isolates, with no bootstrap support for its placement. Overall, relationships involving the study isolates were weakly supported, whereas several reference lineages showed moderate to strong bootstrap support.

Fig. 1.

Fig. 1

Open in a new tab

Maximum-likelihood phylogenetic tree based on partial 18S rRNA gene sequences of Theileria spp. detected in the Fea’s muntjac (Muntiacus feae) and the northern red muntjac (Muntiacus vaginalis). Sequences obtained in this study are highlighted in blue, whereas reference sequences retrieved from the GenBank database are shown with their accession numbers and isolate codes. The tree was constructed using the maximum likelihood method under the T92+G+I model with 1000 bootstrap replicates. Babesia capreoli was included as the outgroup. The scale-bar represents the number of nucleotide substitutions per site.

Pairwise nucleotide sequence identity analysis revealed 99.79–100% identity among the nine isolates positioned among T. capreoli/T. cf. capreoli reference sequences and 99.39–99.79% identity between these isolates and their closest T. capreoli/T. cf. capreoli references. The five isolates positioned among other cervid Theileria lineages shared 99.38–100% identity with one another and 98.35–98.76% identity with their closest GenBank references. MJ17M showed 98.76% identity to its closest reference, T. cf. capreoli (GenBank: LC811654). Sequence identity between the two sets of isolates ranged from 97.53% to 97.94% (Supplementary Table S3).

3.4. Identification of Theileria spp. proteins in M. feae and M. vaginalis serum

Serum proteomic analysis identified 6886 Theileria-associated proteins in M. feae and 12,237 in M. vaginalis, with 6086 detected in both host species. After excluding proteins lacking functional annotation, 4399 proteins remained in M. feae and 7802 in M. vaginalis, including 3877 shared proteins. Application of the detection frequency criteria identified 414 proteins consistently detected in both host species, which were retained for downstream functional analyses. COG functional classification revealed that these proteins were distributed across multiple functional categories. The largest proportion of proteins was assigned to the “function unknown” category. Among the annotated categories, proteins involved in post-translational modification, protein turnover, and chaperones were the most abundant. Other highly represented categories included translation, RNA processing and modification, replication and repair, signal transduction mechanisms, and transcription (Fig. 2A). KEGG pathway analysis identified proteins associated with several cellular pathways. Metabolic pathways represented the largest KEGG category, followed by spliceosome, ribosome biogenesis in eukaryotes, purine metabolism, and pyrimidine metabolism (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

Functional annotation of the 414 shared Theileria-associated proteins identified in serum samples from the Fea’s muntjac (Muntiacus feae) and the northern red muntjac (Muntiacus vaginalis) based on eggNOG analysis. A Clusters of Orthologous Groups (COG) functional classification. B Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway annotation.

The 20 most abundant shared Theileria-associated proteins are summarized in Table 2, whereas all filtered shared proteins are provided in Supplementary Table S4. The top-ranked proteins represented diverse functional categories, including proteolysis, ubiquitin-mediated regulation, gene expression and RNA processing, intracellular transport, signal transduction, and lipid metabolism. Representative proteins included aspartyl protease and calpain catalytic domain-containing proteins, both associated with proteolysis (GO:0006508), E3 ubiquitin-protein ligases and RING-type domain-containing proteins, associated with protein ubiquitination (GO:0016567), lysine-tRNA ligase, pre-mRNA splicing factor 18, and ATP-dependent RNA helicase, with functions related to translation and RNA processing; as well as coatomer subunit gamma and t-SNARE coiled-coil domain-containing proteins, associated with intracellular transport. PNPLA domain-containing proteins, SfiI-subtelomeric related proteins, rhoptry-associated proteins, and several hypothetical membrane proteins were also identified among the top-ranked proteins.

Table 2.

Top 20 abundant Theileria-associated proteins identified in serum samples from Muntiacus feae and Muntiacus vaginalis.

Rank UniProt ID Protein name Peptide count Coverage (%) Log2 intensity (mean ± SD) Biological process (GO) Molecular function (GO)
1 Q4UD05 Aspartyl protease, putative (EC 3.4.23.-) 6 14.4 15.35 ± 1.51 Protein processing [GO:0016485] Aspartic-type endopeptidase activity [GO:0004190]
2 A0A976M5G6 Palmitoyltransferase (EC 2.3.1.225) 7 23.1 15.10 ± 1.26 Protein targeting to membrane [GO:0006612] Protein-cysteine S-palmitoyltransferase activity [GO:0019706]
3 J4C9B2 Coatomer subunit gamma 9 11.5 14.86 ± 0.93 Endoplasmic reticulum to Golgi vesicle-mediated transport [GO:0006888]; intra-Golgi vesicle-mediated transport [GO:0006891]; intracellular protein transport [GO:0006886]; protein secretion [GO:0009306] Structural molecule activity [GO:0005198]
4 A0A3B0MTQ6 SfiI-subtelomeric related protein family member, putative 49 22.4 14.51 ± 1.63 Not assigned Not assigned
5 Q4MZX2 Lysine-tRNA ligase (EC 6.1.1.6) (Lysyl-tRNA synthetase) 9 23.0 14.32 ± 1.52 Lysyl-tRNA aminoacylation [GO:0006430] ATP binding [GO:0005524]; lysine-tRNA ligase activity [GO:0004824]; tRNA binding [GO:0000049]
6 Q4U9F3 E3 ubiquitin-protein ligase (EC 2.3.2.27) 28 15.5 14.27 ± 1.57 Protein ubiquitination [GO:0016567]; ubiquitin-dependent protein catabolic process via the N-end rule pathway [GO:0071596] Ligase activity [GO:0016874]; ubiquitin protein ligase activity [GO:0061630]; zinc ion binding [GO:0008270]
7 Q4N7I3 RING-type domain-containing protein 10 11.5 14.27 ± 1.58 Protein ubiquitination [GO:0016567]; rescue of stalled ribosome [GO:0072344] Ribosome binding [GO:0043022]; ubiquitin protein ligase activity [GO:0061630]
8 J4DNM4 t-SNARE coiled-coil homology domain-containing protein 5 10.6 14.25 ± 1.58 Vesicle-mediated transport [GO:0016192] Not assigned
9 L0B3Q4 PNPLA domain-containing protein 10 16.0 13.88 ± 2.92 Lipid homeostasis [GO:0055088]; triglyceride catabolic process [GO:0019433] Triacylglycerol lipase activity [GO:0004806]
10 A0A976QWJ0 Zinc finger PHD-type domain-containing protein 43 15.0 13.80 ± 2.46 Not assigned Zinc ion binding [GO:0008270]
11 J4C2X2 Non-specific serine/threonine protein kinase (EC 2.7.11.1) 3 12.8 13.75 ± 1.32 Not assigned ATP binding [GO:0005524]; protein serine/threonine kinase activity [GO:0004674]
12 L0B128 Calpain catalytic domain-containing protein 5 7.1 13.63 ± 1.44 Proteolysis [GO:0006508] Calcium-dependent cysteine-type endopeptidase activity [GO:0004198]
13 Q4UI23 RING-type domain-containing protein 9 9.2 13.44 ± 2.53 Protein ubiquitination [GO:0016567]; rescue of stalled ribosome [GO:0072344] Ribosome binding [GO:0043022]; ubiquitin protein ligase activity [GO:0061630]
14 Q4UAX6 Theileria-specific hypothetical membrane protein, putative 24 15.5 13.22 ± 1.43 Not assigned Not assigned
15 J4CCM7 Pre-mRNA-splicing factor 18 33 24.2 12.99 ± 1.62 Generation of catalytic spliceosome for second transesterification step [GO:0000350] Not assigned
16 A0A976SKR9 Peroxisome-assembly ATPase (EC 3.6.4.7) 7 23.5 12.97 ± 0.81 Not assigned ATP binding [GO:0005524]; ATP hydrolysis activity [GO:0016887]
17 Q4UHI3 Tpr-related protein family member, putative 24 18.7 12.91 ± 2.63 Not assigned Not assigned
18 Q4MYW3 W2 domain-containing protein 18 31.8 12.78 ± 2.01 Not assigned Not assigned
19 Q4N797 ATP-dependent RNA helicase (EC 3.6.4.13) 12 29.2 12.64 ± 1.32 Not assigned ATP binding [GO:0005524]; hydrolase activity [GO:0016787]; RNA binding [GO:0003723]; RNA helicase activity [GO:0003724]
20 Q4N7W6 Rhoptry-associated protein 24 32.5 12.40 ± 1.34 Not assigned Not assigned
Open in a new tab

PPI network analysis using the STRING database (v.12.0) identified corresponding T. parva orthologs for 17 of the top 20 proteins, with three proteins excluded due to the absence of identifiable orthologs (Supplementary Table S5). Of the 17 mapped orthologs, six formed an interaction network comprising five predicted functional associations, with an average node degree of 0.588 and an average local clustering coefficient of 0.314 (Fig. 3). Within the STRING network, the ATP-dependent RNA helicase (Q4N797) showed the highest number of predicted interactions (n = 3), with the pre-mRNA splicing factor protein (Q4N6I7), the zinc finger protein (Q4N7K8), and the SfiI-subtelomeric related protein family member (Q4N8X8). All interactions were inferred from homologous protein evidence in other organisms.

Fig. 3.

Fig. 3

Open in a new tab

Protein-protein interaction network of the top 20 abundant Theileria-associated proteins identified in serum samples from the Fea’s muntjac (Muntiacus feae) and the northern red muntjac (Muntiacus vaginalis), constructed using the STRING database (v.12.0) with Theileria parva as the reference organism. Only proteins with predicted interactions are shown. Each node represents a protein, and edges indicate predicted functional associations based on evidence transferred from homologous proteins. The network comprised six nodes and five predicted functional associations. ATP-dependent RNA helicase (Q4N797) showed the highest number of predicted interactions (n = 3), with Q4N7K8, Q4N6I7, and Q4N8X8, whereas Q4N7I3 and Q4N3R9 formed a separate interaction pair. Abbreviations: Q4N3R9, E3 ubiquitin-protein ligase listerin; Q4N7I3, RING-type domain-containing protein; Q4N7K8, zinc finger protein; Q4N6I7, pre-mRNA splicing factor protein; Q4N797, ATP-dependent RNA helicase; Q4N8X8, SfiI-subtelomeric related protein family member.

4. Discussion

This study provides integrative molecular and proteomic evidence of Theileria spp. infection in captive M. feae and M. vaginalis in Thailand. PCR screening identified Theileria spp. DNA in all examined animals, whereas Babesia spp. were below the detection limit of the PCR assay and Anaplasmataceae were not detected. The non-specific amplification observed in the Babesia spp. PCR may have reduced assay sensitivity for the intended target, particularly at low infection levels. Despite universal Theileria PCR positivity, no parasites were observed by blood smear examination, and all animals appeared clinically healthy, with hematological and blood chemistry parameters generally remaining within reference ranges. These findings are consistent with previous reports of T. capreoli infection in red deer (Cervus elaphus), Theileria spp. infection in white-tailed deer (Odocoileus virginianus), and T. orientalis infection in red deer in New Zealand, where infected animals were clinically normal, and PCR was more sensitive than microscopy for detecting low-level infections (Sawczuk et al., 2008; Noaman, 2012; Gieger et al., 2020; Lawrence et al., 2024). Additionally, our findings are consistent with subclinical infection and suggest a potential role of captive muntjacs in parasite maintenance, particularly in environments where competent vectors are present (Tiawsirisup et al., 2023; Sri-in et al., 2024).

Because all study animals except FM4F, a Fea’s muntjac of unrecorded origin, were born at their respective facilities, the detection of Theileria spp. DNA across all sampled facilities suggests that local vector exposure may contribute to transmission within these captive populations rather than infection having been acquired exclusively before captivity. This interpretation is consistent with previous observations at Khao Kheow Open Zoo, where Rhipicephalus microplus, Dermacentor auratus, and deer keds (Lipoptena spp.) have been directly documented and molecularly linked to Theileria spp., Anaplasma spp., and Babesia spp. (Tiawsirisup et al., 2023; Sri-in et al., 2024). At Chiang Mai Zoo and Om Koi Wildlife Breeding Center, no facility-specific vector surveys have been conducted, although R. microplus has been reported on red muntjac elsewhere in Chiang Mai Province (Sumrandee et al., 2016). Similarly, at Ton Nga Chang Wildlife Breeding Center, Dermacentor ticks have been recorded within the surrounding wildlife sanctuary, although they were found on non-cervid hosts and were not screened for pathogens (Apanaskevich et al., 2021). Therefore, the precise source and timing of infection cannot be determined, and dedicated vector surveillance at these three facilities remains an important area for future research.

Notably, universal Theileria positivity was observed despite routine in-feed ivermectin administration and weekly vegetation clearance at all four facilities, suggesting that these measures may not have completely prevented vector exposure or transmission. In contrast, Babesia spp. were below the detection limit of the PCR assay, and Anaplasmataceae were not detected. However, these findings do not exclude low-level infections, as pathogen loads may fall below the sensitivity of conventional PCR (Alvarez et al., 2019). In addition, the non-specific amplification observed in the Babesia spp. PCR may have further reduced assay sensitivity for the intended target. Phylogenetic analysis of the partial 18S rRNA sequences demonstrated genetic heterogeneity among the Theileria spp. sequences detected in the present study. Most isolates were positioned among T. capreoli/T. cf. capreoli reference sequences or other cervid-associated Theileria lineages, whereas MJ17M was positioned separately. Pairwise sequence identity analysis revealed high similarity within each set of isolates but greater divergence between them. Nevertheless, species-level interpretation should be made cautiously because relationships involving the study isolates were generally weakly supported. The relatively conserved nature of the 18S rRNA gene may provide insufficient variation for robust discrimination among closely related Theileria species or genotypes. Accordingly, proximity of a study sequence to a particular reference sequence in the phylogenetic tree should not, by itself, be considered definitive evidence of species identity when the corresponding relationship lacks bootstrap support. These findings nevertheless indicate genetic heterogeneity among the Theileria sequences detected in the study population. Further characterization using additional or more variable molecular markers, longer sequence regions, or multilocus approaches would help clarify their taxonomic identities and evolutionary relationships.

While PCR provides direct molecular evidence of pathogen DNA, serum proteomics provides complementary information on parasite-associated biological processes. Rather than serving as an additional diagnostic method, the proteomic analysis was performed to characterize parasite-associated proteins detected during naturally occurring subclinical infection. Among the most abundant proteins identified were rhoptry-associated proteins, aspartyl protease, calpain catalytic domain-containing proteins, E3 ubiquitin-protein ligases, RING-type domain-containing proteins, and ATP-dependent RNA helicase. Together, these proteins were associated with parasite invasion, proteolysis, ubiquitin-mediated regulation, and gene expression, consistent with parasite-associated biological processes during subclinical infection. Rhoptry-associated proteins play key roles in host cell invasion and effector delivery, whereas proteases such as aspartyl proteases and calpain-like proteins contribute to protein processing and parasite development (Roiko and Carruthers, 2009; Ben et al., 2021). Likewise, E3 ubiquitin-protein ligases and RING-type domain-containing proteins are involved in ubiquitin-mediated regulation, which has been implicated in protein turnover, signaling, and host cell modulation in apicomplexan parasites (Pickart and Eddins, 2004; Marsolier et al., 2015). ATP-dependent RNA helicases are generally associated with RNA processing and gene expression. These findings are consistent with biological processes associated with parasite activity and intracellular survival (Linder and Jankowsky, 2011; Woods et al., 2021; Buckingham and Ashby, 2022). Although the biological significance of these proteins in cervid-associated Theileria spp. requires further experimental validation, their detection provides preliminary functional insight into parasite-associated biological processes during naturally occurring subclinical infection.

Because the entire captive population of M. feae in Thailand currently consists of only seven individuals, the detection of Theileria spp. DNA in clinically healthy animals highlights the importance of incorporating routine molecular surveillance into conservation breeding and animal translocation programmes. Although all animals were clinically healthy, subclinical carriers may contribute to parasite maintenance where competent tick vectors are present. Regular PCR-based screening, together with tick surveillance and health monitoring, may therefore help minimize pathogen transmission within captive populations and reduce disease risks associated with conservation translocations, consistent with current international recommendations for wildlife disease surveillance and translocation planning (IUCN/SSC, 2013; WOAH, IUCN, 2024). A limitation of the present study is that conventional PCR followed by direct Sanger sequencing cannot reliably resolve mixed infections of closely related Theileria species. Future studies using lineage-resolving molecular approaches will be required to determine the frequency and composition of mixed infections in captive muntjacs.

5. Conclusion

This study demonstrates the molecular detection of Theileria spp. in clinically healthy captive M. feae and M. vaginalis in Thailand, consistent with subclinical Theileria spp. infections. Molecular and phylogenetic analyses showed that most isolates were positioned among T. capreoli/T. cf. capreoli reference sequences or other cervid-associated Theileria lineages, while one isolate was positioned separately; relationships involving the study isolates were generally weakly supported. Additionally, our findings support the potential role of captive muntjacs in parasite maintenance, particularly in environments where competent vectors are present. Serum proteomics complemented PCR-based detection by providing functional insight into parasite-associated proteins detected during subclinical infection. Although the biological roles of these proteins require further experimental validation, integrating molecular detection with proteomic profiling provides a useful framework for investigating parasite-associated biological processes and host-parasite interactions in wildlife.

Ethical approval

All procedures were approved by the Chulalongkorn University Animal Care and Use Committee (CU-ACUC), Thailand (Approval No. 2131003).

CRediT authorship contribution statement

Pannawat Supapannachart: Methodology, Investigation, Formal analysis, Data curation, Visualization, Funding acquisition, Writing - original draft, Writing - review & editing. Sittiruk Roytrakul: Conceptualization, Methodology, Validation, Formal analysis, Supervision, Writing - review & editing. Narumon Phaonakrop: Investigation, Formal analysis. Thewarach Vechmanus: Investigation, Resources. Umaporn Maikaew: Investigation, Resources. Pridsana Sreepromma: Investigation, Resources. Karin Hirankailas: Investigation, Resources. Supatsorn Panyalert: Investigation, Resources. Thanapon Chotikaprakal: Methodology, Investigation. Sonthaya Tiawsirisup: Methodology, Validation, Supervision. Kritsada Thongmeesee: Methodology, Investigation. Rittidet Kongtawee: Methodology, Investigation. Piyanan Taweethavonsawat: Conceptualization, Methodology, Validation, Supervision. Gunnaporn Suriyaphol: Conceptualization, Methodology, Validation, Formal analysis, Funding acquisition, Supervision, Writing - review & editing.

Funding

This study was financially supported by the National Research Council of Thailand, the H.M. King Bhumibol Adulyadej 72nd Birthday Anniversary Scholarship from Chulalongkorn University, and the 90th Anniversary of Chulalongkorn University Scholarship (grant number GCUGR1125661059D). The funding bodies had no involvement in study design, data collection, data analysis, interpretation of results, or manuscript preparation.

Declaration of competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

The authors sincerely thank the veterinarians and field teams involved in sample collection at Khao Kheow Open Zoo, Chiang Mai Zoo, Ton Nga Chang Wildlife Breeding Center, and Om Koi Wildlife Breeding Center for their valuable assistance. The graphical abstract was created with BioRender.com.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.crpvbd.2026.100437.

Appendix A. Supplementary data

The following are the Supplementary data to this article.

Supplementary file 1: Supplementary Table S1. Information for Fea’s muntjac (Muntiacus feae) and northern red muntjac (Muntiacus vaginalis) individuals included in the study. Supplementary Table S2. Hematological and blood chemistry profiles of Fea’s muntjac and northern red muntjac in this study. Supplementary Table S3. Pairwise nucleotide sequence identities (%) among Theileria 18S rRNA sequences obtained in this study and selected reference sequences from GenBank.Multimedia component 1

mmc1.pdf (233.1KB, pdf)

Supplementary file 2: Supplementary Table S4. Complete list of Theileria-associated proteins consistently detected in serum samples from Fea’s muntjac (Muntiacus feae) and northern red muntjac (Muntiacus vaginalis) using in-solution LC-MS/MS proteomics. Supplementary Table S5. Corresponding Theileria parva orthologs of the top 20 abundant Theileria-associated proteins identified for STRING-based protein-protein interaction (PPI) network analysis.Multimedia componet 2

mmc2.xlsx (62.1KB, xlsx)

Supplementary file 3: Supplementary Fig. S1. Representative agarose gel electrophoresis results for PCR detection of Theileria spp., Anaplasmataceae, and Babesia spp. in blood samples from Fea’s muntjac (Muntiacus feae) and northern red muntjac (Muntiacus vaginalis).Multimedia componet 3

mmc3.pdf (184.7KB, pdf)

Data availability

All data generated or analyzed during this study are included in this published article and its supplementary files. The newly generated sequences were submitted to the GenBank database under the accession numbers PZ295588-PZ295602. The LC-MS/MS proteomics datasets generated during this study are available in the ProteomeXchange repository under the accession IDs JPST004619 and PXD078238 (via jPOST: https://repository.jpostdb.org/preview/16214697446a0249346d810.access.key.7806).

References

  1. Alhassan A., Hove P., Sharma B., Matthew-Belmar V., Karasek I., Lanza-Perea M., et al. Molecular detection and characterization of Anaplasma platys and Ehrlichia canis in dogs from the Caribbean. Ticks Tick Borne Dis. 2021;12 doi: 10.1016/j.ttbdis.2021.101727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Allsopp B.A., Baylis H.A., Allsopp M.T., Cavalier-Smith T., Bishop R.P., Carrington D.M., et al. Discrimination between six species of Theileria using oligonucleotide probes which detect small subunit ribosomal RNA sequences. Parasitology. 1993;107:157–165. doi: 10.1017/s0031182000067263. [DOI] [PubMed] [Google Scholar]
  3. Altay K., Aydin M.F., Dumanli N., Aktas M. Molecular detection of Theileria and Babesia infections in cattle. Vet. Parasitol. 2008;158:295–301. doi: 10.1016/j.vetpar.2008.09.025. [DOI] [PubMed] [Google Scholar]
  4. Altschul S.F., Gish W., Miller W., Myers E.W., Lipman D.J. Basic local alignment search tool. J. Mol. Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  5. Alvarez J.A., Rojas C., Figueroa J.V. Diagnostic tools for the identification of Babesia sp. in persistently infected cattle. Pathogens. 2019;8:143. doi: 10.3390/pathogens8030143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Apanaskevich D.A., Apanaskevich M.A., Nooma W., Ahantarig A., Trinachartvanit W. Reinstatement of Dermacentor tricuspis (Schulze, 1933) n. comb., n. stat. (Acari: Ixodidae) as a valid species, synonymization of D. atrosignatus Neumann, 1906 and description of a new species from Indonesia, Malaysia and Thailand. Syst. Parasitol. 2021;98:207–230. doi: 10.1007/s11230-021-09972-6. [DOI] [PubMed] [Google Scholar]
  7. Beltran P.M.J., Federspiel J.D., Sheng X., Cristea I.M. Proteomics and integrative omic approaches for understanding host-pathogen interactions and infectious diseases. Mol. Syst. Biol. 2017;13:922. doi: 10.15252/msb.20167062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ben C.R., Lentini G., Soldati‐Favre D. Biogenesis and discharge of the rhoptries: key organelles for entry and hijack of host cells by the Apicomplexa. Mol. Microbiol. 2021;115:453–465. doi: 10.1111/mmi.14674. [DOI] [PubMed] [Google Scholar]
  9. Buckingham L.J., Ashby B. Coevolutionary theory of hosts and parasites. J. Evol. Biol. 2022;35:205–224. doi: 10.1111/jeb.13981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Calchi A.C., Soares J.F., Machado R.Z., André M.R. Diversity of piroplasmids in wild animals in Brazil: a review. Rev. Bras. Parasitol. Vet. 2025;34 doi: 10.1590/s1984-29612025061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cantalapiedra C.P., Hernández-Plaza A., Letunic I., Bork P., Huerta-Cepas J. eggNOG-mapper v2: functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Mol. Biol. Evol. 2021;38:5825–5829. doi: 10.1093/molbev/msab293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cauvin A., Hood K., Shuman R., Orange J., Blackburn J.K., Sayler K.A., et al. The impact of vector control on the prevalence of Theileria cervi in farmed Florida white-tailed deer, Odocoileus virginianus. Parasites Vectors. 2019;12:100. doi: 10.1186/s13071-019-3344-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dantas-Torres F., Chomel B.B., Otranto D. Ticks and tick-borne diseases: a One Health perspective. Trends Parasitol. 2012;28:437–446. doi: 10.1016/j.pt.2012.07.003. [DOI] [PubMed] [Google Scholar]
  14. Francis C.M. 2nd ed. Bloomsbury Wildlife; London, UK: 2019. Field Guide to the Mammals of Southeast Asia. [Google Scholar]
  15. Gieger S., Furmaga E., World Organisation for Animal Health (WOAH) OIE Technical Disease Cards. World Organisation for Animal Health; Paris, France: 2020. Theileriosis in wildlife.https://www.woah.org/app/uploads/2021/05/theileria-spp-new-or-unusual-occurrencesinfection-with.pdf [Google Scholar]
  16. Han J.-I., Jang H.-J., Lee S.-J., Na K.-J. High prevalence of Theileria sp. in wild Chinese water deer (Hydropotes inermis argyropus) in South Korea. Vet. Parasitol. 2009;164:311–314. doi: 10.1016/j.vetpar.2009.05.027. [DOI] [PubMed] [Google Scholar]
  17. Hilpertshauser H., Deplazes P., Schnyder M., Gern L., Mathis A. Babesia spp. identified by PCR in ticks collected from domestic and wild ruminants in southern Switzerland. Appl. Environ. Microbiol. 2006;72:6503–6507. doi: 10.1128/AEM.00823-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. IUCN/SSC . IUCN Species Survival Commission; Gland, Switzerland: 2013. Guidelines for reintroductions and other conservation translocations: version 1.0.https://portals.iucn.org/library/node/10386 [Google Scholar]
  19. Koonyosying P., Rittipornlertrak A., Chomjit P., Sangkakam K., Muenthaisong A., Nambooppha B., et al. Incidence of hemoparasitic infections in cattle from central and northern Thailand. PeerJ. 2022;10 doi: 10.7717/peerj.13835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kumar S., Stecher G., Suleski M., Sanderford M., Sharma S., Tamura K. MEGA 12: Molecular Evolutionary Genetics Analysis version 12 for adaptive and green computing. Mol. Biol. Evol. 2024;41 doi: 10.1093/molbev/msae263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lawrence K.E., Gedye K., Carvalho L., Wang B., Fermin L.M., Pomroy W.E. Theileria orientalis Ikeda infection detected in red deer but not dogs or horses in New Zealand. N. Z. Vet. J. 2024;73:41–45. doi: 10.1080/00480169.2024.2393679. [DOI] [PubMed] [Google Scholar]
  22. Lazar C., Gatto L., Ferro M., Bruley C., Burger T. Accounting for the multiple natures of missing values in label-free quantitative proteomics data sets to compare imputation strategies. J. Proteome Res. 2016;15:1116–1125. doi: 10.1021/acs.jproteome.5b00981. [DOI] [PubMed] [Google Scholar]
  23. Lee H., Kim S.I. Review of liquid chromatography-mass spectrometry-based proteomic analyses of body fluids to diagnose infectious diseases. Int. J. Mol. Sci. 2022;23:2187. doi: 10.3390/ijms23042187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lee S.H., Moumouni P.F.A., Galon E.M., Vudriko P., Liu M., Benedicto B., et al. Differential diagnosis and molecular characterization of Theileria spp. in sika deer (Cervus nippon) in Hokkaido, Japan. Parasitol. Int. 2019;70:23–26. doi: 10.1016/j.parint.2019.01.005. [DOI] [PubMed] [Google Scholar]
  25. Li Y., Chen Z., Liu Z., Liu J., Yang J., Li Q., et al. Molecular identification of Theileria parasites of northwestern Chinese Cervidae. Parasites Vectors. 2014;7:225. doi: 10.1186/1756-3305-7-225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lin M., Kikuchi T., Brewer H.M., Norbeck A.D., Rikihisa Y. Global proteomic analysis of two tick-borne emerging zoonotic agents: Anaplasma phagocytophilum and Ehrlichia chaffeensis. Front. Microbiol. 2011;2:24. doi: 10.3389/fmicb.2011.00024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Linder P., Jankowsky E. From unwinding to clamping - the DEAD box RNA helicase family. Nat. Rev. Mol. Cell Biol. 2011;12:505–516. doi: 10.1038/nrm3154. [DOI] [PubMed] [Google Scholar]
  28. Marsolier J., Perichon M., DeBarry J.D., Villoutreix B.O., Chluba J., Lopez T., et al. Theileria parasites secrete a prolyl isomerase to maintain host leukocyte transformation. Nature. 2015;520:378–382. doi: 10.1038/nature14044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Morrison W.I., Hemmink J.D., Toye P.G. Theileria parva: a parasite of African buffalo, which has adapted to infect and undergo transmission in cattle. Int. J. Parasitol. 2020;50:403–412. doi: 10.1016/j.ijpara.2019.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Naveed M., Ijaz M., Ahmed A., Ghumman N.Z., Ishaq M., Muzammil I., et al. Molecular evidence, risk factors analysis, and hematological alterations associated with Theileria spp. spillover in captive wild mouflon sheep in Punjab, Pakistan. Iran. J. Vet. Res. 2022;23:349–357. doi: 10.22099/IJVR.2022.43496.6362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Noaman V. Comparison of molecular and microscopic technique for detection of Theileria spp. in carrier cattle. J. Parasit. Dis. 2012;38:64–67. doi: 10.1007/s12639-012-0196-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. ONEP . Office of Natural Resources and Environmental Policy and Planning (ONEP), Ministry of Natural Resources and Environment, Bangkok, Thailand; 2020. Thailand national red list: threatened species assessment 2020.https://chm-thai.onep.go.th/?page_id=920 [Google Scholar]
  33. Pickart C.M., Eddins M.J. Ubiquitin: structures, functions, mechanisms. Biochim. Biophys. Acta. 2004;1695:55–72. doi: 10.1016/j.bbamcr.2004.09.019. [DOI] [PubMed] [Google Scholar]
  34. Pumpitakkul V., Roytrakul S., Phaonakrop N., Suriyaphol G. Serum proteomic profile of subclinical Babesia bovis infection in PCR-positive Eld’s deer using serum protein electrophoresis coupled with LC-MS/MS. Thai J. Vet. Med. 2024;54:155–173. https://he01.tci-thaijo.org/index.php/tjvm/article/view/277514 [Google Scholar]
  35. Remesar S., Díaz P., Prieto A., Markina F., Cao J.M.D., López-Lorenzo G., et al. Prevalence and distribution of Babesia and Theileria species in roe deer from Spain. Int. J. Parasitol. Parasites Wildl. 2019;9:195–201. doi: 10.1016/j.ijppaw.2019.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Riaz M., Nasreen N., Khan A., Said M. Differential diagnosis of theileriosis through blood smear examination and polymerase chain reaction in small ruminants from Pakistan. Open Vet. J. 2023;13:697. doi: 10.5455/ovj.2023.v13.i6.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Roiko M.S., Carruthers V.B. New roles for perforins and proteases in apicomplexan egress. Cell. Microbiol. 2009;11:1444–1452. doi: 10.1111/j.1462-5822.2009.01357.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sanyathitiseree P., Lertwatcharasarakul P., Thougtip N., Phatthanakunanan S., Jala S., Tanwattana W., et al. Identification of Theileria in endangered serow and endangered Eld’s deer in Thailand. Infect. Genet. Evol. 2008;8:S45. doi: 10.1016/j.meegid.2008.01.008. [DOI] [Google Scholar]
  39. Sawczuk M., Maciejewska A., Skotarczak B. Identification and molecular characterization of Theileria sp. infecting red deer (Cervus elaphus) in northwestern Poland. Eur. J. Wildl. Res. 2008;54:225–230. doi: 10.1007/s10344-007-0133-z. [DOI] [Google Scholar]
  40. Sri-in C., Thongmeesee K., Wechtaisong W., Yurayart N., Rittisornthanoo G., Akarapas C., et al. Tick diversity and molecular detection of Anaplasma, Babesia, and Theileria from Khao Kheow open zoo, Chonburi Province, Thailand. Front. Vet. Sci. 2024;11 doi: 10.3389/fvets.2024.1430892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Stuen S. Haemoparasites - challenging and wasting infections in small ruminants: a review. Animals. 2020;10:2179. doi: 10.3390/ani10112179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sumrandee C., Baimai V., Trinachartvanit W., Ahantarig A. Molecular detection of Rickettsia, Anaplasma, Coxiella and Francisella bacteria in ticks collected from Artiodactyla in Thailand. Ticks Tick Borne Dis. 2016;7:678–689. doi: 10.1016/j.ttbdis.2016.02.015. [DOI] [PubMed] [Google Scholar]
  43. Supapannachart P., Jenjaroenpun P., Wongsurawat T., Tangphatsornruang S., Pootakham W., Sonthirod C., et al. Genome assembly of the threatened Fea’s muntjac (Muntiacus feae) reveals adaptive evolution and comparative population genomics of Fea’s and red muntjacs. Anim. Genet. 2026;57 doi: 10.1002/age.70093. [DOI] [PubMed] [Google Scholar]
  44. Supapannachart P., Tangphatsornruang S., Pootakham W., Sonthirod C., Tongsima S., Wangkumhang P., et al. Genome-wide SNP data reveal genetic relatedness and structure in an ex-situ population of threatened Fea’s muntjac (Muntiacus feae) (Artiodactyla, Cervidae) ZooKeys. 2026;1283:223–239. doi: 10.3897/zookeys.1283.186911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Szklarczyk D., Kirsch R., Koutrouli M., Nastou K., Mehryary F., Hachilif R., et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023;51:D638–D646. doi: 10.1093/nar/gkac1000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tiawsirisup S., Yurayart N., Thongmeesee K., Sri-in C., Akarapas C., Rittisornthanoo G., et al. Possible role of Lipoptena fortisetosa (Diptera: Hippoboscidae) as a potential vector for Theileria spp. in captive Eld’s deer in Khao Kheow open zoo, Thailand. Acta Trop. 2023;237 doi: 10.1016/j.actatropica.2022.106737. [DOI] [PubMed] [Google Scholar]
  47. Timmins R.J., Steinmetz R., Chutipong W. The IUCN Red List of Threatened Species 2016: e.T13927A22160266. 2016. Muntiacus feae. [DOI] [Google Scholar]
  48. Timmins R.J., Steinmetz R., Samba Kumar N., Anwarul Islam M., Sagar Baral H. The IUCN Red List of Threatened Species 2016: e.T136551A22165292. 2016. Muntiacus vaginalis. [DOI] [Google Scholar]
  49. Tyanova S., Temu T., Sinitcyn P., Carlson A., Hein M.Y., Geiger T., et al. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods. 2016;13:731–740. doi: 10.1038/nmeth.3901. [DOI] [PubMed] [Google Scholar]
  50. WOAH, IUCN . World Organisation for Animal Health (WOAH), Paris & International Union for Conservation of Nature (IUCN), Gland; 2024. General guidelines for surveillance of diseases, pathogens and toxic agents in free-ranging wildlife: an overview for wildlife authorities and others working with wildlife. [DOI] [Google Scholar]
  51. Woods K., Perry C., Brühlmann F., Olias P. Theileria’s strategies and effector mechanisms for host cell transformation: from invasion to immortalization. Front. Cell Dev. Biol. 2021;9 doi: 10.3389/fcell.2021.662805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yabsley M.J., Quick T.C., Little S.E. Theileriosis in a white-tailed deer (Odocoileus virginianus) fawn. J. Wildl. Dis. 2005;41:806–809. doi: 10.7589/0090-3558-41.4.806. [DOI] [PubMed] [Google Scholar]
  53. Yang J., Li Y., Liu Z., Liu J., Guan G., Chen Z., et al. Molecular evidence for piroplasms in wild Reeves’ muntjac (Muntiacus reevesi) in China. Parasitol. Int. 2014;63:713–716. doi: 10.1016/j.parint.2014.06.002. [DOI] [PubMed] [Google Scholar]
  54. Zanet S., Trisciuoglio A., Bottero E., de Mera I.G.F., Gortazar C., Carpignano M.G., et al. Piroplasmosis in wildlife: Babesia and Theileria affecting free-ranging ungulates and carnivores in the Italian Alps. Parasites Vectors. 2014;7:70. doi: 10.1186/1756-3305-7-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. ZIMS . Species360 Zoological Information Management System (ZIMS); 2025. Muntiacusvaginalis.http://zims.species360.org [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file 1: Supplementary Table S1. Information for Fea’s muntjac (Muntiacus feae) and northern red muntjac (Muntiacus vaginalis) individuals included in the study. Supplementary Table S2. Hematological and blood chemistry profiles of Fea’s muntjac and northern red muntjac in this study. Supplementary Table S3. Pairwise nucleotide sequence identities (%) among Theileria 18S rRNA sequences obtained in this study and selected reference sequences from GenBank.Multimedia component 1

mmc1.pdf (233.1KB, pdf)

Supplementary file 2: Supplementary Table S4. Complete list of Theileria-associated proteins consistently detected in serum samples from Fea’s muntjac (Muntiacus feae) and northern red muntjac (Muntiacus vaginalis) using in-solution LC-MS/MS proteomics. Supplementary Table S5. Corresponding Theileria parva orthologs of the top 20 abundant Theileria-associated proteins identified for STRING-based protein-protein interaction (PPI) network analysis.Multimedia componet 2

mmc2.xlsx (62.1KB, xlsx)

Supplementary file 3: Supplementary Fig. S1. Representative agarose gel electrophoresis results for PCR detection of Theileria spp., Anaplasmataceae, and Babesia spp. in blood samples from Fea’s muntjac (Muntiacus feae) and northern red muntjac (Muntiacus vaginalis).Multimedia componet 3

mmc3.pdf (184.7KB, pdf)

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its supplementary files. The newly generated sequences were submitted to the GenBank database under the accession numbers PZ295588-PZ295602. The LC-MS/MS proteomics datasets generated during this study are available in the ProteomeXchange repository under the accession IDs JPST004619 and PXD078238 (via jPOST: https://repository.jpostdb.org/preview/16214697446a0249346d810.access.key.7806).

Articles from Current Research in Parasitology & Vector-borne Diseases are provided here courtesy of Elsevier

RESOURCES